[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.20 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk054-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk054-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk054.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.0 = CTTAACTAGGTCGGAT-1

using 6050 reads

====================================================================================

graph has 2092 edges initially, 6 edges after simplification

total ucounts = 220
nonsolo ucounts = 97[2^30, 3^12, 4^6, 5^7, 6^7, 7^6, 8, 9^3, 12^2, 23, 49, 61, 137, 138, 193, 220, 222, 246, 254, 266, 277, 287, 290, 298, 299, 302, 321, 337, 338, 341, 349, 381]
surviving nonsolo ucounts = 20[137, 138, 193, 220, 222, 246, 254, 266, 277, 287, 290, 298, 299, 302, 321, 337, 338, 341, 349, 381]
ids = [160, 94, 136, 164, 85, 171, 129, 217, 140, 37, ...]

====================================================================================

UMI info for barcode CTTAACTAGGTCGGAT-1 contig 1 = TGGGGAGAGC...
umi ACTTTTACAG = 293 reads: +388 validated
umi AGTCGTCCCT = 289 reads: +388 validated
umi AGTGCACTCC = 343 reads: +388 validated
umi ATAGAACCAT = 308 reads: +388 validated
umi ATTGATTGGC = 338 reads: +388 validated
umi CATCCTCTTT = 325 reads: +388 validated
umi CCGACTTACC = 223 reads: +388 validated
umi CGCTAGCCCA = 142 reads: +388 validated
umi CGTCCATCAG = 288 reads: +388 validated
umi CGTGTTAGGC = 301 reads: +388 validated
umi GATTCGGCCC = 252 reads: +388 validated
umi GCTACTGCCT = 194 reads: +388 validated
umi GGCAGGTGCC = 278 reads: +388 validated
umi TAATAAATTG = 137 reads: +388 validated
umi TAGTGTTCGT = 220 reads: +388 validated
umi TCAAAGCTTT = 253 reads: +388 validated
umi TCGTCACATT = 339 reads: +388 validated
umi TGGATTTGGC = 349 reads: +388 validated
umi TTTACTCATA = 382 reads: +388 validated
umi TTTAGTTGTG = 266 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=573]
0-49 ==> 0-49 on |289|IGKV3D-15|5'UTR| [len=49] (mis=3)
49-396 ==> 0-347 on |290|IGKV3D-15|L-REGION+V-REGION| [len=347] (mis=3)
399-437 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
437-573 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 20 umis using 833 reads
cdr3 = CQQYNNWPPSITF at 370, score = 9 + 8
umis assigned: [26, 37, 39, 44, 57, 76, 85, 94, 99, 100] and 10 others
of which 20 are surviving nonsolos
reads assigned: 5425
start codons at 49, 118, 254, 479
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.5 = CTTAACTAGTGAAGAG-1

using 144 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[3^3, 127]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.20 = CTTAACTCACATCTTT-1

using 355 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 1[342]
surviving nonsolo ucounts = 1[342]
ids = [0]

====================================================================================

UMI info for barcode CTTAACTCACATCTTT-1 contig 1 = GGGACTGATC...
umi ACCCCAGGCC = 345 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=569]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=2)
36-362 ==> 0-326 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=11)
395-433 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
433-569 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CMNTLPGGFTF at 372, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 339
start codons at 36, 69, 105, 193, 355, 375, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.23 = CTTAACTCACCCTATC-1

using 77 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 69]
surviving nonsolo ucounts = 1[69]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.24 = CTTAACTCACCGCTAG-1

using 73 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 1[64]
surviving nonsolo ucounts = 1[64]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=428]
0-338 ==> 7-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=22)
340-378 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
378-428 ==> 0-50 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYYNWPPWTF at 314, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 56
start codons at 62, 135, 198, 218, 371, 420
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.36 = CTTAACTCAGTCGTGC-1

using 307 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^3, 297]
surviving nonsolo ucounts = 1[297]
ids = [7]

====================================================================================

REJECT CONTIGS

TIG 1[bases=557]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-36 ==> 5964-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
9-61 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
36-336 ==> 0-300 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=17)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQLRRNWPRGTF at 357, score = 6 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 36, 241, 463
confident = false
not full
full length stopped transcript of length 557
frameshifted full length stopped transcript of length 557
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.55 = CTTAACTGTAGCAAAT-1

using 3917 reads

====================================================================================

graph has 2044 edges initially, 16 edges after simplification

total ucounts = 352
nonsolo ucounts = 146[2^60, 3^27, 4^18, 5^8, 6^9, 7^4, 8, 9, 10, 11^2, 12^3, 13, 88, 229, 256, 268, 309, 313, 337, 346, 348, 349, 374]
surviving nonsolo ucounts = 11[88, 229, 256, 268, 309, 313, 337, 346, 348, 349, 374]
ids = [274, 129, 277, 175, 214, 19, 44, 73, 256, 3, ...]

====================================================================================

UMI info for barcode CTTAACTGTAGCAAAT-1 contig 1 = GGGAGAGCCC...
umi AAACGCCCTC = 351 reads: +379 validated
umi AAGTTCATAC = 310 reads: +379 validated
umi ATACGTGGCT = 342 reads: +379 validated
umi CGTTTTGAGG = 376 reads: +379 validated
umi CTACTAGCGT = 266 reads: +379 validated
umi GCCCAGTTCC = 312 reads: +379 validated
umi TACATGAGGT = 347 reads: +379 validated
umi TCAACGTGCC = 87 reads: +379 validated

UMI info for barcode CTTAACTGTAGCAAAT-1 contig 2 = GGGATCACAC...
umi ACGACAACAG = 337 reads: +421 validated
umi CATTTAAGAG = 221 reads: +421 validated
umi TCAGGGCAAC = 260 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=562]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
389-426 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 8 umis using 379 reads
cdr3 = CQQRSNWLTF at 368, score = 9 + 9
umis assigned: [3, 19, 73, 172, 175, 214, 256, 274]
of which 8 are surviving nonsolos
reads assigned: 2361
start codons at 47, 252, 255, 468
confident = true

TIG 2[bases=552]
0-60 ==> 0-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=3)
60-413 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=3)
414-434 ==> 8-28 on |15|IGHD2-21|D-REGION| [len=28] (mis=1)
433-481 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
481-552 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 3 umis using 50 reads
cdr3 = CATRVVVTAISYFDYW at 402, score = 9 + 7
umis assigned: [44, 129, 277]
of which 3 are surviving nonsolos
reads assigned: 802
start codons at 60, 216, 258, 280, 324, 357
confident = true
now this is a cell
paired!

GAGGACACGGCCGTGTATTACTGTGCAACTAGGGTGGTGGTGACTGCTATTTCTTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ACCATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.61 = CTTAACTGTGAGTGAC-1

using 118 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[118]
surviving nonsolo ucounts = 1[118]
ids = [0]

====================================================================================

UMI info for barcode CTTAACTGTGAGTGAC-1 contig 1 = GAGTGCTTTC...
umi GCGTCGTAGT = 117 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=529]
39-176 ==> 0-137 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=25)
176-302 ==> 140-266 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=30)
423-469 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=12)
469-529 ==> 0-60 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARGPLVRGILGKGYYLDLW at 378, score = 8 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 114
start codons at 39, 83, 348
confident = false
see deletion of 3 bases at pos 137 on |197|IGHV4/OR15-8|L-REGION+V-REGION|
>vscore_54.61_77.1%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGCGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.67 = CTTAACTGTTCCGTCT-1

using 176 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 170]
surviving nonsolo ucounts = 1[170]
ids = [2]

====================================================================================

UMI info for barcode CTTAACTGTTCCGTCT-1 contig 1 = GGGGGGTCTC...
umi ATTGAGTTAT = 170 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=474]
40-401 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=12)
390-428 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
428-474 ==> 0-46 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CSSYTSSSTLVF at 364, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 165
start codons at 40, 197, 241, 248, 251
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.82 = CTTAACTTCAGCATGT-1

using 211 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[206]
surviving nonsolo ucounts = 1[206]
ids = [2]

====================================================================================

UMI info for barcode CTTAACTTCAGCATGT-1 contig 1 = AGGAGTCAGA...
umi GATAACCAGT = 197 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=510]
0-27 ==> 2-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
27-378 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-510 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CLQDYTYPFSF at 354, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 27, 33, 89, 102, 184, 187, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.90 = CTTAACTTCATGGTCA-1

using 15 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.95 = CTTAACTTCGACAGCC-1

using 488 reads

====================================================================================

graph has 164 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[231, 253]
surviving nonsolo ucounts = 2[231, 253]
ids = [0, 3]

====================================================================================

UMI info for barcode CTTAACTTCGACAGCC-1 contig 1 = GGCTGGGGTC...
umi CTGCGCTCGC = 251 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=521]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-383 ==> 0-341 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=15)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
427-521 ==> 0-94 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CSSYAGASWVF at 366, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 42, 193, 199, 250, 253, 349, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.101 = CTTAACTTCGCGGATC-1

using 238 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 231]
surviving nonsolo ucounts = 1[231]
ids = [2]

====================================================================================

UMI info for barcode CTTAACTTCGCGGATC-1 contig 1 = GCTCTGCCTC...
umi GTCATTGGAT = 229 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=541]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=6)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
445-541 ==> 0-96 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQSYDTSLSGSNVF at 375, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.102 = CTTAACTTCGGAAATA-1

using 230 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2, 4^2, 6, 13, 198]
surviving nonsolo ucounts = 1[198]
ids = [8]

====================================================================================

UMI info for barcode CTTAACTTCGGAAATA-1 contig 1 = GCTGGGATCT...
umi TGTGAGCACC = 195 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=533]
0-39 ==> 20-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
39-392 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=20)
411-457 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
457-533 ==> 0-76 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARPYNSYWLGFDYW at 381, score = 8 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 39, 213, 511
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.105 = CTTAACTTCTATGTGG-1

using 2282 reads

====================================================================================

graph has 3358 edges initially, 30 edges after simplification

total ucounts = 1035
nonsolo ucounts = 493[2^193, 3^108, 4^81, 5^46, 6^27, 7^21, 8^6, 9^4, 10^2, 11^2, 12, 14^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.106 = CTTAACTTCTCAAGTG-1

using 18 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.115 = CTTAACTTCTGCGGCA-1

using 221 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 214]
surviving nonsolo ucounts = 1[214]
ids = [4]

====================================================================================

UMI info for barcode CTTAACTTCTGCGGCA-1 contig 1 = AGAGGCAGCA...
umi TCCGTGGTTC = 210 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=541]
0-28 ==> 23-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
28-384 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
419-541 ==> 0-122 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQSYDTSLSGSVF at 352, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 28, 182, 185, 236, 335, 362
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.116 = CTTAACTTCTGCGTAA-1

using 47 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[42]
surviving nonsolo ucounts = 1[42]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.117 = CTTAACTTCTGGCGTG-1

using 297 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 290]
surviving nonsolo ucounts = 1[290]
ids = [4]

====================================================================================

UMI info for barcode CTTAACTTCTGGCGTG-1 contig 1 = GGAGAAGAGC...
umi TCATCCTAGC = 281 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=482]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-372 ==> 0-336 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
418-482 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYRNSITF at 360, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 36, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.123 = CTTACCGAGAATCTCC-1

using 21 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 6, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.124 = CTTACCGAGAGGTACC-1

using 254 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 7, 238]
surviving nonsolo ucounts = 1[238]
ids = [1]

====================================================================================

UMI info for barcode CTTACCGAGAGGTACC-1 contig 1 = GATCAGGACT...
umi CGATTAAGCG = 230 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=498]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
388-427 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
427-498 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CMQALQTPRTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.133 = CTTACCGAGCTGAACG-1

using 243 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 17, 220]
surviving nonsolo ucounts = 1[220]
ids = [0]

====================================================================================

UMI info for barcode CTTACCGAGCTGAACG-1 contig 1 = AGCTTCAGCT...
umi AGCTAGGTTT = 216 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=567]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-355 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-567 ==> 0-132 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CVAWDDSLYAWVF at 368, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 47, 351, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.134 = CTTACCGAGCTGTTCA-1

using 222 reads

====================================================================================

graph has 70 edges initially, 6 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[5, 213]
surviving nonsolo ucounts = 1[213]
ids = [3]

====================================================================================

UMI info for barcode CTTACCGAGCTGTTCA-1 contig 1 = GGGAGTCTCA...
umi ACCTAACTAC = 4 reads: -2 +20 -1X +18 -1X +6 -1X +3 -1X +5 -20 +32 -1X +13 -1X +9 -39 +8 -1X +20 -1XX +3 -1XX +3 -1XX +5 -1X +11 -1XX +9 -150 invalidated
umi TCTTCAATCC = 198 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=496]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
373-411 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
411-496 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQSYSTPFTF at 350, score = 9 + 8
umis assigned: [0, 3]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.140 = CTTACCGAGTACTTGC-1

using 14 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.142 = CTTACCGAGTCTCCTC-1

using 363 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^3, 3^2, 345]
surviving nonsolo ucounts = 1[345]
ids = [10]

====================================================================================

UMI info for barcode CTTACCGAGTCTCCTC-1 contig 1 = GAGCTACAAC...
umi TCACTTTTGT = 325 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=498]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
392-430 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
430-498 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYYSTPWTF at 369, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.154 = CTTACCGCAATGTAAG-1

using 732 reads

====================================================================================

graph has 234 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[322, 402]
surviving nonsolo ucounts = 2[322, 402]
ids = [7, 5]

====================================================================================

UMI info for barcode CTTACCGCAATGTAAG-1 contig 1 = GAGGAACTGC...
umi GCATGGTAAG = 408 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=11)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQQYNNWPPYTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 400
start codons at 33, 102, 238, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.159 = CTTACCGCACATCCGG-1

using 924 reads

====================================================================================

graph has 870 edges initially, 28 edges after simplification

total ucounts = 284
nonsolo ucounts = 116[2^61, 3^23, 4^14, 5^5, 6^7, 7^2, 9, 11, 13, 394]
surviving nonsolo ucounts = 1[394]
ids = [266]

====================================================================================

UMI info for barcode CTTACCGCACATCCGG-1 contig 1 = GAGAAGAGCT...
umi TGTACGTTTT = 397 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQYGSSLGTF at 359, score = 9 + 8
umis assigned: [266]
of which 1 are surviving nonsolos
reads assigned: 386
start codons at 35, 243, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.162 = CTTACCGCACCAGGTC-1

using 343 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[340]
surviving nonsolo ucounts = 1[340]
ids = [0]

====================================================================================

UMI info for barcode CTTACCGCACCAGGTC-1 contig 1 = GGGAATCAGT...
umi ACTGCACTGA = 326 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=502]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-502 ==> 0-87 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.165 = CTTACCGCAGCATGAG-1

using 154 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 10[2^3, 3^2, 4^2, 5, 7, 119]
surviving nonsolo ucounts = 1[119]
ids = [12]

====================================================================================

UMI info for barcode CTTACCGCAGCATGAG-1 contig 1 = GTCTCCCTCA...
umi TTGATGCAAT = 119 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=496]
0-56 ==> 3-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
56-409 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=14)
436-486 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
junction support: 1 umis using 10 reads
cdr3 = CARPGYSGAWSRRDTFNIW at 398, score = 7 + 8
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 117
start codons at 56, 230, 254, 389, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.166 = CTTACCGCAGCCTGTG-1

using 223 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[219]
surviving nonsolo ucounts = 1[219]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.171 = CTTACCGCAGGCGATA-1

using 245 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[244]
surviving nonsolo ucounts = 1[244]
ids = [0]

====================================================================================

UMI info for barcode CTTACCGCAGGCGATA-1 contig 1 = GGGCCTCAGG...
umi GTTGGTTTCT = 239 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=563]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-369 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
373-411 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
411-563 ==> 0-152 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQAWDSTEVVF at 350, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 35, 40, 329, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.172 = CTTACCGCAGGGCATA-1

using 506 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[499]
surviving nonsolo ucounts = 1[499]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=319]
3-143 ==> 208-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
145-183 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
183-319 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQHHGSSPPRTF at 119, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 493
start codons at 3, 129, 225
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.177 = CTTACCGCAGTCAGCC-1

using 280 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[6, 270]
surviving nonsolo ucounts = 1[270]
ids = [5]

====================================================================================

UMI info for barcode CTTACCGCAGTCAGCC-1 contig 1 = TGGGGAGATC...
umi TGATTTCATC = 258 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=533]
23-376 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
425-459 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
459-533 ==> 0-74 on |1|IGHA1|C-REGION| [len=1058] (mis=1)
junction support: 1 umis using 31 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 365, score = 7 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 23, 221, 226, 243, 287, 320, 513
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.179 = CTTACCGCAGTTCCCT-1

using 210 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 3, 5, 193]
surviving nonsolo ucounts = 1[193]
ids = [0]

====================================================================================

UMI info for barcode CTTACCGCAGTTCCCT-1 contig 1 = TGAGCGCAGA...
umi AATTCACGGG = 185 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=431]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=3)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
junction support: 1 umis using 25 reads
cdr3 = CGTWDSSLSAWVF at 357, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.180 = CTTACCGCATAACCTG-1

using 284 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[279]
surviving nonsolo ucounts = 1[279]
ids = [3]

====================================================================================

UMI info for barcode CTTACCGCATAACCTG-1 contig 1 = GAAGAGCTGC...
umi CTTCTCGCAT = 262 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=493]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
421-493 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYGSSPPYTF at 357, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 33, 237, 241, 340, 367, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.183 = CTTACCGCATCGGAAG-1

using 182 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2^2, 172]
surviving nonsolo ucounts = 1[172]
ids = [5]

====================================================================================

UMI info for barcode CTTACCGCATCGGAAG-1 contig 1 = ATCATCCAAC...
umi TAGTTAGCAT = 167 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=509]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=8)
428-476 ==> 15-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
476-509 ==> 0-33 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARVHTVVEDGMDVW at 400, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 166
start codons at 58, 214, 256, 322, 355, 433
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.203 = CTTACCGGTCGCATCG-1

using 337 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2^2, 3^2, 318]
surviving nonsolo ucounts = 1[318]
ids = [8]

====================================================================================

UMI info for barcode CTTACCGGTCGCATCG-1 contig 1 = GGAATCAGTC...
umi GTAAATAAGC = 285 reads: +10 -1XX +377 invalidated

GOOD CONTIGS

TIG 1[bases=509]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=20)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-509 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.204 = CTTACCGGTCGTGGCT-1

using 117 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[117]
surviving nonsolo ucounts = 1[117]
ids = [0]

====================================================================================

UMI info for barcode CTTACCGGTCGTGGCT-1 contig 1 = GGGAGAGGAG...
umi GCCCAGACTC = 116 reads: +424 -1 +2 -1 +2 non-validated

GOOD CONTIGS

TIG 1[bases=503]
0-73 ==> 7-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=2)
73-424 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=15)
452-503 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=1)
junction support: 1 umis using 12 reads
cdr3 = CARGAGYDFLSGHHWFDPW at 415, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 114
start codons at 73, 229, 280, 287, 290, 308, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.208 = CTTACCGGTCTCTTAT-1

using 187 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 183]
surviving nonsolo ucounts = 2[2, 183]
ids = [2, 1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=447]
0-44 ==> 35-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
0-44 ==> 5956-6000 on rc of segment after IGHV3-48 exon 1 [len=6000] (mis=0)
4-55 ==> 3150-3201 on rc of segment before IGHV3-33 exon 2 [len=3201] (mis=9)
12-80 ==> 6506-6574 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=3)
44-397 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=24)
398-419 ==> 0-21 on |33|IGHD6-19|D-REGION| [len=21] (mis=3)
414-447 ==> 0-33 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
cdr3 = CITVRRPLIA at 378, score = 5 + 5
umis assigned: [0, 1, 2, 3]
of which 2 are surviving nonsolos
reads assigned: 156
start codons at 44, 200, 321, 347, 371
confident = false
VJ delta = -7
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.213 = CTTACCGGTTCCACAA-1

using 4214 reads

====================================================================================

graph has 2234 edges initially, 18 edges after simplification

total ucounts = 296
nonsolo ucounts = 132[2^44, 3^25, 4^26, 5^9, 6^4, 7^2, 8^2, 9, 10, 15^2, 19, 27, 46, 53, 85, 153, 159, 223^2, 230, 256, 273, 279, 292, 380, 937]
surviving nonsolo ucounts = 12[46, 153, 159, 223^2, 230, 256, 273, 279, 292, 380, 937]
ids = [279, 220, 238, 88, 269, 206, 108, 121, 233, 68, ...]

====================================================================================

UMI info for barcode CTTACCGGTTCCACAA-1 contig 1 = AGAGAGGTGC...
umi CAGTACGGGC = 226 reads: +418 validated
umi CCGCTCCGTC = 253 reads: +418 validated
umi CGATCGGCAG = 270 reads: +418 validated
umi GTGCTGACGG = 234 reads: +418 validated
umi TACCGTACCA = 156 reads: +418 validated
umi TCACAACTCA = 281 reads: +418 validated
umi TCATAATCCT = 158 reads: +418 validated
umi TGGACCACGC = 223 reads: +418 validated

UMI info for barcode CTTACCGGTTCCACAA-1 contig 2 = TGGGGAGGAA...
umi ATGAGCTACG = 366 reads: +388 validated
umi ATTAAATATG = 281 reads: +388 validated
umi TGTGTAAATA = 47 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=561]
0-72 ==> 7-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
72-425 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=24)
426-447 ==> 0-21 on |33|IGHD6-19|D-REGION| [len=21] (mis=3)
442-490 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
490-561 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 155 reads
cdr3 = CAKAAYSSGWFLDNW at 414, score = 7 + 7
umis assigned: [88, 108, 121, 206, 220, 233, 238, 269]
of which 8 are surviving nonsolos
reads assigned: 1767
start codons at 72, 228, 349, 375, 399
confident = true

TIG 2[bases=510]
0-37 ==> 60-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
37-382 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=10)
386-425 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
425-510 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 113 reads
cdr3 = CHQYNNWPSLYTF at 358, score = 9 + 8
umis assigned: [63, 68, 279]
of which 3 are surviving nonsolos
reads assigned: 684
start codons at 37, 106, 242, 245, 467
confident = true
now this is a cell
paired!

GACGAGGACATGGCTGTGTATTACTGTGCGAAGGCCGCTTATAGCAGTGGCTGGTTCCTTGACAACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCACCAATATAATAACTGGCCGTCCTTGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.215 = CTTACCGGTTCCATGA-1

using 20 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.218 = CTTACCGGTTTCCACC-1

using 280 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[10, 268]
surviving nonsolo ucounts = 1[268]
ids = [3]

====================================================================================

UMI info for barcode CTTACCGGTTTCCACC-1 contig 1 = AGTTAGGACC...
umi GGCTAGTCTC = 266 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=539]
0-21 ==> 26-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
21-366 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
364-403 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
403-539 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CHQRSDWPYTF at 342, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 21, 226, 229, 445
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.219 = CTTACCGGTTTCGCTC-1

using 305 reads

====================================================================================

graph has 86 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 4, 121, 174]
surviving nonsolo ucounts = 2[121, 174]
ids = [1, 3]

====================================================================================

UMI info for barcode CTTACCGGTTTCGCTC-1 contig 1 = GCTGTGGGTC...
umi CGTTCACCAA = 111 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=515]
0-38 ==> 5-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
38-375 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=2)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
420-515 ==> 0-95 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CQSADSSGTYWVF at 353, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 111
start codons at 38, 99, 168, 186
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.220 = CTTACCGTCAAAGTAG-1

using 287 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 4, 5, 273]
surviving nonsolo ucounts = 1[273]
ids = [3]

====================================================================================

UMI info for barcode CTTACCGTCAAAGTAG-1 contig 1 = ACTAGAAGTC...
umi GAACAATTTA = 266 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=526]
0-57 ==> 23-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
57-408 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=25)
418-466 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
466-526 ==> 0-60 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CASAMAFYFEDW at 399, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 57, 208, 213, 271, 274, 283, 292, 360, 411
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.223 = CTTACCGTCAACGAAA-1

using 282 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 6, 267]
surviving nonsolo ucounts = 1[267]
ids = [0]

====================================================================================

UMI info for barcode CTTACCGTCAACGAAA-1 contig 1 = GAAGAGCTGC...
umi AACACTCGTC = 265 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYGSSPVTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 33, 241, 244, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.231 = CTTACCGTCCAAACAC-1

using 339 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[5, 329]
surviving nonsolo ucounts = 1[329]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=497]
0-75 ==> 5533-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=5)
391-429 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
429-497 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWDLLLHASSTNSSITF at 350, score = 4 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 30, 63, 99, 349, 369, 471
confident = false
not full
frameshifted full length transcript of length 497
VJ delta = 30
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.232 = CTTACCGTCCAAACTG-1

using 122 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 4, 10, 99]
surviving nonsolo ucounts = 1[99]
ids = [10]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.233 = CTTACCGTCCCAAGAT-1

using 518 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 8, 237, 264]
surviving nonsolo ucounts = 2[237, 264]
ids = [3, 4]

====================================================================================

UMI info for barcode CTTACCGTCCCAAGAT-1 contig 1 = GGGAGCATCA...
umi CGCCTCCACC = 238 reads: +424 validated
umi CGTCCGCATA = 262 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=559]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=1)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=7)
440-488 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
488-559 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 40 reads
cdr3 = CARSLVSYSSSWIFDYW at 406, score = 8 + 7
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 498
start codons at 64, 262, 267, 299, 328, 361
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.235 = CTTACCGTCCGTCAAA-1

using 320 reads

====================================================================================

graph has 134 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 30, 285]
surviving nonsolo ucounts = 2[30, 285]
ids = [2, 0]

====================================================================================

UMI info for barcode CTTACCGTCCGTCAAA-1 contig 1 = ATCAGGACTC...
umi CCTGGTTGCC = 278 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=496]
0-29 ==> 1-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
29-389 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
393-432 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
432-496 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CMQALQTPPMYTF at 365, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 29, 62, 98, 186, 348, 368, 392, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.241 = CTTACCGTCGCGTTTC-1

using 36 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 6, 23]
surviving nonsolo ucounts = 2[6, 23]
ids = [5, 3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.242 = CTTACCGTCGGCGGTT-1

using 432 reads

====================================================================================

graph has 140 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[7, 14, 161, 247]
surviving nonsolo ucounts = 2[161, 247]
ids = [2, 3]

====================================================================================

UMI info for barcode CTTACCGTCGGCGGTT-1 contig 1 = GATCAGGACT...
umi AGGCTGTTAA = 145 reads: +397 validated

UMI info for barcode CTTACCGTCGGCGGTT-1 contig 2 = GGGACTCCTG...
umi CAGGCACGAG = 237 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=511]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-511 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 144
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false

TIG 2[bases=502]
19-377 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
402-452 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
452-502 ==> 0-50 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 364, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 19, 63, 242, 245, 248, 334, 404
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.245 = CTTACCGTCGTCGTTC-1

using 49 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 46]
surviving nonsolo ucounts = 1[46]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.249 = CTTACCGTCTACTATC-1

using 26 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.250 = CTTACCGTCTAGCACA-1

using 236 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^2, 3, 222]
surviving nonsolo ucounts = 1[222]
ids = [2]

====================================================================================

UMI info for barcode CTTACCGTCTAGCACA-1 contig 1 = GTCAGTCCCA...
umi CAGTAACAAG = 218 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 35-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
23-355 ==> 0-332 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=24)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQHLVTHPISF at 350, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 23, 29, 234, 237, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.255 = CTTACCGTCTCTGCTG-1

using 187 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 4, 6, 170]
surviving nonsolo ucounts = 3[3, 6, 170]
ids = [7, 6, 1]

====================================================================================

UMI info for barcode CTTACCGTCTCTGCTG-1 contig 1 = GGTGGTAGCT...
umi CACCTCTCCA = 164 reads: +388 validated
umi GTGTTTCACG = 6 reads: -5 +99 -22 +56 -51 +56 -77 +22 non-validated
umi GTTATTCACG = 3 reads: -84 +106 -198 non-validated

GOOD CONTIGS

TIG 1[bases=498]
0-39 ==> 47-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
39-376 ==> 0-337 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=6)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
427-498 ==> 0-71 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQSFGSNTRVF at 366, score = 6 + 8
umis assigned: [1, 6, 7]
of which 3 are surviving nonsolos
reads assigned: 169
start codons at 39, 102, 193, 244
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.257 = CTTACCGTCTGCGGCA-1

using 267 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[2^3, 3, 6, 9, 237]
surviving nonsolo ucounts = 1[237]
ids = [4]

====================================================================================

UMI info for barcode CTTACCGTCTGCGGCA-1 contig 1 = AGAGCTCTGG...
umi CTCTGCAATA = 224 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=511]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
390-429 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
429-511 ==> 0-82 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYGNSPYTF at 368, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 44, 378, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.263 = CTTAGGAAGAAGGACA-1

using 1660 reads

====================================================================================

graph has 2634 edges initially, 8 edges after simplification

total ucounts = 735
nonsolo ucounts = 314[2^108, 3^72, 4^40, 5^29, 6^28, 7^11, 8^9, 9^8, 10^2, 12^4, 14^2, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.271 = CTTAGGAAGAGTAATC-1

using 100 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[100]
surviving nonsolo ucounts = 1[100]
ids = [0]

====================================================================================

UMI info for barcode CTTAGGAAGAGTAATC-1 contig 1 = GGCTGGGGTC...
umi TCTTAGAGTT = 103 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=525]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-370 ==> 0-328 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=17)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
430-525 ==> 0-95 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CSSVAGSYSLVF at 366, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 97
start codons at 42, 181, 199, 250, 253, 349
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.277 = CTTAGGAAGCAGATCG-1

using 288 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[286]
surviving nonsolo ucounts = 1[286]
ids = [2]

====================================================================================

UMI info for barcode CTTAGGAAGCAGATCG-1 contig 1 = GGGAGTCAGT...
umi GCCAAGCCTT = 288 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=554]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQSYSTPSLTF at 354, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 27, 33, 89, 102, 238, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.282 = CTTAGGAAGCGGCTTC-1

using 258 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[257]
surviving nonsolo ucounts = 1[257]
ids = [1]

====================================================================================

UMI info for barcode CTTAGGAAGCGGCTTC-1 contig 1 = GTCTCAGGAG...
umi GTCCAACTAG = 250 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=540]
35-373 ==> 0-338 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
385-423 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
423-540 ==> 0-117 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CSSYTTIHTFVF at 359, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 35, 243, 246
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.283 = CTTAGGAAGCGTGAAC-1

using 237 reads

====================================================================================

graph has 130 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 5, 6, 220]
surviving nonsolo ucounts = 2[6, 220]
ids = [1, 3]

====================================================================================

UMI info for barcode CTTAGGAAGCGTGAAC-1 contig 1 = CCCTAGATCA...
umi CCTGAAATAG = 3 reads: -75 +41 -1X +11 -1X +2 -8 +4 -1X +1 -1X +3 -1X +1 -1X +4 -1X +3 -1X +27 -1XX +18 -1X +13 -1X +2 -212 invalidated
umi GCCATACCGC = 212 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=514]
0-22 ==> 37-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
22-375 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
424-458 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
458-514 ==> 0-56 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 364, score = 7 + 7
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 211
start codons at 22, 220, 225, 242, 286, 319
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.295 = CTTAGGAAGTAAGTAC-1

using 341 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 5, 329]
surviving nonsolo ucounts = 1[329]
ids = [3]

====================================================================================

UMI info for barcode CTTAGGAAGTAAGTAC-1 contig 1 = ACATCTGTCC...
umi CTCCCACTGC = 329 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=527]
0-44 ==> 20-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
44-397 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=0)
410-456 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
456-527 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARDRSSYGYDYW at 386, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 44, 200, 242, 247, 279, 308, 341, 408
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.296 = CTTAGGAAGTACCGGA-1

using 185 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[179]
surviving nonsolo ucounts = 1[179]
ids = [5]

====================================================================================

UMI info for barcode CTTAGGAAGTACCGGA-1 contig 1 = GTCAGACTCA...
umi GTATAATCAG = 166 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=485]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-485 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQQYNSYPLTF at 350, score = 8 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 23, 29, 85, 98, 234, 237, 330, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.297 = CTTAGGAAGTACGTTC-1

using 1025 reads

====================================================================================

graph has 442 edges initially, 20 edges after simplification

total ucounts = 227
nonsolo ucounts = 71[2^38, 3^12, 4^12, 5^2, 6^4, 92, 238, 345]
surviving nonsolo ucounts = 3[92, 238, 345]
ids = [34, 49, 103]

====================================================================================

UMI info for barcode CTTAGGAAGTACGTTC-1 contig 1 = GGAGGAACTG...
umi CGTGTTACTT = 339 reads: +385 validated

UMI info for barcode CTTAGGAAGTACGTTC-1 contig 2 = AGTCTCAGTC...
umi AGCCCAATTA = 87 reads: -374 +11 non-validated
umi ATCATACGTG = 237 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=555]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
381-419 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYNNWPPITF at 355, score = 9 + 8
umis assigned: [103]
of which 1 are surviving nonsolos
reads assigned: 336
start codons at 34, 103, 239, 461
confident = false

TIG 2[bases=541]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-130 ==> 0-110 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=0)
130-370 ==> 113-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=7)
367-405 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
405-541 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQSYSIPWTF at 344, score = 9 + 8
umis assigned: [34, 49]
of which 2 are surviving nonsolos
reads assigned: 322
start codons at 20, 26, 82, 95, 228, 447
confident = false
see deletion of 3 bases at pos 110 on |253|IGKV1D-39|L-REGION+V-REGION|
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.300 = CTTAGGAAGTCTCGGC-1

using 254 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 245]
surviving nonsolo ucounts = 1[245]
ids = [5]

====================================================================================

UMI info for barcode CTTAGGAAGTCTCGGC-1 contig 1 = TGAGCGCAGA...
umi TCGGCAGATT = 236 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=13)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-548 ==> 0-124 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CGAWDTSLSAWVF at 357, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.306 = CTTAGGAAGTTTGCGT-1

using 235 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 3^2, 5, 217]
surviving nonsolo ucounts = 1[217]
ids = [5]

====================================================================================

UMI info for barcode CTTAGGAAGTTTGCGT-1 contig 1 = AGCTTCAGCT...
umi GTATTGGGTT = 217 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=538]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=3)
400-438 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
438-538 ==> 0-100 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CAAWDDSLNGFYVF at 368, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 47, 351, 376, 381, 393, 402
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.307 = CTTAGGACAAACTGCT-1

using 177 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 172]
surviving nonsolo ucounts = 1[172]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.308 = CTTAGGACAAGAAGAG-1

using 187 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[3, 7, 22, 29^2, 42, 50]
surviving nonsolo ucounts = 4[22, 29, 42, 50]
ids = [7, 11, 9, 8]

====================================================================================

UMI info for barcode CTTAGGACAAGAAGAG-1 contig 1 = GGCTGGGGGC...
umi TCGTGTAATA = 23 reads: +310 -1 +1 -21 +55 non-validated
umi TCGTGTTATA = 49 reads: +386 -1 +1 non-validated
umi TCGTTTAATA = 42 reads: +388 validated
umi TCGTTTTATA = 30 reads: +297 -1 +3 -1 +3 -1 +2 -1 +60 -1 +5 -13 non-validated

GOOD CONTIGS

TIG 1[bases=557]
42-403 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
430-557 ==> 0-127 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 5 reads
cdr3 = CSSYTSSSTLVF at 366, score = 8 + 9
umis assigned: [7, 8, 9, 11]
of which 4 are surviving nonsolos
reads assigned: 141
start codons at 42, 199, 243, 250, 253
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.311 = CTTAGGACAAGCTGTT-1

using 95 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[93]
surviving nonsolo ucounts = 1[93]
ids = [0]

====================================================================================

UMI info for barcode CTTAGGACAAGCTGTT-1 contig 1 = CAGCTGTGGG...
umi AAACATCCGC = 90 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=506]
0-42 ==> 9-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
42-398 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
398-436 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
436-506 ==> 0-70 on |305|IGLC1|C-REGION| [len=317] (mis=2)
junction support: 1 umis using 14 reads
cdr3 = CQSYDSSLSGLYVF at 366, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 89
start codons at 42, 196, 199, 250, 349, 376, 400
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.314 = CTTAGGACAATTCCTT-1

using 19655 reads

====================================================================================

graph has 10165 edges initially, 116 edges after simplification

total ucounts = 1597
nonsolo ucounts = 824[2^302, 3^177, 4^109, 5^67, 6^47, 7^23, 8^13, 9^8, 10^9, 11^5, 13^2, 15^2, 19, 20, 23, 34, 48, 53, 86, 100, 110, 141, 147, 154, 160, 177, 201^2, 214, 218, 224, 230, 231^2, 251, 263, 266, 269, 274, 276, 280, 281, 289, 293, 298^2, 300^2, 301, 304, 305, 306^2, 314, 315, 318, 323^2, 324, 328, 342, 367, 369, 373, 391, 399, 426, 496, 523, 536, 571, 636]
surviving nonsolo ucounts = 55[2, 86, 100, 110, 141, 147, 154, 160, 177, 201^2, 214, 218, 224, 230, 231^2, 251, 263, 266, 269, 274, 276, 280, 281, 289, 293, 298^2, 300^2, 301, 304, 305, 306^2, 314, 315, 318, 323^2, 324, 328, 342, 367, 369, 373, 391, 399, 426, 496, 523, 536, 571, 636]
ids = [1032, 945, 1299, 1071, 331, 1308, 27, 637, 706, 825, ...]

====================================================================================

UMI info for barcode CTTAGGACAATTCCTT-1 contig 1 = TGGGAGGAGT...
umi AACCACTCTC = 147 reads: -358 +24 non-validated
umi ACATCCTTTT = 301 reads: +333 -1XX +48 invalidated
umi ACTAACCCAA = 284 reads: +207 -1XX +174 invalidated
umi AGGTGCTCCT = 301 reads: +333 -1XX +48 invalidated
umi AGTCTATTCT = 400 reads: +382 validated
umi ATCCTCCGCA = 398 reads: +382 validated
umi ATTATAACGG = 351 reads: +333 -1XX +48 invalidated
umi CCCGTGTAGC = 240 reads: +207 -1XX +174 invalidated
umi CCGTCGTTTG = 328 reads: +382 validated
umi CCTGCAGTCA = 390 reads: +207 -1XX +174 invalidated
umi CCTGCGAAAA = 328 reads: +382 validated
umi CGTCGCGGGA = 525 reads: +382 validated
umi CGTTTCTCAC = 337 reads: +207 -1XX +174 invalidated
umi CTATGGTCTT = 638 reads: +382 validated
umi GACCTCAGGG = 309 reads: +382 validated
umi GACGCATTCC = 255 reads: +333 -1XX +48 invalidated
umi GACGCCTGCG = 269 reads: +382 validated
umi GACTCTCTAA = 317 reads: +333 -1XX +48 invalidated
umi GAGTGCCGGT = 317 reads: +382 validated
umi GCCTGATTGC = 366 reads: +382 validated
umi GCTTCTGTAC = 289 reads: +382 validated
umi GTCGATGCAA = 499 reads: +382 validated
umi TAGGGCGAGA = 308 reads: +333 -1XX +48 invalidated
umi TAGTCGAATA = 302 reads: +382 validated
umi TATATTTGAC = 305 reads: +333 -1XX +48 invalidated
umi TCAGTAGCGG = 304 reads: +382 validated
umi TCCCTATAGC = 289 reads: +254 -1XX +127 invalidated
umi TCCGTGATGA = 322 reads: +382 validated
umi TCGGTATATA = 288 reads: +281 -1XX +100 invalidated
umi TGTATTGATC = 210 reads: +382 validated
umi TGTCGCAGTA = 335 reads: +207 -1XX +174 invalidated
umi TGTGCTTTTT = 395 reads: +207 -1XX +174 invalidated

UMI info for barcode CTTAGGACAATTCCTT-1 contig 2 = GGGGCTCAGA...
umi ACTTTGTTAC = 227 reads: +430 validated
umi CAACGCGCCG = 140 reads: +415 -1 +14 non-validated
umi GCTTCCACGG = 220 reads: +430 validated
umi TCAACTTGCG = 25 reads: -380X +1 -5XX +1 -3XX +3 -2XX +6 -1XX +2 -1XX +2 -1XX +3 -2XX +17 invalidated
umi TCGCATATCC = 146 reads: +430 validated
umi TCTATTGGGT = 196 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=555]
37-285 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
381-419 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 24 umis using 1293 reads
cdr3 = CLHYDNWRRTF at 358, score = 9 + 8
umis assigned: [27, 80, 128, 195, 209, 256, 293, 473, 502, 529] and 22 others
of which 32 are surviving nonsolos
reads assigned: 10313
start codons at 37, 93, 106, 245, 368, 461
confident = true

TIG 2[bases=608]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=3)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=36)
463-509 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
509-608 ==> 0-99 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 5 umis using 77 reads
cdr3 = CARESYVGLYSSTSYPDYW at 421, score = 8 + 7
umis assigned: [155, 331, 940, 1221, 1308, 1329]
of which 6 are surviving nonsolos
reads assigned: 944
start codons at 79, 228, 235, 314, 382, 437, 563
confident = true
now this is a cell
paired!

GCTGTGTATTACTGTGCGAGAGAATCTTATGTCGGGCTCTATTCTTCAACCAGTTATCCCGACTACTGGGGTCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GTCTCCAGCCTGCAACCTGAAGATTTTGCCACCTATTATTGTCTACACTATGATAATTGGCGTCGCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.315 = CTTAGGACAATTGCTG-1

using 313 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 11[2, 3^2, 6^2, 7, 8^3, 12, 247]
surviving nonsolo ucounts = 1[247]
ids = [9]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.317 = CTTAGGACACATTCGA-1

using 291 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[289]
surviving nonsolo ucounts = 1[289]
ids = [2]

====================================================================================

UMI info for barcode CTTAGGACACATTCGA-1 contig 1 = GGGGGACTCC...
umi TGGTTACACA = 280 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=594]
21-379 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
404-454 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
454-594 ==> 0-140 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 41 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 366, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 21, 65, 244, 247, 250, 336, 406
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.328 = CTTAGGACACTAAGTC-1

using 630 reads

====================================================================================

graph has 200 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[8, 120, 173, 324]
surviving nonsolo ucounts = 3[120, 173, 324]
ids = [3, 5, 2]

====================================================================================

UMI info for barcode CTTAGGACACTAAGTC-1 contig 1 = GGGGAGGAAT...
umi CCCAGTGTCT = 325 reads: +388 validated
umi CCTAGCACCG = 120 reads: +388 validated
umi CGACTAATTA = 24 reads: -347X +1 -2X +9 -1XX +4 -1XX +16 -1XX +6 invalidated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 73 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [2, 3, 5]
of which 3 are surviving nonsolos
reads assigned: 463
start codons at 31, 37, 106, 242, 461
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.330 = CTTAGGACAGATCGGA-1

using 424 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[13, 190, 220]
surviving nonsolo ucounts = 2[190, 220]
ids = [2, 0]

====================================================================================

UMI info for barcode CTTAGGACAGATCGGA-1 contig 1 = ATCACATAAC...
umi ACTGTTTGGG = 214 reads: +421 validated
umi CCGCATTCCC = 190 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=609]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=10)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
479-609 ==> 0-130 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 2 umis using 42 reads
cdr3 = CARSELVIAIQRFDYW at 400, score = 8 + 6
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 401
start codons at 58, 209, 256, 355
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.332 = CTTAGGACAGCATGAG-1

using 314 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^3, 3, 303]
surviving nonsolo ucounts = 1[303]
ids = [2]

====================================================================================

UMI info for barcode CTTAGGACAGCATGAG-1 contig 1 = GGGCTGCTTC...
umi ATCATTTTCG = 296 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=573]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=2)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=2)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
445-573 ==> 0-128 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQSYDSSLSASYVF at 375, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 292
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 54.336 = CTTAGGACAGTCCTTC-1

using 269 reads

====================================================================================

graph has 111 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 4, 261]
surviving nonsolo ucounts = 1[261]
ids = [1]

====================================================================================
NOT paired!
sorting bam, mem = 0.05
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk054-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk054-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

11.203 seconds used processing barcodes, peak mem = 0.23
