[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.19 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk056-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk056-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk056.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.0 = CTTGGCTAGATCTGAA-1

using 20875 reads

====================================================================================

graph has 6486 edges initially, 84 edges after simplification

total ucounts = 964
nonsolo ucounts = 463[2^200, 3^73, 4^41, 5^35, 6^17, 7^7, 8^6, 9^3, 10^3, 11^4, 12, 13, 14, 15^4, 29, 31, 56, 127, 140, 144, 172, 175, 182^2, 190, 194, 207, 212, 234, 235, 236^2, 240, 242, 246, 258, 259, 262, 266, 271, 273^2, 274, 276, 277, 281, 282, 283, 293, 295, 296^3, 302, 303, 307, 310, 315, 318, 323, 324, 327, 332, 334, 337, 343, 345^2, 346, 348, 352^2, 360, 374, 385, 391, 394, 417, 418, 543, 751]
surviving nonsolo ucounts = 64[11, 140, 144, 172, 175, 182^2, 190, 194, 207, 212, 234, 235, 236^2, 240, 242, 246, 258, 259, 262, 266, 271, 273^2, 274, 276, 277, 281, 282, 283, 293, 295, 296^3, 302, 303, 307, 310, 315, 318, 323, 324, 327, 332, 334, 337, 343, 345^2, 346, 348, 352^2, 360, 374, 385, 391, 394, 417, 418, 543, 751]
ids = [881, 525, 178, 519, 890, 77, 476, 558, 220, 770, ...]

====================================================================================

UMI info for barcode CTTGGCTAGATCTGAA-1 contig 1 = AGAGCTCTGG...
umi AAACTTCAGG = 755 reads: -240X +145 invalidated
umi AGTCTATCGA = 186 reads: +312 -1X +1 -6X +1 -1 +63 invalidated
umi ATCCTTGTGC = 316 reads: +385 validated
umi ATCTGTTCTT = 213 reads: +385 validated
umi CAAAGCGTCC = 335 reads: +385 validated
umi CACCTACTTG = 381 reads: +385 validated
umi CACTTACTTT = 358 reads: +385 validated
umi CATAAACTTT = 254 reads: +385 validated
umi CATTCTTTCA = 411 reads: +385 validated
umi CCAATTTACA = 324 reads: +385 validated
umi CCAGGACAAC = 298 reads: +385 validated
umi CCCAACCTTC = 324 reads: +385 validated
umi CCCACTTGTA = 286 reads: +385 validated
umi CCCCTGTTTT = 276 reads: +385 validated
umi CCCGATCGTT = 332 reads: +385 validated
umi CCGGGGCGTC = 240 reads: +385 validated
umi CGTGGCAGCA = 269 reads: +385 validated
umi CGTTATCGGG = 295 reads: +385 validated
umi CTACGCCAAA = 345 reads: +385 validated
umi CTGCGAAACT = 275 reads: +385 validated
umi CTTTGCGTTT = 277 reads: +385 validated
umi GAACGACCTC = 260 reads: +385 validated
umi GAATTGTCTT = 352 reads: +385 validated
umi GACTTTTCTT = 249 reads: +385 validated
umi GAGACGTGCT = 142 reads: +385 validated
umi GAGGCCCATT = 351 reads: +385 validated
umi GATGTATATT = 300 reads: +385 validated
umi GCAACACTCG = 287 reads: +235 -1XX +149 invalidated
umi GCCAGGGGCA = 189 reads: -348 +37 non-validated
umi GCGTGCGTTT = 317 reads: +385 validated
umi GCTGCCTGGG = 393 reads: +385 validated
umi GTACCCAGCT = 317 reads: +385 validated
umi GTCCATCGCG = 297 reads: +385 validated
umi GTTCTTCCCT = 305 reads: +385 validated
umi GTTTCTTCCT = 262 reads: +385 validated
umi TAATATCTGC = 340 reads: +385 validated
umi TACAATTATG = 277 reads: +385 validated
umi TCACATCTTA = 544 reads: -98 +287 non-validated
umi TCAGTTAGGC = 205 reads: +385 validated
umi TCCAGTAGAG = 416 reads: +385 validated
umi TCCCTAGTGC = 235 reads: +385 validated
umi TCCGCCCCTC = 325 reads: +385 validated
umi TCCGTCCGTC = 245 reads: +134 -7XX +244 invalidated
umi TCGTTGGGAG = 281 reads: +385 validated
umi TCTAGCGCAA = 298 reads: +385 validated
umi TCTATAAGGG = 353 reads: +385 validated
umi TCTGCAAGCA = 333 reads: +385 validated
umi TGCCGGCCTC = 328 reads: +385 validated
umi TGGGAACATT = 380 reads: +385 validated
umi TTAGCCGGGA = 180 reads: +385 validated
umi TTTAAAGGGG = 236 reads: +385 validated
umi TTTATACCTT = 367 reads: +385 validated
umi TTTGTTGGTT = 303 reads: +385 validated

UMI info for barcode CTTGGCTAGATCTGAA-1 contig 2 = GGATCACTCA...
umi CATACCCGTG = 137 reads: +451 validated
umi CCACGTGGTT = 191 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
391-429 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 51 umis using 2429 reads
cdr3 = CQQYGSSLSTF at 368, score = 9 + 8
umis assigned: [1, 77, 98, 101, 113, 152, 162, 175, 203, 216] and 43 others
of which 53 are surviving nonsolos
reads assigned: 16096
start codons at 44, 252, 378, 471
confident = true

TIG 2[bases=517]
60-413 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=0)
424-445 ==> 0-21 on |21|IGHD3-3|D-REGION| [len=31] (mis=0)
460-511 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=0)
junction support: 2 umis using 24 reads
cdr3 = CARGPRGSITIFGVALPRADNWFDPW at 402, score = 9 + 7
umis assigned: [178, 220]
of which 2 are surviving nonsolos
reads assigned: 321
start codons at 60, 211, 258, 263, 267, 295, 324, 357
confident = true

REJECT CONTIGS

TIG 1[bases=634]
0-97 ==> 78-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
97-460 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=0)
460-498 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
498-634 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [124, 296, 425, 476, 519, 761]
of which 6 are surviving nonsolos
reads assigned: 1468
start codons at 97, 166, 419, 540
confident = false
did not find CDR3
now this is a cell
paired!

GGCCCCCGTGGTAGTATTACGATTTTTGGAGTGGCCCTCCCCCGGGCCGACAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACTCTCCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.4 = CTTGGCTAGCAGGTCA-1

using 313 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 305]
surviving nonsolo ucounts = 1[305]
ids = [3]

====================================================================================

UMI info for barcode CTTGGCTAGCAGGTCA-1 contig 1 = GGGAGTCTCA...
umi GAACATGGAC = 308 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=544]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=4)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQSYSTITF at 350, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 304
start codons at 23, 29, 85, 98, 234, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.13 = CTTGGCTAGGACATTA-1

using 218 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 213]
surviving nonsolo ucounts = 1[213]
ids = [2]

====================================================================================

UMI info for barcode CTTGGCTAGGACATTA-1 contig 1 = GGAATCAGTC...
umi TACGACGTAA = 194 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=491]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-491 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.15 = CTTGGCTAGGCCCTCA-1

using 373 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 6, 7, 19, 333]
surviving nonsolo ucounts = 1[333]
ids = [10]

====================================================================================

REJECT CONTIGS

TIG 1[bases=519]
0-35 ==> 140-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
35-398 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
393-430 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
430-519 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 35, 104, 357, 472
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.17 = CTTGGCTAGGGATGGG-1

using 343 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 333]
surviving nonsolo ucounts = 1[333]
ids = [4]

====================================================================================

UMI info for barcode CTTGGCTAGGGATGGG-1 contig 1 = GGAGGAACTG...
umi CATGGCTATA = 310 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=496]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
416-496 ==> 0-80 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQRSNWPLTF at 355, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 34, 242, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.28 = CTTGGCTAGTCCATAC-1

using 1330 reads

====================================================================================

graph has 1791 edges initially, 65 edges after simplification

total ucounts = 681
nonsolo ucounts = 265[2^125, 3^62, 4^37, 5^14, 6^8, 7^5, 8^5, 9^5, 10, 12, 13, 57]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.35 = CTTGGCTAGTGTTTGC-1

using 200 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 193]
surviving nonsolo ucounts = 1[193]
ids = [6]

====================================================================================

UMI info for barcode CTTGGCTAGTGTTTGC-1 contig 1 = CCCTCCTTGG...
umi TACCGTCTCT = 187 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=500]
0-39 ==> 20-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
39-392 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
441-475 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
475-500 ==> 0-25 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 381, score = 7 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 39, 237, 242, 259, 303, 336
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.36 = CTTGGCTCAAACTGCT-1

using 292 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 2[2, 280]
surviving nonsolo ucounts = 1[280]
ids = [11]

====================================================================================

UMI info for barcode CTTGGCTCAAACTGCT-1 contig 1 = GCTCTGCCTC...
umi TTCAGTGAGC = 269 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=581]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=9)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
445-581 ==> 0-136 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQSYDTSLSGSNVF at 375, score = 8 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.39 = CTTGGCTCAACTGCTA-1

using 767 reads

====================================================================================

graph has 238 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 214, 220, 326]
surviving nonsolo ucounts = 3[214, 220, 326]
ids = [6, 2, 7]

====================================================================================

UMI info for barcode CTTGGCTCAACTGCTA-1 contig 1 = ATCAGTCCCA...
umi GATTCCTTTC = 218 reads: +388 validated
umi TATTGACGCG = 209 reads: +388 validated
umi TTACACTGTA = 336 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 119 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [2, 6, 7]
of which 3 are surviving nonsolos
reads assigned: 749
start codons at 23, 29, 98, 234, 453
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.51 = CTTGGCTCACCAACCG-1

using 230 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 3, 218]
surviving nonsolo ucounts = 1[218]
ids = [1]

====================================================================================

UMI info for barcode CTTGGCTCACCAACCG-1 contig 1 = GGGCCTAAGG...
umi AGCCAGCTAG = 221 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=628]
0-35 ==> 216-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
35-367 ==> 0-332 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=32)
379-417 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
417-628 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQVWDRSRDHVVF at 350, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 35, 96, 183, 234, 378
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.62 = CTTGGCTCAGACACTT-1

using 273 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[273]
surviving nonsolo ucounts = 1[273]
ids = [0]

====================================================================================

UMI info for barcode CTTGGCTCAGACACTT-1 contig 1 = GGGGTCACAA...
umi CTATGCTTCT = 276 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=590]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
395-423 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
423-590 ==> 0-167 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 38 reads
cdr3 = CFSYGTSGRTF at 362, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 38, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.70 = CTTGGCTCAGCGTTCG-1

using 7760 reads

====================================================================================

graph has 6003 edges initially, 94 edges after simplification

total ucounts = 1200
nonsolo ucounts = 903[2^148, 3^137, 4^106, 5^90, 6^56, 7^73, 8^53, 9^56, 10^45, 11^33, 12^25, 13^23, 14^8, 15^15, 16^6, 17^8, 18, 19^5, 20, 21^2, 22^2, 23^2, 24^2, 32, 216, 221, 274, 510, 560]
surviving nonsolo ucounts = 5[216, 221, 274, 510, 560]
ids = [679, 795, 132, 393, 209]

====================================================================================

UMI info for barcode CTTGGCTCAGCGTTCG-1 contig 1 = TGAGCGCAGA...
umi ACGTCCACCG = 272 reads: +388 validated
umi GCATGATTAT = 218 reads: +388 validated
umi GTAGTTTCCA = 220 reads: +388 validated

UMI info for barcode CTTGGCTCAGCGTTCG-1 contig 2 = AGTGACTCCT...
umi CCAAATCTAT = 511 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=635]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=5)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 90 reads
cdr3 = CETWDSSLNAGVF at 357, score = 7 + 8
umis assigned: [132, 679, 795]
of which 3 are surviving nonsolos
reads assigned: 697
start codons at 36, 184, 190, 241, 365, 382
confident = true

TIG 2[bases=500]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=9)
393-429 ==> 10-46 on |54|IGHJ4|J-REGION| [len=46] (mis=1)
429-500 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CARRRGGYPNW at 365, score = 7 + 6
umis assigned: [393]
of which 1 are surviving nonsolos
reads assigned: 498
start codons at 20, 64, 243, 246, 326, 335
confident = true

REJECT CONTIGS

TIG 1[bases=447]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
28-86 ==> 5638-5696 on segment before IGLV3-29 exon 1 [len=6000] (mis=4)
40-122 ==> 0-82 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=2)
112-201 ==> 262-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=3) [SHIFT!]
198-236 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
236-447 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [209, 221]
of which 1 are surviving nonsolos
reads assigned: 556
start codons at 40, 101, 148
confident = false
did not find CDR3
now this is a cell
paired!

ACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACGCAGGAGGGGGGGTTACCCCAACTGGGGCCAGGGAGCCCTGGTCACCGTCTCCTCAG <==> GGACTCCAGACTGGGGACGAGGCCGATTATTACTGCGAAACATGGGATAGCAGCCTGAATGCTGGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAA

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.79 = CTTGGCTCAGTAAGAT-1

using 4777 reads

====================================================================================

graph has 2619 edges initially, 56 edges after simplification

total ucounts = 848
nonsolo ucounts = 378[2^171, 3^87, 4^38, 5^27, 6^17, 7^8, 8^4, 9^5, 10, 13, 14, 23, 31, 78, 89, 112, 153, 155, 161, 184, 195, 226, 233, 242, 244, 250, 252^2, 265]
surviving nonsolo ucounts = 15[89, 112, 153, 155, 161, 184, 195, 226, 233, 242, 244, 250, 252^2, 265]
ids = [87, 354, 638, 836, 156, 277, 358, 655, 158, 295, ...]

====================================================================================

UMI info for barcode CTTGGCTCAGTAAGAT-1 contig 1 = GCTGTGCTGT...
umi ATATTGTTTC = 263 reads: +379 validated
umi ATCAATCCTA = 253 reads: +379 validated
umi CATATGTGGC = 163 reads: +379 validated
umi CATCAAGGTA = 232 reads: +379 validated
umi CATCTCCTCC = 248 reads: +379 validated
umi CATTTTACTC = 254 reads: +379 validated
umi CCTAACACTA = 185 reads: +379 validated
umi CCTGTCTGGC = 243 reads: +379 validated
umi CGTCTCCCTA = 111 reads: +379 validated
umi CGTGGACCAC = 198 reads: +379 validated
umi TATTATCGGT = 150 reads: +379 validated
umi TCACTATTCG = 228 reads: +379 validated
umi TGTCCTTTGT = 241 reads: +379 validated
umi TTTGGAAACA = 152 reads: +379 validated

UMI info for barcode CTTGGCTCAGTAAGAT-1 contig 2 = AGCTCTGAGA...
umi ATTCACGCCA = 86 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=633]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=14)
384-422 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
422-633 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 14 umis using 460 reads
cdr3 = CQSAHSSGAYVF at 358, score = 8 + 8
umis assigned: [69, 70, 156, 158, 162, 184, 277, 295, 354, 358] and 4 others
of which 14 are surviving nonsolos
reads assigned: 2886
start codons at 43, 173, 251, 386, 554
confident = true

TIG 2[bases=506]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=1)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=10)
446-494 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
junction support: 1 umis using 7 reads
cdr3 = CAKVGGATLGFDNW at 421, score = 9 + 7
umis assigned: [87]
of which 1 are surviving nonsolos
reads assigned: 85
start codons at 79, 235
confident = true
now this is a cell
paired!

AGAGCCGAGGACACGGCCCTATATTACTGTGCGAAAGTGGGAGGTGCAACCTTGGGCTTTGACAACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGTGGAGTCCAGGCAGAAGACGAGGCTGACTATTACTGTCAATCAGCACACAGCAGTGGTGCGTATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.84 = CTTGGCTCATAAGACA-1

using 54 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 9[2^4, 4, 6, 7, 8, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.87 = CTTGGCTCATCACCCT-1

using 323 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[4, 312]
surviving nonsolo ucounts = 1[312]
ids = [3]

====================================================================================

UMI info for barcode CTTGGCTCATCACCCT-1 contig 1 = AATCAGTCCC...
umi AGTACTACGC = 269 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=474]
0-24 ==> 3-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
24-375 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-474 ==> 0-62 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CLQYSSSPWTF at 351, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 24, 30, 99, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.92 = CTTGGCTCATGAAGTA-1

using 332 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 6, 318]
surviving nonsolo ucounts = 1[318]
ids = [8]

====================================================================================

UMI info for barcode CTTGGCTCATGAAGTA-1 contig 1 = GGAGTCAGTC...
umi TTCACCATAG = 319 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 32-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
26-377 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=6)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQLHDYPITF at 353, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 313
start codons at 26, 32, 88, 237, 366, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.94 = CTTGGCTCATGCCACG-1

using 378 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 25
nonsolo ucounts = 9[2^5, 4^2, 5, 339]
surviving nonsolo ucounts = 1[339]
ids = [6]

====================================================================================

UMI info for barcode CTTGGCTCATGCCACG-1 contig 1 = TGGGGGATCA...
umi CCCGACAGTA = 340 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=571]
35-395 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=10)
396-435 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CMQGTHWPPYTF at 371, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 335
start codons at 35, 68, 96, 104, 192, 354, 374, 477
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.102 = CTTGGCTCATTAGGCT-1

using 262 reads

====================================================================================

graph has 104 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2, 3, 5^2, 6, 8, 229]
surviving nonsolo ucounts = 1[229]
ids = [2]

====================================================================================

UMI info for barcode CTTGGCTCATTAGGCT-1 contig 1 = GGCTGGGGTC...
umi ACGGGTCGCA = 220 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=569]
42-386 ==> 0-344 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=20)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
430-569 ==> 0-139 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CSSYISSTTLGF at 366, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 42, 250, 253, 562
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.103 = CTTGGCTCATTCACTT-1

using 29 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[3, 6, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.105 = CTTGGCTCATTGAGCT-1

using 16 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.107 = CTTGGCTGTAAACACA-1

using 220 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 6, 204]
surviving nonsolo ucounts = 1[204]
ids = [4]

====================================================================================

UMI info for barcode CTTGGCTGTAAACACA-1 contig 1 = GGAGTCAGAC...
umi TGCGATAGGG = 194 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=489]
0-26 ==> 3-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
26-377 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
414-489 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CLQDYTYPFSF at 353, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 26, 32, 88, 101, 183, 186, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.128 = CTTGGCTGTATATCCG-1

using 476 reads

====================================================================================

graph has 234 edges initially, 4 edges after simplification

total ucounts = 49
nonsolo ucounts = 12[2^4, 3^3, 4, 7, 30, 91, 290]
surviving nonsolo ucounts = 1[290]
ids = [6]

====================================================================================

UMI info for barcode CTTGGCTGTATATCCG-1 contig 1 = TGGGGTCTCA...
umi ACTAGCATAA = 282 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=582]
0-39 ==> 2-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
39-389 ==> 0-350 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
430-582 ==> 0-152 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CSSYTSSSTHVVF at 363, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 39, 196, 240, 247, 391
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.136 = CTTGGCTGTCACCTAA-1

using 307 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 302]
surviving nonsolo ucounts = 1[302]
ids = [3]

====================================================================================

UMI info for barcode CTTGGCTGTCACCTAA-1 contig 1 = GGAATCAGTC...
umi TCAAAAGACA = 297 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 292
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.137 = CTTGGCTGTCAGAAGC-1

using 343 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[6, 334]
surviving nonsolo ucounts = 1[334]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=572]
0-29 ==> 5-34 on |62|IGHV1-18|5'UTR| [len=59] (mis=0)
0-29 ==> 5-34 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
0-29 ==> 11310-11339 on rc of segment before IGHV3-19 exon 1 [len=11364] (mis=0)
30-329 ==> 54-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
378-412 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
412-572 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 318, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 174, 179, 196, 240, 273, 466
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.138 = CTTGGCTGTCAGTGGA-1

using 1615 reads

====================================================================================

graph has 2212 edges initially, 42 edges after simplification

total ucounts = 749
nonsolo ucounts = 343[2^153, 3^79, 4^39, 5^20, 6^17, 7^16, 8^5, 9^5, 10^4, 11, 12, 13, 15, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.167 = CTTGGCTGTGCACTTA-1

using 146 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^3, 135]
surviving nonsolo ucounts = 1[135]
ids = [7]

====================================================================================

UMI info for barcode CTTGGCTGTGCACTTA-1 contig 1 = CCTCCTTGGG...
umi TGACTCCCTT = 128 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=552]
0-38 ==> 21-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
38-391 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
440-474 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
474-552 ==> 0-78 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 380, score = 7 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 38, 236, 241, 258, 302, 335, 528
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.175 = CTTGGCTGTGGTCTCG-1

using 63 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 6, 55]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.185 = CTTGGCTGTTAGAACA-1

using 9 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.190 = CTTGGCTGTTCAGCGC-1

using 103 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[99]
surviving nonsolo ucounts = 1[99]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=423]
0-344 ==> 16-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
343-381 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
381-423 ==> 0-42 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQALQTRETF at 320, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 88
start codons at 17, 53, 141, 303, 323
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.227 = CTTGGCTTCCCAACGG-1

using 36 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2^2, 24]
surviving nonsolo ucounts = 1[24]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 56.231 = CTTGGCTTCCGAATGT-1

using 28344 reads

====================================================================================

graph has 10085 edges initially, 190 edges after simplification

total ucounts = 2030
nonsolo ucounts = 945[2^447, 3^183, 4^110, 5^56, 6^29, 7^21, 8^4, 9^10, 10^6, 11^5, 12, 13, 15^2, 17, 23, 29, 52, 58, 65, 84, 94, 109, 120, 168, 170^2, 176, 181, 192, 216, 219, 231, 233, 235, 236, 252, 253, 264, 265, 268, 280, 281, 286, 287, 302^2, 307, 308, 310, 315, 317, 324, 326, 329, 333, 343, 346, 355, 357, 391, 392, 443, 491, 512, 515, 517, 522, 539, 556, 562, 569, 576, 603, 604, 617, 646, 655^2, 666, 678, 695, 734, 957]
surviving nonsolo ucounts = 62[94, 109, 120, 170^2, 176, 181, 192, 216, 219, 231, 233, 235, 236, 252, 253, 264, 265, 268, 280, 281, 286, 287, 302^2, 307, 308, 310, 315, 317, 324, 326, 329, 333, 343, 346, 355, 357, 391, 392, 443, 491, 512, 515, 517, 522, 539, 556, 562, 569, 576, 603, 604, 617, 646, 655^2, 666, 678, 695, 734, 957]
ids = [1252, 1035, 1157, 821, 1396, 838, 1983, 571, 1102, 1606, ...]

====================================================================================

UMI info for barcode CTTGGCTTCCGAATGT-1 contig 1 = TCTGAGAGTC...
umi CAATCAGCCA = 569 reads: -406X +1 -5XX +1 -2XX +3 -1XX +1 -6XX +1 -1XX +1 -2XX +1 -6XX +1 invalidated
umi CTATATAGAG = 231 reads: +439 validated
umi CTTATGGCGA = 110 reads: +439 validated
umi GCAGCCGCCC = 118 reads: +439 validated
umi GCTAGTGTAT = 289 reads: +439 validated
umi GGCAACCAGT = 120 reads: -415 +3 -1X +1 -6X +1 -1X +1 -2X +1 -6XX +1 invalidated
umi GTGGACTATG = 175 reads: +439 validated
umi TTATATGGGT = 255 reads: +439 validated
umi TTTAATGGCG = 186 reads: +439 validated

UMI info for barcode CTTGGCTTCCGAATGT-1 contig 2 = AGAGCTCTGG...
umi AACATTATTG = 359 reads: -303X +82 invalidated
umi AACTAACTAT = 282 reads: +42 -1 +342 non-validated
umi ACATCTCTTC = 319 reads: +385 validated
umi ACGCCATCGT = 396 reads: +385 validated
umi AGGTTACTTA = 276 reads: +385 validated
umi ATATGTCACT = 346 reads: +385 validated
umi CAAGTTGCCG = 355 reads: +385 validated
umi CACTATAGGG = 191 reads: +385 validated
umi CAGGTAGTAC = 310 reads: +385 validated
umi CCTATTTGGC = 317 reads: +385 validated
umi CGACAGCCAA = 173 reads: +385 validated
umi CGATTTAGGC = 174 reads: +385 validated
umi CTCCTCGGCG = 283 reads: +385 validated
umi CTCGTTTAAC = 317 reads: +385 validated
umi CTCTTACTCG = 327 reads: +385 validated
umi CTTTTCCTGA = 265 reads: +385 validated
umi GAAAACACTC = 391 reads: +385 validated
umi GACCGCTGAT = 217 reads: +385 validated
umi GCTCCGGCCT = 305 reads: +385 validated
umi GGTCAGCACC = 349 reads: +385 validated
umi GTAACATCCG = 291 reads: +385 validated
umi GTCCTCGGCC = 264 reads: +385 validated
umi GTTGGTCTAG = 255 reads: +385 validated
umi TAGTTGTGCA = 317 reads: +385 validated
umi TATGCTCGTT = 352 reads: +385 validated
umi TCAGAATGGA = 216 reads: +385 validated
umi TCCGCTTGTC = 229 reads: +385 validated
umi TGAATAACAG = 231 reads: +385 validated
umi TTACACTAGT = 238 reads: +385 validated
umi TTCAAAGCCA = 443 reads: +385 validated
umi TTTTCACCCC = 303 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=652]
0-31 ==> 70-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=1)
31-387 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=44)
420-470 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=6)
470-652 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 7 umis using 151 reads
cdr3 = CARGFTMVVYPTRRMGAFDVW at 376, score = 9 + 6
umis assigned: [533, 940, 1035, 1157, 1215, 1252, 1396, 1885, 1983]
of which 9 are surviving nonsolos
reads assigned: 1788
start codons at 31, 75, 164, 254, 394, 418, 431, 451
confident = true

TIG 2[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=24)
391-429 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 30 umis using 1307 reads
cdr3 = CQQYGDTPRTF at 368, score = 9 + 7
umis assigned: [40, 57, 156, 210, 322, 383, 527, 571, 597, 774] and 21 others
of which 31 are surviving nonsolos
reads assigned: 8910
start codons at 44, 252, 378, 422, 471
confident = true

REJECT CONTIGS

TIG 1[bases=344]
4-121 ==> 5529-5646 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=8)
87-130 ==> 0-43 on rc of segment before IGKV2-30 exon 1 [len=426] (mis=2)
87-130 ==> 0-43 on segment before IGKV2D-30 exon 2 [len=426] (mis=2)
129-209 ==> 29-109 on rc of segment before IGKJ1 exon 1 [len=322] (mis=3)
208-344 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [26, 160, 171, 435, 498, 607, 633, 703, 742, 818] and 12 others
of which 22 are surviving nonsolos
reads assigned: 12794
start codons at 38, 71, 104, 117, 122, 158, 166, 250
confident = false
did not find CDR3
now this is a cell
paired!

TATTACTGTGCGAGAGGCTTTACAATGGTGGTATATCCTACTCGGAGGATGGGTGCCTTTGATGTCTGGGGCCAAGGGACGATGGTCGCCGTCTCTTCAG <==> GTCAGTAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGCGACACACCCCGGACGTTCGGCCAAGGGACCAAGGTGGAGATGAAGC
sorting bam, mem = 0.08
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk056-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk056-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

13.719 seconds used processing barcodes, peak mem = 0.23
