[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.21 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk051-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk051-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk051.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.0 = CTCGGAGTCACGCGGT-1

using 4677 reads

====================================================================================

graph has 2312 edges initially, 48 edges after simplification

total ucounts = 424
nonsolo ucounts = 167[2^56, 3^35, 4^19, 5^13, 6^9, 7^5, 8, 9, 10^3, 11, 12, 17, 24, 25, 37, 45, 62, 96, 124, 127, 134, 144, 186, 205, 207, 213, 234, 238, 261, 275, 285, 302, 317, 345]
surviving nonsolo ucounts = 20[37, 45, 62, 96, 124, 127, 134, 144, 186, 205, 207, 213, 234, 238, 261, 275, 285, 302, 317, 345]
ids = [373, 32, 14, 333, 119, 329, 179, 222, 349, 386, ...]

====================================================================================

UMI info for barcode CTCGGAGTCACGCGGT-1 contig 1 = GACACAGCTC...
umi ATGACACGTG = 201 reads: +376 validated
umi CATACCGCCA = 124 reads: +376 validated
umi TATTGTCCCT = 95 reads: +376 validated
umi TGCGCGGCTT = 38 reads: -12 +348 -16 non-validated
umi TTGCTTTTAC = 284 reads: +376 validated
umi TTTGGTTGCC = 275 reads: +376 validated

UMI info for barcode CTCGGAGTCACGCGGT-1 contig 2 = GGGGATGCTT...
umi AACTGTAATG = 263 reads: +454 validated
umi CGATTATATA = 242 reads: +454 validated
umi TATTAGCTCC = 129 reads: +454 validated
umi TCGGAAGGCT = 186 reads: +454 validated
umi TTTGGTTAGC = 293 reads: -419X +5 -7X +1 -6XX +1 -11XX +1 -2XX +1 invalidated

UMI info for barcode CTCGGAGTCACGCGGT-1 contig 3 = GTGGGCTCAG...
umi CGCCGCAGCG = 216 reads: +385 validated
umi CGTACGGGAC = 136 reads: +385 validated
umi GCTAGTCACT = 233 reads: +385 validated

UMI info for barcode CTCGGAGTCACGCGGT-1 contig 4 = AGGAGTCAGA...
umi AAAACGGCTT = 34 reads: -345 +1 -3X +3 -2XX +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi GACACAGGTT = 143 reads: +388 validated
umi TGTCGTCGCC = 210 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=723]
136-476 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=6)
474-512 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
512-723 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 5 umis using 147 reads
cdr3 = CQAWDSSTVVF at 451, score = 6 + 8
umis assigned: [88, 119, 333, 373, 412, 421]
of which 6 are surviving nonsolos
reads assigned: 1009
start codons at 136, 141, 197, 284, 430, 434
confident = false

TIG 2[bases=634]
20-397 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=11)
424-474 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
474-634 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 4 umis using 76 reads
cdr3 = CARLNVRQGSNFPDAFDFW at 386, score = 9 + 7
umis assigned: [15, 169, 329, 349, 420]
of which 5 are surviving nonsolos
reads assigned: 1097
start codons at 4, 20, 29, 41, 85, 399, 426, 455, 528
confident = false

TIG 3[bases=631]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=8)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
420-631 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 99 reads
cdr3 = CYSTDSSGNHGGVF at 350, score = 7 + 8
umis assigned: [172, 179, 249]
of which 3 are surviving nonsolos
reads assigned: 577
start codons at 35, 96, 140, 165, 183, 234, 296, 333, 378
confident = false

TIG 4[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 50 reads
cdr3 = CQQYNSYSYTF at 354, score = 8 + 8
umis assigned: [0, 222, 386]
of which 3 are surviving nonsolos
reads assigned: 379
start codons at 27, 33, 89, 102, 334, 457
confident = false

REJECT CONTIGS

TIG 1[bases=453]
3-350 ==> 5-352 on rc of segment before IGHJ4 exon 1 [len=352] (mis=7)
348-399 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=0)
399-453 ==> 0-54 on rc of segment before IGHJ5 exon 1 [len=348] (mis=2)
umis assigned: [14]
of which 1 are surviving nonsolos
reads assigned: 55
start codons at 121, 169, 241, 343
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.4 = CTCGGAGTCAGGCAAG-1

using 1538 reads

====================================================================================

graph has 1324 edges initially, 12 edges after simplification

total ucounts = 384
nonsolo ucounts = 144[2^60, 3^32, 4^17, 5^7, 6^5, 7^2, 8^4, 9^4, 10^3, 11^2, 12^4, 13, 15, 20, 719]
surviving nonsolo ucounts = 1[719]
ids = [172]

====================================================================================

REJECT CONTIGS

TIG 1[bases=304]
3-128 ==> 223-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
131-168 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
168-304 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYDSSPALTF at 104, score = 9 + 8
umis assigned: [172]
of which 1 are surviving nonsolos
reads assigned: 712
start codons at 114, 155, 210
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.5 = CTCGGAGTCATAACCG-1

using 1284 reads

====================================================================================

graph has 1336 edges initially, 16 edges after simplification

total ucounts = 344
nonsolo ucounts = 158[2^70, 3^34, 4^23, 5^9, 6^7, 7^3, 8^2, 9^2, 10^2, 12, 13, 15, 16, 232, 314]
surviving nonsolo ucounts = 4[2, 3, 232, 314]
ids = [255, 125, 206, 248]

====================================================================================

UMI info for barcode CTCGGAGTCATAACCG-1 contig 1 = ACCCAAAAAC...
umi CCATCAGCAG = 2 reads: -436 non-validated
umi GCCACTTTAA = 232 reads: +436 validated
umi GTTCAAGATA = 2 reads: -436 non-validated

UMI info for barcode CTCGGAGTCATAACCG-1 contig 2 = TGGGGAGGAA...
umi GTCTAAGCTC = 315 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=650]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-650 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [125, 206, 255]
of which 3 are surviving nonsolos
reads assigned: 232
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false

TIG 2[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [248]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.14 = CTCGGAGTCCGTAGTA-1

using 621 reads

====================================================================================

graph has 865 edges initially, 6 edges after simplification

total ucounts = 321
nonsolo ucounts = 126[2^62, 3^26, 4^14, 5^9, 6^3, 7^3, 8^5, 9^2, 11, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.21 = CTCGGAGTCGTACCGG-1

using 280 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 277]
surviving nonsolo ucounts = 1[277]
ids = [1]

====================================================================================

UMI info for barcode CTCGGAGTCGTACCGG-1 contig 1 = GAGACTCAGT...
umi TCTAAACTTT = 251 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=488]
21-372 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
372-409 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
409-488 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYNSYPLTF at 348, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 21, 27, 83, 96, 232, 235, 328, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.24 = CTCGGAGTCTATCCTA-1

using 693 reads

====================================================================================

graph has 286 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 10[2^2, 3, 4, 9, 11, 12, 15, 314, 316]
surviving nonsolo ucounts = 2[314, 316]
ids = [12, 11]

====================================================================================

UMI info for barcode CTCGGAGTCTATCCTA-1 contig 1 = TGGGAGGAAT...
umi CTCTTTGGGT = 314 reads: +388 validated
umi GTACTAATAG = 321 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 111 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [11, 12]
of which 2 are surviving nonsolos
reads assigned: 625
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.29 = CTCGGAGTCTGGAGCC-1

using 175 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 167]
surviving nonsolo ucounts = 1[167]
ids = [0]

====================================================================================

UMI info for barcode CTCGGAGTCTGGAGCC-1 contig 1 = ATCATCCAAC...
umi AATCCCTACA = 160 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=534]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
440-488 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
488-534 ==> 0-46 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 400, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 157
start codons at 58, 214, 256, 322, 355, 445
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.32 = CTCGGAGTCTTGTTTG-1

using 275 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 3, 6, 60, 202]
surviving nonsolo ucounts = 2[60, 202]
ids = [1, 0]

====================================================================================

UMI info for barcode CTCGGAGTCTTGTTTG-1 contig 1 = GGGCCTCAGG...
umi AGCGCGAAAC = 195 reads: +376 validated
umi CCAAGTACGG = 54 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=497]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-375 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=9)
373-411 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
411-497 ==> 0-86 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 44 reads
cdr3 = CQTWDSSTVVF at 350, score = 6 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 246
start codons at 35, 40, 96, 183, 234, 329, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.37 = CTCGGGAAGATCCCGC-1

using 304 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[302]
surviving nonsolo ucounts = 1[302]
ids = [2]

====================================================================================

UMI info for barcode CTCGGGAAGATCCCGC-1 contig 1 = AGAGCTGCTC...
umi TTTTTCACTT = 251 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=508]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
416-508 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYGYSPFTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 31, 239, 365, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.42 = CTCGGGAAGCGTGAGT-1

using 190 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[189]
surviving nonsolo ucounts = 1[189]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=552]
3-75 ==> 5665-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
27-378 ==> 0-351 on |257|IGKV1D-43|L-REGION+V-REGION| [len=351] (mis=0)
384-416 ==> 6-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 27, 33, 89, 102, 241, 458
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.59 = CTCGGGACAACGCACC-1

using 240 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[3, 6, 7, 223]
surviving nonsolo ucounts = 1[223]
ids = [0]

====================================================================================

UMI info for barcode CTCGGGACAACGCACC-1 contig 1 = ACCCAAAAAC...
umi ACGTTCCTGT = 208 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=513]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-513 ==> 0-23 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.60 = CTCGGGACAAGCGTAG-1

using 327 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[325]
surviving nonsolo ucounts = 1[325]
ids = [2]

====================================================================================

UMI info for barcode CTCGGGACAAGCGTAG-1 contig 1 = GGAGTCAGTC...
umi GGGTGCTCAC = 329 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 69 reads
cdr3 = CQQSYTTLLTF at 353, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 323
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.73 = CTCGGGACACGAAGCA-1

using 726 reads

====================================================================================

graph has 1069 edges initially, 10 edges after simplification

total ucounts = 378
nonsolo ucounts = 133[2^60, 3^19, 4^27, 5^8, 6^6, 7^2, 8^4, 9^4, 10, 14^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.75 = CTCGGGACACGTTGGC-1

using 77 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 15[2^3, 3^3, 4^2, 5^2, 6, 7^2, 8, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.84 = CTCGGGACAGTGGGAT-1

using 560 reads

====================================================================================

graph has 246 edges initially, 6 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[3, 112, 212, 227]
surviving nonsolo ucounts = 2[212, 227]
ids = [6, 0]

====================================================================================

UMI info for barcode CTCGGGACAGTGGGAT-1 contig 1 = GATCAGGACT...
umi ACAATTACTT = 209 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=513]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-513 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false

REJECT CONTIGS

TIG 1[bases=535]
0-81 ==> 11262-11343 on segment before IGLV3-6 exon 1 [len=11502] (mis=4)
35-78 ==> 0-43 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=0)
78-337 ==> 88-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=15)
337-375 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
375-535 ==> 0-160 on |306|IGLC2|C-REGION| [len=317] (mis=1)
cdr3 = CYSTDNSGRHSGMF at 305, score = 6 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 35, 138, 185, 189, 288, 341
confident = false
not full
full length transcript of length 535
VJ delta = 67
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.85 = CTCGGGACATCACAAC-1

using 388 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 8, 373]
surviving nonsolo ucounts = 1[373]
ids = [0]

====================================================================================

UMI info for barcode CTCGGGACATCACAAC-1 contig 1 = GGAGGAACTG...
umi AATTAGCCTC = 375 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-340 ==> 0-306 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=25)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYNKWPLTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 368
start codons at 34, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.86 = CTCGGGACATCACGAT-1

using 14 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.87 = CTCGGGACATCCTTGC-1

using 193 reads

====================================================================================

graph has 140 edges initially, 10 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 28, 157]
surviving nonsolo ucounts = 2[28, 157]
ids = [6, 1]

====================================================================================

UMI info for barcode CTCGGGACATCCTTGC-1 contig 1 = GAGTCAGTCC...
umi GTACTCTGTG = 154 reads: +382 validated
umi TGGTCCGGTT = 15 reads: -27 +1 -1 +13 -1XX +2 -1XX +10 -1XX +47 -1XX +2 -1XX +6 -1XX +5 -1XX +7 -88 +1 -1X +4 -1X +3 -2XX +20 -1XX +2 -1XX +6 -2XX +5 -1XX +1 -1XX +1 -1XX +2 -1X +1 -1X +1 -1X +4 -68 +1 -1X +7 -2X +5 -3X +1 -1X +4 -1X +2 -1X +4 invalidated

GOOD CONTIGS

TIG 1[bases=549]
31-279 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CLHYDNRRRTF at 352, score = 9 + 8
umis assigned: [1, 6]
of which 2 are surviving nonsolos
reads assigned: 167
start codons at 31, 87, 100, 239, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.88 = CTCGGGACATCGGAAG-1

using 938 reads

====================================================================================

graph has 226 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[936]
surviving nonsolo ucounts = 1[936]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=300]
0-44 ==> 293-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
51-89 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
89-300 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 923
start codons at 
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.91 = CTCGGGACATGAAGTA-1

using 1380 reads

====================================================================================

graph has 376 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[5, 622, 748]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.97 = CTCGGGAGTACCGGCT-1

using 264 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[263]
surviving nonsolo ucounts = 1[263]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=496]
0-320 ==> 31-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
323-360 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
360-496 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYDNLPPLTF at 296, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 31, 44, 183, 306, 402
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.98 = CTCGGGAGTACCGTTA-1

using 335 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[3, 325]
surviving nonsolo ucounts = 1[325]
ids = [1]

====================================================================================

UMI info for barcode CTCGGGAGTACCGTTA-1 contig 1 = GGGGAGGAAT...
umi AAGCTCGGTC = 328 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 320
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.99 = CTCGGGAGTACTCTCC-1

using 309 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[305]
surviving nonsolo ucounts = 1[305]
ids = [2]

====================================================================================

UMI info for barcode CTCGGGAGTACTCTCC-1 contig 1 = GGAGTCAGAC...
umi ATCACACCAT = 1 reads: -218X +4 -2X +1 -1 +2 -2 +3 -1 +2 -1 +7 -1 +1 -1X +2 -3 +1 -1X +1 -2X +4 -2X +1 -2 +1 -121X invalidated
umi ATCACCCCAG = 268 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=482]
0-26 ==> 3-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
26-377 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
414-482 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CLQDYTYPFSF at 353, score = 9 + 7
umis assigned: [1, 2]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 26, 32, 88, 101, 183, 186, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.109 = CTCGGGAGTCCGTGAC-1

using 430 reads

====================================================================================

graph has 574 edges initially, 2 edges after simplification

total ucounts = 236
nonsolo ucounts = 80[2^41, 3^13, 4^9, 5^6, 6^3, 7^3, 8^2, 9, 10, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.112 = CTCGGGAGTCTTGATG-1

using 195 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 190]
surviving nonsolo ucounts = 1[190]
ids = [3]

====================================================================================

UMI info for barcode CTCGGGAGTCTTGATG-1 contig 1 = GGCTGGGGTC...
umi TAGGTTATAG = 186 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=540]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-386 ==> 0-344 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=20)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
430-540 ==> 0-110 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CCSHAGSYIWVF at 366, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 42, 178, 181, 199, 253, 349, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.120 = CTCGGGAGTTAAGATG-1

using 516 reads

====================================================================================

graph has 474 edges initially, 4 edges after simplification

total ucounts = 141
nonsolo ucounts = 40[2^14, 3^6, 4^8, 5^6, 6^3, 9, 17, 263]
surviving nonsolo ucounts = 1[263]
ids = [59]

====================================================================================

UMI info for barcode CTCGGGAGTTAAGATG-1 contig 1 = AGAGCTGCTC...
umi CCCTGGTCAC = 239 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=471]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
416-471 ==> 0-55 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYGSSPVTF at 355, score = 9 + 8
umis assigned: [59]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 31, 239, 242, 365, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.123 = CTCGGGAGTTCAGCGC-1

using 17 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.125 = CTCGGGAGTTCGTTGA-1

using 218 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[218]
surviving nonsolo ucounts = 1[218]
ids = [0]

====================================================================================

UMI info for barcode CTCGGGAGTTCGTTGA-1 contig 1 = ATCCAACAAC...
umi GTTCTTATTA = 212 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=516]
0-55 ==> 249-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
55-408 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=41)
427-473 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
473-516 ==> 0-43 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CALVSTLSALPFDFW at 397, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 55, 253, 259, 352
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.129 = CTCGGGAGTTTGGGCC-1

using 210 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[208]
surviving nonsolo ucounts = 1[208]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=555]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
28-87 ==> 5638-5697 on segment before IGLV3-29 exon 1 [len=6000] (mis=4)
40-391 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=3)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
424-555 ==> 0-131 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 40, 101, 239, 242, 338
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.130 = CTCGGGATCACAGGCC-1

using 496 reads

====================================================================================

graph has 162 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[8, 201, 286]
surviving nonsolo ucounts = 2[201, 286]
ids = [0, 2]

====================================================================================

UMI info for barcode CTCGGGATCACAGGCC-1 contig 1 = AGACCCAGTC...
umi CAGGTACATA = 1 reads: -276X +4 -1X +22 -1X +13 -3X +3 -1X +7 -51 invalidated
umi GACGCATCCA = 262 reads: +382 validated

UMI info for barcode CTCGGGATCACAGGCC-1 contig 2 = GACCATGGCC...
umi ATACGAGCCC = 188 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=481]
0-20 ==> 27-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
20-371 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=13)
365-402 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
402-481 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQAKSFSF at 347, score = 9 + 7
umis assigned: [1, 2]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 20, 26, 82, 95, 231, 444
confident = false

TIG 2[bases=562]
4-354 ==> 0-350 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=0)
357-395 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
395-562 ==> 0-167 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 33 reads
cdr3 = CCSYAGSYTPYVF at 328, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 186
start codons at 4, 143, 161, 205, 212, 215, 311, 338, 527
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.132 = CTCGGGATCAGATAAG-1

using 233 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[230]
surviving nonsolo ucounts = 1[230]
ids = [0]

====================================================================================

UMI info for barcode CTCGGGATCAGATAAG-1 contig 1 = GGGGTCTCAG...
umi CCGTAACGTT = 225 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=527]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-384 ==> 0-346 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=0)
391-429 ==> 8-46 on |317|IGLJ7|J-REGION| [len=46] (mis=0)
429-527 ==> 0-98 on |308|IGLC7|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CSSYAGSIPHAVF at 362, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 38, 195, 239, 246, 345, 372, 390
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.135 = CTCGGGATCAGGATCT-1

using 57 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[54]
surviving nonsolo ucounts = 1[54]
ids = [3]

====================================================================================

UMI info for barcode CTCGGGATCAGGATCT-1 contig 1 = ACCATGGCCT...
umi GTTAATAAAC = 48 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=457]
3-343 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
359-397 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
397-457 ==> 0-60 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CCSEAGGGVPGLLF at 327, score = 7 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 48
start codons at 3, 157
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.137 = CTCGGGATCATACGGT-1

using 6504 reads

====================================================================================

graph has 3468 edges initially, 78 edges after simplification

total ucounts = 584
nonsolo ucounts = 250[2^96, 3^63, 4^24, 5^19, 6^12, 7^4, 8^4, 9, 10^2, 13^2, 14, 26, 66, 111, 149, 158, 160, 208, 221, 222, 223, 237, 259, 284, 295, 305, 321, 327, 336, 346, 351, 383, 409]
surviving nonsolo ucounts = 22[26, 66, 111, 149, 158, 160, 208, 221, 222, 223, 237, 259, 284, 295, 305, 321, 327, 336, 346, 351, 383, 409]
ids = [426, 401, 208, 429, 351, 455, 279, 545, 35, 214, ...]

====================================================================================

UMI info for barcode CTCGGGATCATACGGT-1 contig 1 = ATACTTTCTG...
umi CATCGGAGCC = 345 reads: +421 validated
umi GCTACACCTC = 124 reads: -410X +2 -1XX +1 -6XX +1 invalidated
umi TCAATCTAAA = 159 reads: +421 validated
umi TCTTACGGGG = 283 reads: +421 validated
umi TTTCCTCCTC = 343 reads: +421 validated

UMI info for barcode CTCGGGATCATACGGT-1 contig 2 = GGGGAGGAAC...
umi AATAACATCC = 333 reads: +382 validated
umi ACACTGGTTG = 221 reads: +382 validated
umi ACTTACGATA = 383 reads: +382 validated
umi CCGTGGTGCA = 226 reads: +382 validated
umi CGAGAGGCGC = 324 reads: +382 validated
umi CTTTATACCA = 255 reads: +382 validated
umi GACATCTTAA = 338 reads: +382 validated
umi GGTCCCGCTT = 353 reads: +382 validated
umi GTTTTCGTGT = 67 reads: +382 validated
umi TTCGTTCAGT = 218 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=529]
0-37 ==> 64-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
37-393 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=12)
410-458 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
458-529 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 4 umis using 87 reads
cdr3 = CARDGGRGGTPFDYW at 382, score = 9 + 7
umis assigned: [177, 346, 455, 494, 574]
of which 5 are surviving nonsolos
reads assigned: 1242
start codons at 37, 81, 392
confident = true

TIG 2[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 411 reads
cdr3 = CQQRSNWLLTF at 357, score = 9 + 9
umis assigned: [19, 35, 67, 214, 225, 298, 308, 370, 401, 545]
of which 10 are surviving nonsolos
reads assigned: 2682
start codons at 36, 241, 244, 460
confident = true

REJECT CONTIGS

TIG 1[bases=582]
0-25 ==> 6-31 on |185|IGHV4-34|5'UTR| [len=31] (mis=0)
0-25 ==> 3160-3185 on rc of segment before IGHV7-34-1 exon 2 [len=3185] (mis=0)
4-34 ==> 1353-1383 on rc of segment before IGHV7-81 exon 2 [len=1396] (mis=1)
12-46 ==> 5966-6000 on rc of segment after IGHV4-4 exon 1 [len=6000] (mis=0)
25-396 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=1)
395-423 ==> 0-28 on |15|IGHD2-21|D-REGION| [len=28] (mis=6)
442-480 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
480-582 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [17, 208, 279, 329, 351, 426, 429]
of which 7 are surviving nonsolos
reads assigned: 1076
start codons at 2, 25, 46, 90, 176, 498, 559
confident = false
frameshifted full length transcript of length 582
did not find CDR3
now this is a cell
paired!

GCCGCAGACACGGCCGTGTATTACTGTGCGAGAGATGGGGGGCGAGGCGGGACCCCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCTCCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.151 = CTCGGGATCTCTTATG-1

using 957 reads

====================================================================================

graph has 1508 edges initially, 2 edges after simplification

total ucounts = 435
nonsolo ucounts = 206[2^98, 3^39, 4^27, 5^16, 6^9, 7^6, 8^2, 9, 10, 11^2, 12, 13, 14, 15, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.152 = CTCGGGATCTGGCGTG-1

using 234 reads

====================================================================================

graph has 88 edges initially, 10 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[24, 209]
surviving nonsolo ucounts = 2[24, 209]
ids = [0, 2]

====================================================================================

UMI info for barcode CTCGGGATCTGGCGTG-1 contig 1 = GGGACCGCTG...
umi ACAAAAAGTC = 16 reads: +40 -1XX +89 -1XX +1 -1X +8 -1X +4 -3X +2 -1X +1 -1X +1 -229X +3 -1X invalidated
umi GACAGCTGCG = 221 reads: +17 -2XX +72 -1XX +296 invalidated

GOOD CONTIGS

TIG 1[bases=515]
65-426 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=8)
415-453 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
453-515 ==> 0-62 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CSSYTSSSTLVF at 389, score = 8 + 9
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 220
start codons at 65, 222, 266, 273, 276
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.154 = CTCGGGATCTTCTGGC-1

using 638 reads

====================================================================================

graph has 248 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 8, 625]
surviving nonsolo ucounts = 1[625]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=534]
3-78 ==> 5665-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
27-380 ==> 0-353 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=2)
359-398 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=17)
398-534 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 618
start codons at 27, 33, 89, 102, 165, 238, 440
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.156 = CTCGGGATCTTTAGTC-1

using 385 reads

====================================================================================

graph has 198 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2, 5, 6, 7, 8, 354]
surviving nonsolo ucounts = 1[354]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=478]
0-232 ==> 121-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
229-267 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
267-478 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CASWDDSLRGRVF at 200, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 351
start codons at 33, 183, 208, 213
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.160 = CTCGTACAGACCTAGG-1

using 242 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 235]
surviving nonsolo ucounts = 1[235]
ids = [3]

====================================================================================

UMI info for barcode CTCGTACAGACCTAGG-1 contig 1 = TGGGGGACTC...
umi GGCCTGGGCG = 195 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=531]
22-372 ==> 0-350 on |94|IGHV2-26|L-REGION+V-REGION| [len=357] (mis=24)
389-440 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
440-531 ==> 0-91 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CASAAAPGDWFDPW at 367, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 22, 178, 245, 337, 494
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.165 = CTCGTACAGAGGTAGA-1

using 145 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 142]
surviving nonsolo ucounts = 1[142]
ids = [0]

====================================================================================

UMI info for barcode CTCGTACAGAGGTAGA-1 contig 1 = GGGTAGAGAA...
umi CACTATATGC = 135 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=480]
0-35 ==> 79-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
35-388 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=5)
385-423 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
423-480 ==> 0-57 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CASWDDSLNGPVF at 356, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 134
start codons at 35, 339, 364, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.175 = CTCGTACAGCCCAGCT-1

using 177 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 170]
surviving nonsolo ucounts = 1[170]
ids = [4]

====================================================================================

UMI info for barcode CTCGTACAGCCCAGCT-1 contig 1 = GGAGTCTCCC...
umi TCGCGGTCCT = 156 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=487]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=20)
431-477 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
junction support: 1 umis using 17 reads
cdr3 = CARPYNSYWLGFDYW at 401, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 152
start codons at 59, 233
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.182 = CTCGTACAGCTGATAA-1

using 235 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 4, 224]
surviving nonsolo ucounts = 1[224]
ids = [0]

====================================================================================

UMI info for barcode CTCGTACAGCTGATAA-1 contig 1 = AGTCAGTCTC...
umi ACATGAGTAC = 190 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=504]
0-24 ==> 23-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
24-375 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
374-412 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
412-504 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQSYRRPITF at 351, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 189
start codons at 24, 30, 86, 99, 235, 334, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.183 = CTCGTACAGCTGCAAG-1

using 658 reads

====================================================================================

graph has 336 edges initially, 16 edges after simplification

total ucounts = 35
nonsolo ucounts = 26[2^4, 3^8, 4^3, 5^3, 7, 9^3, 11, 14, 243, 288]
surviving nonsolo ucounts = 2[243, 288]
ids = [0, 21]

====================================================================================

UMI info for barcode CTCGTACAGCTGCAAG-1 contig 1 = AGGAATCAGT...
umi AATACCCTCG = 229 reads: +388 validated
umi GAACTAGTAT = 268 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=511]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-511 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 64 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [0, 21]
of which 2 are surviving nonsolos
reads assigned: 490
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.186 = CTCGTACAGGACCACA-1

using 278 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 272]
surviving nonsolo ucounts = 1[272]
ids = [0]

====================================================================================

UMI info for barcode CTCGTACAGGACCACA-1 contig 1 = GAAGAGCTGC...
umi ACTAACCCGG = 256 reads: +385 validated
umi AGGGGATCGT = 5 reads: -16 +35 -1X +10 -1XX +11 -1X +10 -1X +29 -1X +2 -8 +3 -1X +23 -2X +2 -8X +1 -3X +1 -1X +3 -1X +1 -29X +6 -1X +1 -1X +6 -1X +13 -1X +26 -124 invalidated

GOOD CONTIGS

TIG 1[bases=490]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-490 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYGSSRGTF at 357, score = 9 + 8
umis assigned: [0, 1]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.189 = CTCGTACAGGGAGTAA-1

using 79 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 3, 73]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.203 = CTCGTACAGTGGAGAA-1

using 85 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 16[2^4, 3^3, 4^2, 6^2, 8^2, 10^3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.205 = CTCGTACCAAAGAATC-1

using 2025 reads

====================================================================================

graph has 2561 edges initially, 36 edges after simplification

total ucounts = 934
nonsolo ucounts = 438[2^169, 3^102, 4^73, 5^43, 6^19, 7^13, 8^11, 9^3, 10^2, 12, 13^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.216 = CTCGTACCAAGTTCTG-1

using 239 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[237]
surviving nonsolo ucounts = 1[237]
ids = [1]

====================================================================================

UMI info for barcode CTCGTACCAAGTTCTG-1 contig 1 = GGACTCCTGT...
umi CACGCTCGGC = 229 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=551]
18-376 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
401-451 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
451-551 ==> 0-100 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 25 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 363, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 18, 62, 241, 244, 247, 333, 403
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.221 = CTCGTACCACGAGGTA-1

using 250 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[5, 14, 227]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.224 = CTCGTACCACGTTGGC-1

using 1057 reads

====================================================================================

graph has 344 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 284, 303, 466]
surviving nonsolo ucounts = 3[284, 303, 466]
ids = [5, 0, 2]

====================================================================================

UMI info for barcode CTCGTACCACGTTGGC-1 contig 1 = ACACAACAGC...
umi TACGATCCCG = 285 reads: +412 validated

UMI info for barcode CTCGTACCACGTTGGC-1 contig 2 = GGAGTCAGAC...
umi AACAGATGTA = 304 reads: +388 validated
umi AGGAAATCGA = 464 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=537]
0-54 ==> 6-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=0)
54-407 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=2)
433-466 ==> 13-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
466-537 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CATFSEYGWLQFG at 396, score = 9 + 6
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 54, 210, 252, 274, 318, 351, 419
confident = true

TIG 2[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 122 reads
cdr3 = CQQYNSYPLTF at 353, score = 8 + 9
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 756
start codons at 26, 32, 88, 101, 237, 240, 333, 456
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.233 = CTCGTACCAGCGATCC-1

using 29511 reads

====================================================================================

graph has 7529 edges initially, 64 edges after simplification

total ucounts = 875
nonsolo ucounts = 458[2^162, 3^72, 4^46, 5^27, 6^19, 7^10, 8^2, 9^3, 10, 14, 16, 24, 25, 27, 39, 60, 71, 73, 89, 113, 143, 158, 163, 166, 168, 173, 177, 179, 181, 182^2, 185, 191^3, 196, 204, 209^2, 212^2, 213, 214, 216, 219, 222, 225^2, 228, 230^2, 237, 238^2, 240^2, 243^2, 246, 248, 249, 251^2, 253, 254, 257, 258^2, 259^3, 264^2, 265^3, 266^2, 267^2, 272, 273, 274, 276^2, 279, 280^2, 283, 284^2, 286, 287^2, 289^3, 291, 292^2, 293^2, 294, 296, 297, 300, 305, 309, 312, 313, 316^2, 323, 325, 329, 330, 331, 333, 336, 340, 341, 366, 367, 472, 482]
surviving nonsolo ucounts = 105[71, 143, 158, 163, 168, 173, 177, 179, 181, 182^2, 185, 191^3, 196, 204, 209^2, 212^2, 213, 214, 216, 219, 222, 225^2, 228, 230^2, 237, 238^2, 240^2, 243^2, 246, 248, 249, 251^2, 253, 254, 257, 258^2, 259^3, 264^2, 265^3, 266^2, 267^2, 272, 273, 274, 276^2, 279, 280^2, 283, 284^2, 286, 287^2, 289^3, 291, 292^2, 293^2, 294, 296, 297, 300, 305, 309, 312, 313, 316^2, 323, 325, 329, 330, 331, 333, 336, 340, 341, 366, 367, 472, 482]
ids = [472, 658, 589, 713, 242, 815, 717, 181, 588, 154, ...]

====================================================================================

UMI info for barcode CTCGTACCAGCGATCC-1 contig 1 = GGGAGAGCCC...
umi AAATATAGAA = 297 reads: +382 validated
umi AACAAACCAT = 249 reads: +382 validated
umi AACTTATGTG = 250 reads: +382 validated
umi AAGCCCCGGA = 240 reads: +382 validated
umi AAGTTTTCCA = 260 reads: +382 validated
umi AATTGCGCCG = 297 reads: +382 validated
umi AATTGCTGTG = 262 reads: +382 validated
umi ACCAGGCGCG = 335 reads: +382 validated
umi ACCAGTCGGT = 215 reads: +382 validated
umi ACGACTTCAG = 286 reads: +382 validated
umi ACGGCCTAAC = 232 reads: +382 validated
umi ATACTTCTTT = 333 reads: +382 validated
umi ATCCAGCTAT = 269 reads: +165 -1XX +216 invalidated
umi ATCTCCTGGT = 277 reads: +382 validated
umi ATCTCGCCTC = 213 reads: +382 validated
umi CAAAACCGGT = 212 reads: +382 validated
umi CAAACACTCT = 219 reads: +382 validated
umi CAACTTATGT = 309 reads: +382 validated
umi CAACTTCCGT = 245 reads: +382 validated
umi CAAGACCGTA = 276 reads: +382 validated
umi CACTCCGCCT = 290 reads: +382 validated
umi CCAGCTTGTC = 315 reads: +382 validated
umi CCCGTACGGA = 262 reads: +14 -1X +1 -1 +3 -1X +2 -2X +2 -1XX +354 invalidated
umi CCCTTTACAA = 194 reads: +382 validated
umi CCTACTGTCA = 257 reads: +382 validated
umi CCTATACGGT = 284 reads: +382 validated
umi CCTCTGTGGA = 263 reads: +382 validated
umi CGGCTTCTGA = 313 reads: +382 validated
umi CTCAAGGCAT = 298 reads: +382 validated
umi CTCTCATTGG = 244 reads: +382 validated
umi CTCTCGTCCA = 226 reads: +382 validated
umi CTGATCTCAC = 245 reads: +382 validated
umi CTTCTGGTAT = 295 reads: +382 validated
umi GAAATACATA = 259 reads: +382 validated
umi GAACTCTCAT = 275 reads: +382 validated
umi GACCAGAGTA = 234 reads: +382 validated
umi GAGCTATGCT = 329 reads: +382 validated
umi GATACTGACT = 294 reads: +382 validated
umi GCAAAAGCCC = 274 reads: +382 validated
umi GCCCACCGCG = 471 reads: -140X +242 invalidated
umi GCGGGACAAG = 338 reads: +382 validated
umi GCTTTAAGAG = 298 reads: +382 validated
umi GGACAGCCAG = 187 reads: +382 validated
umi GGCAAAATCA = 265 reads: +382 validated
umi GGCATACGGG = 316 reads: +382 validated
umi GGTACTCCTT = 240 reads: +382 validated
umi GGTTTTCCAA = 364 reads: +382 validated
umi GTATAGTCCA = 288 reads: +382 validated
umi GTCAATCCTT = 225 reads: +194 -1XX +187 invalidated
umi GTCCCTCATC = 261 reads: +382 validated
umi GTCTATTTTT = 181 reads: +382 validated
umi GTTTCGCACT = 324 reads: +382 validated
umi TAAAAGCCGT = 285 reads: +382 validated
umi TACGGTTTCC = 288 reads: +382 validated
umi TAGGAGGTGG = 266 reads: +382 validated
umi TAGGCAGTGC = 145 reads: +382 validated
umi TATCCACCGT = 293 reads: +382 validated
umi TATCTCCTCG = 282 reads: +382 validated
umi TATGCCTCGG = 291 reads: +382 validated
umi TCGGAGTCAC = 214 reads: +382 validated
umi TCGTGCAGCT = 164 reads: +382 validated
umi TCGTGCTGAT = 251 reads: +382 validated
umi TCTAACGCAC = 178 reads: +382 validated
umi TCTAACTCCT = 313 reads: +382 validated
umi TCTCATACTC = 294 reads: +382 validated
umi TCTGTTCGGT = 267 reads: +382 validated
umi TCTTAGGATG = 330 reads: +382 validated
umi TGATCGATAG = 242 reads: +382 validated
umi TGCTGATAAG = 193 reads: +382 validated
umi TGGTCTGAAT = 297 reads: +382 validated
umi TTAGGGGGAT = 194 reads: +382 validated
umi TTCAATTACC = 290 reads: +382 validated
umi TTCACGTCCG = 174 reads: +382 validated
umi TTTCCACGGA = 328 reads: +382 validated

UMI info for barcode CTCGTACCAGCGATCC-1 contig 2 = AGCTCTGGGA...
umi CAAGGCGGAC = 149 reads: +385 -18 +30 non-validated
umi GAGTGCTCAC = 69 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=565]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 74 umis using 3150 reads
cdr3 = CQQRSNWPFTF at 368, score = 9 + 8
umis assigned: [5, 10, 26, 34, 45, 58, 59, 74, 76, 90] and 64 others
of which 74 are surviving nonsolos
reads assigned: 19434
start codons at 47, 252, 255, 471
confident = true

TIG 2[bases=538]
0-80 ==> 40-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=0)
80-433 ==> 0-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=7)
469-513 ==> 19-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
513-538 ==> 0-25 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 7 reads
cdr3 = CARDQGAGFLEWLSPPMDVW at 422, score = 9 + 7
umis assigned: [242, 472]
of which 2 are surviving nonsolos
reads assigned: 217
start codons at 80, 236, 383, 470, 531
confident = true

REJECT CONTIGS

TIG 1[bases=555]
5-80 ==> 5665-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
29-382 ==> 0-353 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=3)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [42, 65, 86, 87, 154, 181, 205, 208, 268, 296] and 19 others
of which 29 are surviving nonsolos
reads assigned: 7352
start codons at 29, 35, 91, 104, 167, 240, 461
confident = false
did not find CDR3
now this is a cell
paired!

GTGTATTACTGTGCGAGAGATCAGGGTGCTGGATTTTTGGAGTGGTTATCTCCGCCTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCCTTTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.235 = CTCGTACCAGCTTAAC-1

using 13056 reads

====================================================================================

graph has 5109 edges initially, 78 edges after simplification

total ucounts = 816
nonsolo ucounts = 409[2^158, 3^84, 4^52, 5^30, 6^10, 7^11, 8^4, 9^3, 10^2, 13^3, 16, 17, 26, 38, 41, 73, 85, 113, 131, 137, 146^2, 150, 157, 171, 174, 198, 215, 217, 221, 224, 226, 230^2, 231, 236, 257, 260, 266, 274^2, 277, 278^2, 279^2, 280, 282, 285, 288, 291^2, 294, 296^2, 298, 316, 324, 325, 326^2, 378]
surviving nonsolo ucounts = 46[41, 85, 113, 131, 137, 146^2, 150, 157, 171, 174, 198, 215, 217, 221, 224, 226, 230^2, 231, 236, 257, 260, 266, 274^2, 277, 278^2, 279^2, 280, 282, 285, 288, 291^2, 294, 296^2, 298, 316, 324, 325, 326^2]
ids = [253, 158, 461, 698, 167, 231, 430, 685, 190, 594, ...]

====================================================================================

UMI info for barcode CTCGTACCAGCTTAAC-1 contig 1 = AGGAGTCAGA...
umi AACGCGTGCG = 222 reads: +388 validated
umi ACGCGACTGT = 231 reads: +388 validated
umi AGTCGAACCC = 270 reads: +388 validated
umi ATATTACATA = 295 reads: +388 validated
umi ATATTTTCGG = 138 reads: +2 -1XX +385 invalidated
umi ATCACTCGAA = 326 reads: +388 validated
umi ATGTTTGTAA = 289 reads: +388 validated
umi CCTGTGCACA = 299 reads: +388 validated
umi CGCGATCCAC = 233 reads: +388 validated
umi CGGGTACATG = 262 reads: +388 validated
umi CGTATGCCTA = 278 reads: +388 validated
umi CGTTTACCCT = 295 reads: +388 validated
umi CTAATTGGCA = 279 reads: +388 validated
umi CTCCAATGCA = 228 reads: +388 validated
umi GAGAGTCTCG = 146 reads: +388 validated
umi GATGTATGAC = 320 reads: +388 validated
umi GCCTCTGACC = 114 reads: +388 validated
umi GCGCATTCCC = 279 reads: +388 validated
umi GGACTCTCTA = 226 reads: +388 validated
umi GGGATTGGCT = 330 reads: +388 validated
umi GGGGTCGCAT = 233 reads: +388 validated
umi GTGATGTCTG = 199 reads: +388 validated
umi TAATCACCGG = 265 reads: +388 validated
umi TATAGGAGCC = 218 reads: +388 validated
umi TCGACTGCCT = 299 reads: +388 validated
umi TGATATCGGG = 127 reads: +388 validated
umi TGTGCCAAGG = 292 reads: +388 validated
umi TGTTTCATCG = 264 reads: +388 validated

UMI info for barcode CTCGTACCAGCTTAAC-1 contig 2 = GAGCTCTGGG...
umi ATAATCACCT = 80 reads: +387 -2 +2 -2 +1 -2 +3 -22 non-validated
umi CAGTAAGTTG = 41 reads: +382 -1 +1 -37 non-validated
umi TCTTACGATA = 147 reads: +421 validated

UMI info for barcode CTCGTACCAGCTTAAC-1 contig 3 = AGGAGTCAGA...
umi AGTGGGCCTC = 280 reads: +382 validated
umi CAAGTAGGGT = 147 reads: +382 validated
umi CACAGTCTAT = 275 reads: +382 validated
umi CATGAGGATC = 324 reads: +382 validated
umi CCTCTATGTG = 175 reads: +382 validated
umi CGAAAACGGC = 288 reads: +382 validated
umi CTTCGTCGAC = 279 reads: +382 validated
umi TACTCTGTGA = 173 reads: +382 validated
umi TAGGTCTTTG = 324 reads: +382 validated
umi TAGTACCGGA = 277 reads: +382 validated
umi TCGTAGAACA = 235 reads: +382 validated
umi TGTATAGGCT = 272 reads: +382 validated
umi TGTTTGACGA = 298 reads: +382 validated
umi TTCGAGGCCT = 3 reads: -382 non-validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |260|IGKV1D-8|5'UTR| [len=181] (mis=0)
27-380 ==> 0-353 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=3)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 28 umis using 1112 reads
cdr3 = CQQYYSFRATF at 354, score = 9 + 8
umis assigned: [20, 83, 140, 163, 167, 172, 198, 302, 317, 328] and 18 others
of which 28 are surviving nonsolos
reads assigned: 6833
start codons at 27, 33, 89, 102, 165, 238, 457
confident = true

TIG 2[bases=525]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=6)
451-501 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
501-525 ==> 0-24 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CAKSGGTYDLDAFDIW at 422, score = 9 + 8
umis assigned: [158, 253, 685]
of which 3 are surviving nonsolos
reads assigned: 264
start codons at 80, 231, 236, 294, 297, 315, 383, 444, 453, 482
confident = true

TIG 3[bases=551]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=0)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 13 umis using 567 reads
cdr3 = CQQYYSYPFTF at 354, score = 9 + 8
umis assigned: [143, 231, 236, 262, 300, 305, 403, 594, 609, 612] and 4 others
of which 13 are surviving nonsolos
reads assigned: 3312
start codons at 33, 89, 102, 238, 457
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.239 = CTCGTACCAGTATGCT-1

using 12918 reads

====================================================================================

graph has 6614 edges initially, 102 edges after simplification

total ucounts = 1198
nonsolo ucounts = 627[2^251, 3^146, 4^73, 5^40, 6^25, 7^19, 8^8, 9^4, 10, 11^2, 14, 35, 48, 51^2, 53, 62, 65, 73, 87, 91, 97, 102, 103, 110, 119, 120, 122, 123, 126, 132, 135, 136, 147, 168^2, 172, 173, 179, 183, 185, 190, 191, 194, 195, 196, 207, 227, 230, 236, 246, 250, 262, 264, 265, 276, 278, 281, 289, 291^2, 298^2, 300, 303, 310, 335, 367]
surviving nonsolo ucounts = 54[51, 53, 62, 65, 73, 87, 91, 97, 102, 103, 110, 119, 120, 122, 123, 126, 132, 135, 136, 147, 168^2, 172, 173, 179, 183, 185, 190, 191, 194, 195, 196, 207, 227, 230, 236, 246, 250, 262, 264, 265, 276, 278, 281, 289, 291^2, 298^2, 300, 303, 310, 335, 367]
ids = [717, 199, 869, 322, 716, 226, 462, 92, 386, 888, ...]

====================================================================================

UMI info for barcode CTCGTACCAGTATGCT-1 contig 1 = AGGAGTCAGA...
umi CGTAAGAGTT = 86 reads: +382 validated
umi CTCTGGCGAC = 266 reads: +382 validated
umi GACTCACCTC = 251 reads: +382 validated
umi GCCCTTTGTT = 340 reads: +382 validated
umi GGAGGTCCTA = 184 reads: +382 validated
umi TCAACCTATA = 244 reads: +382 validated
umi TCCAGATCGT = 364 reads: +382 validated
umi TGATTATGCC = 286 reads: +382 validated
umi TGTTCCGTAC = 302 reads: +382 validated
umi TTTAAGTCGG = 308 reads: +382 validated

UMI info for barcode CTCGTACCAGTATGCT-1 contig 2 = GGGAGAGGAG...
umi AAAAGGTCTA = 290 reads: +418 validated
umi AAAGTTGTAG = 172 reads: +385 -33 non-validated
umi AACCTACTCG = 149 reads: +418 validated
umi AATAGGTTCC = 197 reads: +26 -1X +1 -1X +1 -1XX +385 -2 invalidated
umi AATCATGTCC = 200 reads: +418 validated
umi ACAAATTGTG = 184 reads: +377 -1 +4 -1 +1 -2X +3 -29 invalidated
umi ACCACTCGAT = 95 reads: +350 -1 +14 -53 non-validated
umi ATCAGTCTGC = 52 reads: +324 -14 +56 -24 non-validated
umi ATCTGTGTTT = 235 reads: +418 validated
umi ATGACCTTTA = 86 reads: +404 -14 non-validated
umi CACCTTCTTG = 191 reads: +418 validated
umi CCACCGTCAG = 125 reads: +404 -1 +1 -1 +11 non-validated
umi CCCAACCCGT = 125 reads: +381 -37 non-validated
umi CCGTAGTCCA = 230 reads: +418 validated
umi CTCGTAGGGT = 175 reads: +418 validated
umi GAAATAGGCC = 180 reads: +403 -15 non-validated
umi GAGATAAGTC = 208 reads: +418 validated
umi GGAACCATCG = 279 reads: +418 validated
umi GGGAAATATC = 243 reads: +418 validated
umi GGGGTTGGCC = 267 reads: +418 validated
umi GGGTCTACCT = 72 reads: +268 -7 +5 -1 +134 -1 +2 non-validated
umi GGGTGACGAT = 51 reads: +418 validated
umi GTAAAATCGG = 128 reads: +418 validated
umi TATTACCATT = 65 reads: +198 -1XX +45 -1 +156 -1 +1 -1 +14 invalidated
umi TCAACTATTC = 102 reads: +403 -1 +1 -13 non-validated
umi TCACAGGTCC = 175 reads: +418 validated
umi TCCGCACCGA = 228 reads: +418 validated
umi TCGAGACACC = 292 reads: +418 validated
umi TTCATATGTG = 139 reads: +386 -32 non-validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=1)
383-415 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 435 reads
cdr3 = CQQYYSYPLTF at 354, score = 9 + 9
umis assigned: [462, 525, 599, 647, 688, 887, 927, 1023, 1074, 1155]
of which 10 are surviving nonsolos
reads assigned: 2585
start codons at 27, 33, 89, 102, 238, 457
confident = true

TIG 2[bases=562]
0-73 ==> 148-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=0)
73-423 ==> 0-350 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=4)
443-491 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
491-562 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 19 umis using 262 reads
cdr3 = CARSDRVAPEGYFDYW at 412, score = 9 + 7
umis assigned: [3, 16, 26, 44, 48, 63, 92, 199, 222, 226] and 19 others
of which 29 are surviving nonsolos
reads assigned: 4827
start codons at 73, 229, 373
confident = true

REJECT CONTIGS

TIG 1[bases=549]
3-75 ==> 5665-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
27-380 ==> 0-353 on |251|IGKV1D-37|L-REGION+V-REGION| [len=353] (mis=1)
375-413 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [17, 341, 682, 785, 1069]
of which 5 are surviving nonsolos
reads assigned: 1284
start codons at 27, 33, 89, 337, 370, 455
confident = false
did not find CDR3

TIG 2[bases=576]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
16-106 ==> 5828-5918 on rc of segment after IGHV5-78 exon 1 [len=6000] (mis=10)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=1)
431-447 ==> 0-16 on |25|IGHD4-17|D-REGION| [len=16] (mis=0)
457-505 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
505-576 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [358, 376, 386, 540, 724, 997, 1060, 1062]
of which 8 are surviving nonsolos
reads assigned: 1045
start codons at 59, 233, 257, 392, 430
confident = false
frameshifted full length stopped transcript of length 576
did not find CDR3
now this is a cell
paired!

GAGGACACGGCCGTGTATTACTGTGCGAGATCCGATCGAGTTGCGCCTGAAGGGTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCTGCCTGCAGTCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTTACCCTCTAACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.241 = CTCGTACCATAAAGGT-1

using 257 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^3, 3, 10, 235]
surviving nonsolo ucounts = 1[235]
ids = [8]

====================================================================================

UMI info for barcode CTCGTACCATAAAGGT-1 contig 1 = GCTTCAGCTG...
umi TAGGTGCTCA = 235 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=553]
0-46 ==> 5-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
46-402 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
402-440 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
440-553 ==> 0-113 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 35 reads
cdr3 = CQSYDSSLSGLYVF at 370, score = 7 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 46, 200, 203, 254, 353, 380, 404
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.242 = CTCGTACCATAGTAAG-1

using 83 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 3[2, 4, 67]
surviving nonsolo ucounts = 1[67]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.244 = CTCGTACCATATGGTC-1

using 753 reads

====================================================================================

graph has 312 edges initially, 6 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 3, 176, 238, 328]
surviving nonsolo ucounts = 3[176, 238, 328]
ids = [10, 4, 6]

====================================================================================

UMI info for barcode CTCGTACCATATGGTC-1 contig 1 = AGGAATCAGT...
umi GATCAACCAT = 335 reads: +388 validated

UMI info for barcode CTCGTACCATATGGTC-1 contig 2 = AGTGACTCCT...
umi TTGACTCTCC = 171 reads: +433 validated

UMI info for barcode CTCGTACCATATGGTC-1 contig 3 = GTGCTTTCTG...
umi CTTCCAGTGC = 203 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 326
start codons at 27, 33, 102, 238, 457
confident = false

TIG 2[bases=520]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
403-453 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
453-520 ==> 0-67 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 365, score = 8 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 20, 64, 243, 246, 249, 335, 405
confident = false

TIG 3[bases=499]
16-387 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
419-467 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
467-499 ==> 0-32 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CARGSGILVIAIEDYYFDHW at 376, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 16, 37, 81, 167, 254
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.246 = CTCGTACCATCGACGC-1

using 146 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 6, 135]
surviving nonsolo ucounts = 1[135]
ids = [4]

====================================================================================

UMI info for barcode CTCGTACCATCGACGC-1 contig 1 = ATCTCCTCCA...
umi TTTCGCTTCG = 136 reads: +380 -1 +1 non-validated

GOOD CONTIGS

TIG 1[bases=600]
0-134 ==> 117-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
134-485 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=9)
478-516 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
516-600 ==> 0-84 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CQVWDSSSDHWVF at 449, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 135
start codons at 41, 134, 195, 336, 432
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.252 = CTCGTACGTAACGTTC-1

using 379 reads

====================================================================================

graph has 144 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[3, 9, 176, 190]
surviving nonsolo ucounts = 2[176, 190]
ids = [3, 1]

====================================================================================

UMI info for barcode CTCGTACGTAACGTTC-1 contig 1 = AGCTCTCAGA...
umi GTATTGTTGG = 165 reads: +421 validated

UMI info for barcode CTCGTACGTAACGTTC-1 contig 2 = GCTGGGGTCT...
umi AGGATCGTCT = 181 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=598]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=15)
452-500 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
500-598 ==> 0-98 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARASQLMYLGAFDFW at 421, score = 9 + 6
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 79, 139, 230, 235, 282, 382, 442, 554
confident = false

TIG 2[bases=573]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-381 ==> 0-340 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=2)
385-423 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
423-573 ==> 0-150 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CSSYADSLIF at 365, score = 8 + 10
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 180
start codons at 41, 198, 242, 249, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.257 = CTCGTACGTACTTCTT-1

using 297 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 9[2, 3^2, 4, 5, 8, 9, 14, 246]
surviving nonsolo ucounts = 1[246]
ids = [11]

====================================================================================

UMI info for barcode CTCGTACGTACTTCTT-1 contig 1 = GCTCTGCTTC...
umi TTGCGAGTTC = 235 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=608]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-399 ==> 0-348 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=0)
401-439 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
439-608 ==> 0-169 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQSYDSSLWRVF at 375, score = 8 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.261 = CTCGTACGTAGGACAC-1

using 61 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 57]
surviving nonsolo ucounts = 1[57]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.262 = CTCGTACGTATCAGTC-1

using 375 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 100
nonsolo ucounts = 72[2^9, 3^17, 4^11, 5^8, 6^12, 7^7, 8^5, 9, 10, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.264 = CTCGTACGTCAGATAA-1

using 3672 reads

====================================================================================

graph has 3048 edges initially, 48 edges after simplification

total ucounts = 853
nonsolo ucounts = 387[2^166, 3^88, 4^51, 5^33, 6^11, 7^9, 8^8, 9^3, 10, 12^2, 14, 19, 62, 63, 65, 73, 74, 93, 107, 171, 185, 199, 213, 322, 327]
surviving nonsolo ucounts = 15[10, 19, 62, 63, 65, 73, 74, 93, 107, 171, 185, 199, 213, 322, 327]
ids = [58, 584, 713, 632, 750, 559, 449, 690, 46, 28, ...]

====================================================================================

UMI info for barcode CTCGTACGTCAGATAA-1 contig 1 = TGGGGGATCA...
umi AACTCCCACG = 172 reads: +397 validated
umi ACTTTGCCTT = 326 reads: +397 validated
umi AGATGGGGTT = 200 reads: +397 validated
umi GACGCACCAG = 330 reads: +397 validated
umi GACTTGTCGG = 70 reads: -394 +3 non-validated
umi GTCGTATATG = 74 reads: +397 validated
umi GTCTTACCAT = 183 reads: +397 validated
umi GTTTGACCAG = 19 reads: +6 -12 +62 -1 +26 -3 +284 -1 +2 non-validated
umi TCGTAACCAT = 214 reads: +397 validated
umi TCTCGCCTTC = 63 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=568]
35-395 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=9)
395-432 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 8 umis using 214 reads
cdr3 = CMQGTHWPLTF at 371, score = 9 + 9
umis assigned: [28, 105, 110, 443, 449, 559, 562, 584, 700, 713]
of which 10 are surviving nonsolos
reads assigned: 1623
start codons at 35, 68, 96, 104, 192, 354, 374, 474
confident = true

REJECT CONTIGS

TIG 1[bases=488]
0-79 ==> 0-79 on |156|IGHV3-7|5'UTR| [len=79] (mis=0)
0-79 ==> 5921-6000 on rc of segment after IGHV3-7 exon 1 [len=6000] (mis=0)
47-118 ==> 6506-6577 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=6)
79-411 ==> 0-332 on |157|IGHV3-7|L-REGION+V-REGION| [len=351] (mis=29)
449-488 ==> 10-49 on |50|IGHJ2|J-REGION| [len=52] (mis=1)
cdr3 = CWRYSSSSSIDLW at 421, score = 9 + 7
umis assigned: [46, 58, 632, 690]
of which 4 are surviving nonsolos
reads assigned: 229
start codons at 79, 235, 296, 382
confident = false
VJ delta = 10
not full
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.267 = CTCGTACGTCGGGTCT-1

using 161 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[161]
surviving nonsolo ucounts = 1[161]
ids = [0]

====================================================================================

UMI info for barcode CTCGTACGTCGGGTCT-1 contig 1 = GCTGTGCTGT...
umi ATAGATGAAC = 159 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=564]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=1)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
425-564 ==> 0-139 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CQSADSSGTYVVF at 358, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 155
start codons at 43, 104, 173, 191, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.271 = CTCGTACGTCTCCCTA-1

using 59 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 50]
surviving nonsolo ucounts = 1[50]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.275 = CTCGTACGTCTTCTCG-1

using 294 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[291]
surviving nonsolo ucounts = 1[291]
ids = [1]

====================================================================================

UMI info for barcode CTCGTACGTCTTCTCG-1 contig 1 = GGAGTCAGTC...
umi AGCATACAGC = 296 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=10)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQSYTTLLTF at 353, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.284 = CTCGTACGTTCCCTTG-1

using 315 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[314]
surviving nonsolo ucounts = 1[314]
ids = [1]

====================================================================================

UMI info for barcode CTCGTACGTTCCCTTG-1 contig 1 = GCTACAACAG...
umi ATTGTGTTTT = 310 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=564]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
389-428 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYYGSPRTF at 367, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 25, 28, 83, 97, 350, 380, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.291 = CTCGTACGTTTGACTG-1

using 18 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.296 = CTCGTACTCAATAAGG-1

using 403 reads

====================================================================================

graph has 150 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 161, 235]
surviving nonsolo ucounts = 2[161, 235]
ids = [7, 6]

====================================================================================

UMI info for barcode CTCGTACTCAATAAGG-1 contig 1 = TGAGCGCAGA...
umi TTGGTATCCA = 157 reads: +388 validated

UMI info for barcode CTCGTACTCAATAAGG-1 contig 2 = GTCAGTCTCA...
umi TGTGTTTATC = 217 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=528]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=13)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-528 ==> 0-104 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CGAWDTSLSAWVF at 357, score = 7 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 153
start codons at 36, 190, 241, 365
confident = false

TIG 2[bases=497]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
411-497 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQSYTTPWTF at 350, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.299 = CTCGTACTCACATGCA-1

using 289 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[2, 279]
surviving nonsolo ucounts = 1[279]
ids = [3]

====================================================================================

UMI info for barcode CTCGTACTCACATGCA-1 contig 1 = GTCAGTCTCA...
umi ACTTTCTTAC = 263 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-490 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQSYSTPLTF at 350, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.309 = CTCGTACTCATACGGT-1

using 12 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.314 = CTCGTACTCCGAAGAG-1

using 213 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 3, 203]
surviving nonsolo ucounts = 1[203]
ids = [6]

====================================================================================

UMI info for barcode CTCGTACTCCGAAGAG-1 contig 1 = ATCACATAAC...
umi TTGCGTTACA = 197 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=566]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=9)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
479-566 ==> 0-87 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 30 reads
cdr3 = CARSGVMIAIQRFDYW at 400, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 58, 209, 256, 355, 418
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.316 = CTCGTACTCCTAGTGA-1

using 425 reads

====================================================================================

graph has 136 edges initially, 10 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 3, 183, 230]
surviving nonsolo ucounts = 2[183, 230]
ids = [2, 5]

====================================================================================

UMI info for barcode CTCGTACTCCTAGTGA-1 contig 1 = GGGGGCGCCA...
umi CATTTTCACA = 18 reads: -322X +1 -3XX +1 -1XX +1 -3XX +1 -1XX +1 -2XX +1 -6XX +1 -2XX +1 -2XX +35 invalidated
umi CCTTCTTCCT = 215 reads: +370 -1XX +14 invalidated

GOOD CONTIGS

TIG 1[bases=470]
0-34 ==> 0-34 on |385|IGLV7-43|5'UTR| [len=34] (mis=3)
34-385 ==> 0-351 on |386|IGLV7-43|L-REGION+V-REGION| [len=351] (mis=3)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
419-470 ==> 0-51 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 0 umis using 0 reads
cdr3 = CLLYYGGALVF at 358, score = 8 + 9
umis assigned: [2, 5]
of which 2 are surviving nonsolos
reads assigned: 225
start codons at 34, 371
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.319 = CTCGTACTCGAATGGG-1

using 206 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[7, 196]
surviving nonsolo ucounts = 1[196]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.326 = CTCGTACTCGGTGTCG-1

using 15443 reads

====================================================================================

graph has 7306 edges initially, 118 edges after simplification

total ucounts = 1451
nonsolo ucounts = 706[2^268, 3^141, 4^97, 5^50, 6^34, 7^17, 8^12, 9^8, 10^3, 11^4, 12^2, 13^2, 14, 15^3, 16^2, 17, 18^3, 42, 47, 50, 80, 83, 98, 102, 113, 116, 122, 126, 129, 130, 140, 145, 150, 153, 154, 171, 173, 177, 181, 185, 192, 195, 198^2, 218, 223, 226^2, 230, 231, 236, 238, 240, 249, 251, 256, 257, 268, 269, 278, 283, 290^2, 293, 297, 302, 306, 315, 322, 330, 342, 344, 347, 353, 364]
surviving nonsolo ucounts = 56[18, 42, 47, 80, 98, 102, 113, 116, 122, 126, 129, 130, 140, 145, 150, 153, 154, 173, 177, 181, 185, 192, 195, 198^2, 218, 223, 226^2, 230, 231, 236, 238, 240, 249, 251, 256, 257, 268, 269, 278, 283, 290^2, 293, 297, 302, 306, 315, 322, 330, 342, 344, 347, 353, 364]
ids = [281, 385, 5, 1187, 1054, 1383, 1260, 1340, 430, 7, ...]

====================================================================================

UMI info for barcode CTCGTACTCGGTGTCG-1 contig 1 = AGACCCAGTC...
umi AAACCACTTA = 125 reads: +388 validated
umi AACCCATGAG = 271 reads: +388 validated
umi AATCCTTATG = 246 reads: +388 validated
umi ACAGGATCGC = 294 reads: +388 validated
umi ACATAAGGGC = 307 reads: +388 validated
umi ACGAATGCCG = 322 reads: +388 validated
umi ACTAACGGCC = 347 reads: +388 validated
umi AGAGCATCCC = 371 reads: +388 validated
umi AGTATACCCG = 339 reads: +388 validated
umi CAACTGAGCC = 225 reads: +388 validated
umi CACGATTCGT = 119 reads: +388 validated
umi CACTGCTGGG = 215 reads: +388 validated
umi CATAGGTTTC = 191 reads: +388 validated
umi CGAGCTATCG = 225 reads: +388 validated
umi CGCACTACTG = 250 reads: +388 validated
umi CGGGGCGCGG = 253 reads: +388 validated
umi CGTATTGGCT = 349 reads: +388 validated
umi CTACACAGTG = 227 reads: +388 validated
umi CTTTCTTACT = 223 reads: +388 validated
umi GAACGCCTAG = 196 reads: +388 validated
umi GATGTGCTTC = 352 reads: +388 validated
umi GCACCACGGC = 278 reads: +388 validated
umi GCACCTCGTC = 291 reads: +388 validated
umi GGCCAGGCAC = 245 reads: +388 validated
umi GGTGGCGGTG = 315 reads: +388 validated
umi GTCAATCTTC = 294 reads: +388 validated
umi GTCACTGTTG = 176 reads: +388 validated
umi TATACATTCA = 291 reads: +388 validated
umi TCAGTTTGGA = 268 reads: +388 validated
umi TCTTGCTTTC = 255 reads: +388 validated
umi TGATCAGGTG = 197 reads: +388 validated
umi TGCATGTTTA = 110 reads: +388 validated
umi TGCCCTTTAC = 178 reads: +388 validated
umi TGGAGGGCGC = 152 reads: +388 validated
umi TTCGCTCCTT = 197 reads: +388 validated

UMI info for barcode CTCGTACTCGGTGTCG-1 contig 2 = AGCTCTCAGA...
umi AAACATGCGC = 24 reads: -26 +3 -1XX +6 -1XX +5 -2XX +13 -1XX +1 -2XX +26 -1XX +2 -1XX +1 -1XX +8 -2XX +20 -1XX +19 -2XX +3 -2XX +4 -2XX +3 -1XX +1 -1XX +20 -1XX +11 -1XX +4 -3XX +1 -3XX +1 -1XX +1 -200XX invalidated
umi AACTGATATT = 220 reads: +369 -23 +17 non-validated
umi AAGCTACTGC = 149 reads: +383 -1 +8 -1 +16 non-validated
umi AGTCTCAGCG = 19 reads: +63 -1X +146 -70X +1 -1 +2 -1 +5 -1X +56 -62 invalidated
umi ATTTGGGGGT = 42 reads: +264 -21 +9 -1 +1 -1 +10 -1 +11 -1 +20 -1 +5 -2 +2 -1 +2 -1 +1 -1 +2 -1 +50 non-validated
umi CGGTACCGCC = 184 reads: +409 validated
umi TCGCCTTCTC = 47 reads: +6 -1XX +1 -1XX +6 -1XX +13 -1XX +6 -1XX +5 -2XX +13 -1XX +1 -2XX +26 -1XX +2 -1XX +1 -1XX +8 -2XX +20 -1XX +19 -2XX +3 -2XX +4 -2XX +3 -1XX +1 -1XX +20 -1XX +11 -1XX +4 -3XX +1 -3XX +1 -1XX +1 -2X +1 -1X +2 -164 +3 -1X +3 -1X +7 -1 +14 invalidated
umi TTACGAGTGT = 239 reads: +409 validated
umi TTCAGCAGGC = 131 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 27-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
20-371 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=12)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 35 umis using 1383 reads
cdr3 = CQQGNSFPFTF at 347, score = 9 + 8
umis assigned: [7, 42, 92, 119, 125, 160, 183, 210, 271, 400] and 25 others
of which 35 are surviving nonsolos
reads assigned: 8571
start codons at 20, 26, 82, 95, 116, 231, 450
confident = true

TIG 2[bases=559]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=17)
456-488 ==> 20-52 on |49|IGHJ1|J-REGION| [len=52] (mis=0)
488-559 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 50 reads
cdr3 = CARGGYSFDSLS at 421, score = 8 + 6
umis assigned: [5, 56, 64, 281, 385, 604, 1187, 1333, 1361]
of which 9 are surviving nonsolos
reads assigned: 1039
start codons at 79, 139, 230, 235, 273, 307, 382
confident = true

REJECT CONTIGS

TIG 1[bases=947]
0-90 ==> 3254-3344 on rc of segment before IGKV2-24 exon 2 [len=3774] (mis=6)
0-90 ==> 3251-3341 on segment before IGKV2D-23 exon 1 [len=3772] (mis=6)
30-78 ==> 0-48 on |271|IGKV2D-26|L-REGION+V-REGION| [len=360] (mis=0)
79-240 ==> 0-161 on rc of segment before IGKV2-26 exon 1 [len=391] (mis=1)
238-372 ==> 167-301 on rc of segment before IGKV2-26 exon 1 [len=391] (mis=3)
367-461 ==> 297-391 on rc of segment before IGKV2-26 exon 1 [len=391] (mis=5)
460-621 ==> 48-209 on |271|IGKV2D-26|L-REGION+V-REGION| [len=360] (mis=4) [SHIFT!]
622-707 ==> 209-294 on |271|IGKV2D-26|L-REGION+V-REGION| [len=360] (mis=5) [SHIFT!]
707-772 ==> 295-360 on |271|IGKV2D-26|L-REGION+V-REGION| [len=360] (mis=1) [SHIFT!]
774-811 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
811-947 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [52, 530, 544, 676, 933, 1054, 1134, 1194, 1340, 1373] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2047
start codons at 30, 63, 95, 108, 148, 168, 177, 200, 207, 341, 393, 403, 410, 417, 481, 532, 569, 633, 731, 751, 758, 853
confident = false
did not find CDR3
now this is a cell
paired!

AGCCTGAGAGTCGAGGACACGGCTCTTTATTACTGTGCGAGAGGGGGATACAGTTTCGACTCTCTTTCGGGCCAGGGCACCCTGGTCACCGTCTCCTCAG <==> ATCATCAGCCTGCAGCCTGAAGATTTTGCAACTTACTATTGTCAACAGGGTAACAGTTTTCCCTTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.335 = CTCGTACTCTTGCAAG-1

using 309 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[3, 4, 5, 291]
surviving nonsolo ucounts = 1[291]
ids = [2]

====================================================================================

UMI info for barcode CTCGTACTCTTGCAAG-1 contig 1 = AGTCCCACTC...
umi ATCCCCTCAG = 264 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=471]
0-20 ==> 7-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
408-471 ==> 0-63 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CLQYSSSPWTF at 347, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 20, 26, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.337 = CTCGTACTCTTTACAC-1

using 292 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^3, 282]
surviving nonsolo ucounts = 1[282]
ids = [5]

====================================================================================

UMI info for barcode CTCGTACTCTTTACAC-1 contig 1 = AACAACCACA...
umi CTGTTTACAT = 284 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=555]
0-51 ==> 10-61 on |84|IGHV1-69|5'UTR| [len=61] (mis=0)
51-404 ==> 0-353 on |85|IGHV1-69|L-REGION+V-REGION| [len=353] (mis=3)
408-432 ==> 7-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=2)
435-484 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
484-555 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CASLGCSGGSCYPTYGMDVW at 393, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 51, 202, 249, 348, 441
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.344 = CTCGTCAAGACGCACA-1

using 834 reads

====================================================================================

graph has 1306 edges initially, 4 edges after simplification

total ucounts = 404
nonsolo ucounts = 179[2^94, 3^38, 4^14, 5^11, 6^5, 7^4, 8^5, 9^2, 10, 11^2, 12, 14, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.354 = CTCGTCAAGCGCCTCA-1

using 4495 reads

====================================================================================

graph has 2377 edges initially, 30 edges after simplification

total ucounts = 473
nonsolo ucounts = 217[2^83, 3^39, 4^27, 5^15, 6^9, 7^7, 8^7, 9^4, 10^3, 16^2, 18, 26, 68, 73, 88, 105, 111, 114, 130, 142, 145, 146, 148, 162, 183, 195, 242, 290, 303, 403, 424]
surviving nonsolo ucounts = 17[68, 73, 105, 111, 130, 142, 145, 146, 148, 162, 183, 195, 242, 290, 303, 403, 424]
ids = [239, 135, 168, 422, 341, 431, 260, 456, 386, 36, ...]

====================================================================================

UMI info for barcode CTCGTCAAGCGCCTCA-1 contig 1 = AGGAATCAGT...
umi TGCTCCTTCA = 185 reads: +388 validated

UMI info for barcode CTCGTCAAGCGCCTCA-1 contig 2 = ACAACAGGCA...
umi TGGTCGGAAC = 114 reads: +8 -1 +2 -1 +388 non-validated
umi TTGGCAACGA = 146 reads: +400 validated

UMI info for barcode CTCGTCAAGCGCCTCA-1 contig 3 = AGCTCTGGGA...
umi ACATATGTCA = 165 reads: +398 -5 +15 non-validated
umi CATTCGGTCA = 72 reads: +388 -1 +4 -1 +24 non-validated
umi CCTGCGGCAA = 105 reads: +418 validated
umi GCCAGAGGAT = 155 reads: +143 -1X +274 invalidated
umi TACGATACAT = 127 reads: +418 validated
umi TATGCATTAC = 199 reads: +418 validated
umi TCGGTTTCGG = 148 reads: +418 validated
umi TGTTTCCATA = 140 reads: +417 -1 non-validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [412]
of which 1 are surviving nonsolos
reads assigned: 182
start codons at 27, 33, 102, 238, 457
confident = true

TIG 2[bases=561]
0-25 ==> 150-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
25-388 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=11)
387-425 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 35 reads
cdr3 = CQQYYSVPITF at 364, score = 9 + 8
umis assigned: [422, 456]
of which 2 are surviving nonsolos
reads assigned: 255
start codons at 25, 94, 347, 467
confident = true

TIG 3[bases=658]
0-80 ==> 0-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=18)
450-498 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
498-658 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 6 umis using 88 reads
cdr3 = CGRKVSQLNFDYW at 428, score = 8 + 7
umis assigned: [36, 135, 168, 260, 341, 351, 386, 431]
of which 8 are surviving nonsolos
reads assigned: 1084
start codons at 80, 231, 236, 303, 360, 389, 552
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.355 = CTCGTCAAGCGTCTAT-1

using 417 reads

====================================================================================

graph has 160 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[3, 4, 82, 93, 234]
surviving nonsolo ucounts = 3[82, 93, 234]
ids = [5, 2, 0]

====================================================================================

UMI info for barcode CTCGTCAAGCGTCTAT-1 contig 1 = CAGGACACAG...
umi ATACGTCCCG = 219 reads: +388 validated

UMI info for barcode CTCGTCAAGCGTCTAT-1 contig 2 = TGGGTAGAGA...
umi CACATATTCC = 89 reads: +388 validated
umi TTAATTAGCA = 79 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=460]
11-362 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=0)
361-399 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
399-460 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQANSFPLTF at 338, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 11, 17, 73, 86, 222, 441
confident = true

TIG 2[bases=452]
0-36 ==> 78-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
36-389 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
424-452 ==> 0-28 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 33 reads
cdr3 = CASWDDSLRGRVF at 357, score = 8 + 8
umis assigned: [2, 5]
of which 2 are surviving nonsolos
reads assigned: 164
start codons at 36, 190, 340, 365, 370
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.370 = CTCGTCAAGTACGACG-1

using 221 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[219]
surviving nonsolo ucounts = 1[219]
ids = [1]

====================================================================================

UMI info for barcode CTCGTCAAGTACGACG-1 contig 1 = AGCTTCAGCT...
umi ATCCACCTGC = 212 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-548 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.379 = CTCGTCACAAACAACA-1

using 300 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[298]
surviving nonsolo ucounts = 1[298]
ids = [0]

====================================================================================

UMI info for barcode CTCGTCACAAACAACA-1 contig 1 = GTCAGTCTCA...
umi ACCTAAACCC = 297 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=15)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQSYSTPLTF at 350, score = 10 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.381 = CTCGTCACAAAGGTGC-1

using 1102 reads

====================================================================================

graph has 1640 edges initially, 16 edges after simplification

total ucounts = 478
nonsolo ucounts = 212[2^91, 3^48, 4^30, 5^8, 6^9, 7^5, 8^4, 9^5, 10^4, 11^2, 12^3, 14, 17, 55]
surviving nonsolo ucounts = 1[55]
ids = [289]

====================================================================================

REJECT CONTIGS

TIG 1[bases=319]
0-315 ==> 22-337 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=8)
umis assigned: [289]
of which 1 are surviving nonsolos
reads assigned: 46
start codons at 47, 183
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.384 = CTCGTCACAACGCACC-1

using 488 reads

====================================================================================

graph has 206 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 3, 191, 286]
surviving nonsolo ucounts = 2[191, 286]
ids = [6, 7]

====================================================================================

UMI info for barcode CTCGTCACAACGCACC-1 contig 1 = GCTGGGGTCT...
umi CTTTAATCCC = 3 reads: -23 +2 -1X +49 -1X +2 -75X +4 -1X +6 -2X +4 -1X +5 -1X +1 -1X +24 -2X +4 -12X +1 -1 +5 -1 +1 -1 +3 -1X +1 -2X +2 -1X +19 -1 +4 -1X +10 -112 invalidated
umi GCCCTTGCCG = 182 reads: +388 validated

UMI info for barcode CTCGTCACAACGCACC-1 contig 2 = GTCAGTCTCA...
umi TGAAGTCCTT = 290 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
429-551 ==> 0-122 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CSSHAGSTRVLF at 365, score = 8 + 8
umis assigned: [5, 6]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 41, 198, 249, 348, 375
confident = false

TIG 2[bases=547]
0-23 ==> 24-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
23-366 ==> 0-343 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=3)
373-411 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQSYMLGFTF at 350, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 23, 29, 85, 98, 234, 365, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.389 = CTCGTCACAAGTTCTG-1

using 4325 reads

====================================================================================

graph has 2798 edges initially, 38 edges after simplification

total ucounts = 568
nonsolo ucounts = 265[2^99, 3^55, 4^40, 5^22, 6^11, 7^11, 8^5, 9^3, 11^3, 12, 13, 28, 58, 99, 127, 149, 187, 201, 208, 259, 267, 282, 303, 349, 604]
surviving nonsolo ucounts = 12[28, 58, 127, 187, 201, 208, 259, 267, 282, 303, 349, 604]
ids = [42, 70, 130, 237, 312, 81, 227, 194, 139, 478, ...]

====================================================================================

UMI info for barcode CTCGTCACAAGTTCTG-1 contig 1 = ATACTTTCTG...
umi ACCCTTTTCC = 27 reads: -388 +1 -1X +2 -1X +2 -2X +13 -1X +4 invalidated
umi CACATTGGGA = 281 reads: +415 validated
umi CATTCGTCGA = 353 reads: +415 validated
umi CCCTAGGCGT = 186 reads: -29X +3 -2XX +1 -6XX +2 -1XX +1 -1XX +369 invalidated

UMI info for barcode CTCGTCACAAGTTCTG-1 contig 2 = GGCTGGGGTC...
umi AGCACTCAGC = 57 reads: +388 validated
umi AGCTGTTTGC = 206 reads: +388 validated
umi CAAGTATTAG = 130 reads: +388 validated
umi CGGATATGGA = 260 reads: +388 validated
umi CGTTACCTAT = 188 reads: +388 validated
umi GCGGCTTATA = 201 reads: +388 validated
umi TGATCCGGTA = 305 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=523]
0-37 ==> 27-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
37-390 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=4)
404-452 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
452-523 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 3 umis using 75 reads
cdr3 = CARDVGPTGDFDYW at 379, score = 9 + 7
umis assigned: [42, 139, 167, 194]
of which 4 are surviving nonsolos
reads assigned: 835
start codons at 16, 37, 81
confident = true

TIG 2[bases=641]
42-387 ==> 0-345 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=6)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
430-641 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 7 umis using 227 reads
cdr3 = CSSYTSSRAYVF at 366, score = 8 + 7
umis assigned: [70, 81, 130, 227, 237, 312, 478]
of which 7 are surviving nonsolos
reads assigned: 1325
start codons at 42, 193, 199, 243, 250, 253, 562
confident = true
now this is a cell
paired!

ACCGCCGCGGACACGGCCGTGTATTACTGTGCGAGAGACGTGGGACCTACTGGGGACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATACACAAGCAGCCGCGCTTACGTCTTCGGAACCGGGACCCAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.393 = CTCGTCACACACCGAC-1

using 94 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 90]
surviving nonsolo ucounts = 1[90]
ids = [2]

====================================================================================

UMI info for barcode CTCGTCACACACCGAC-1 contig 1 = CTGGGCCTCA...
umi GCACACTCTA = 80 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=514]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-383 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=28)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
413-514 ==> 0-101 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CQAWDSSIAFF at 352, score = 6 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 78
start codons at 37, 42, 98, 167, 236, 242, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.396 = CTCGTCACACGACTCG-1

using 1309 reads

====================================================================================

graph has 1600 edges initially, 20 edges after simplification

total ucounts = 520
nonsolo ucounts = 234[2^93, 3^61, 4^30, 5^20, 6^9, 7^8, 8^4, 9^3, 10, 11^2, 17, 18, 198]
surviving nonsolo ucounts = 1[198]
ids = [294]

====================================================================================

UMI info for barcode CTCGTCACACGACTCG-1 contig 1 = GCTCTGCTTC...
umi GCAGACTGTG = 187 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=583]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
423-442 ==> 19-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
442-583 ==> 0-141 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 31 reads
cdr3 = CQSYDSSLSGYVF at 375, score = 8 + 8
umis assigned: [294]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 51, 205, 259, 358, 385, 406, 574
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.397 = CTCGTCACACGCCAGT-1

using 257 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[6, 247]
surviving nonsolo ucounts = 1[247]
ids = [4]

====================================================================================

UMI info for barcode CTCGTCACACGCCAGT-1 contig 1 = AGCTACAACA...
umi TCTTACCACA = 249 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=565]
0-29 ==> 146-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
29-392 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=9)
390-429 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQHYYSIPPTF at 368, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 29, 98, 351, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.401 = CTCGTCACAGACACTT-1

using 265 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[265]
surviving nonsolo ucounts = 1[265]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.405 = CTCGTCACAGCGTCCA-1

using 150 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[148]
surviving nonsolo ucounts = 1[148]
ids = [0]

====================================================================================

UMI info for barcode CTCGTCACAGCGTCCA-1 contig 1 = GGGAGGAGTC...
umi ATATACGCTC = 136 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
30-383 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-490 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQQSYSTPWTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 134
start codons at 30, 36, 92, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.408 = CTCGTCACAGGATCGA-1

using 376 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[376]
surviving nonsolo ucounts = 1[376]
ids = [0]

====================================================================================

UMI info for barcode CTCGTCACAGGATCGA-1 contig 1 = GGAACTGCTC...
umi GGCCAACATA = 356 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=498]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
413-498 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 72 reads
cdr3 = CLQYYNWPRTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 346
start codons at 31, 86, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.412 = CTCGTCACAGGTCTCG-1

using 22 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.424 = CTCGTCACATGCCTTC-1

using 137 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[137]
surviving nonsolo ucounts = 1[137]
ids = [0]

====================================================================================

UMI info for barcode CTCGTCACATGCCTTC-1 contig 1 = GGGGTCTCAG...
umi AGGCCCCAGT = 126 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=525]
0-38 ==> 4-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
38-366 ==> 0-328 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=16)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
426-525 ==> 0-99 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CSSVAGSYSLVF at 362, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 124
start codons at 38, 177, 195, 246, 249, 345
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.425 = CTCGTCACATGGGACA-1

using 253 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 244]
surviving nonsolo ucounts = 1[244]
ids = [1]

====================================================================================

UMI info for barcode CTCGTCACATGGGACA-1 contig 1 = GCTCTGCTTC...
umi AATTTGTTCG = 234 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=596]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-596 ==> 0-151 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.427 = CTCGTCACATGTTGAC-1

using 135 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 131]
surviving nonsolo ucounts = 1[131]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.443 = CTCGTCAGTAGGGTAC-1

using 36 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[36]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.453 = CTCGTCAGTCGTCTTC-1

using 25 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[21]
surviving nonsolo ucounts = 1[21]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.457 = CTCGTCAGTCTCTCGT-1

using 5109 reads

====================================================================================

graph has 5232 edges initially, 94 edges after simplification

total ucounts = 1002
nonsolo ucounts = 743[2^110, 3^106, 4^94, 5^69, 6^65, 7^55, 8^47, 9^42, 10^29, 11^23, 12^26, 13^20, 14^20, 15^13, 16^3, 17^7, 18^5, 19^3, 20^2, 21, 24^2, 49]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.461 = CTCGTCAGTGAAAGAG-1

using 13 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.470 = CTCGTCAGTGTGAATA-1

using 57139 reads

====================================================================================

graph has 15179 edges initially, 146 edges after simplification

total ucounts = 1544
nonsolo ucounts = 863[2^255, 3^127, 4^95, 5^54, 6^30, 7^13, 8^8, 9^6, 10^4, 11^6, 12, 13^2, 14, 15^2, 16, 17^2, 18, 19, 24, 32, 34, 35^2, 36, 41, 44, 46, 52, 54^2, 55, 60^2, 64, 65, 71^2, 72, 73, 78, 81, 84, 93^2, 95, 98, 100, 101, 108, 110, 113, 116, 120, 121, 122^2, 123^2, 128^2, 131^4, 134, 135, 136^2, 137, 138^2, 139, 141, 142, 146, 147^2, 149^2, 151, 152^2, 154, 157^2, 158, 161, 163, 164, 165, 167, 168, 170^2, 171, 172, 174, 176, 178, 179^3, 180, 181, 182, 183^2, 184^2, 185^2, 187^2, 188^4, 191, 192, 193, 194, 195^2, 197^2, 198^3, 200^2, 201, 202^2, 203, 204, 206^2, 207^3, 208^2, 209^2, 211^3, 212, 213^3, 214^2, 215^4, 216^2, 217, 218^3, 220, 221^2, 224^3, 225, 227^3, 228, 230, 231, 232, 233^2, 235, 237^4, 238, 239^2, 240^3, 243^3, 244^4, 245^3, 246, 248^2, 251, 252, 253^2, 254, 256, 257, 258, 259, 261, 262^3, 263^4, 264, 266^2, 269, 271, 277^2, 279, 281, 284^2, 286^2, 287^2, 290^2, 296^2, 297, 299^2, 307, 309, 310, 314, 315, 320, 326, 327, 328, 334, 336, 337, 348, 360, 368^2, 379, 410, 411, 414, 423, 439, 458, 461, 485, 487, 489, 515, 647, 812]
surviving nonsolo ucounts = 238[41, 54, 60, 64, 71^2, 72, 78, 84, 93^2, 95, 98, 100, 101, 108, 110, 113, 116, 120, 121, 122^2, 123^2, 128^2, 131^4, 134, 135, 136^2, 137, 138^2, 139, 141, 142, 146, 147^2, 149^2, 151, 152^2, 154, 157^2, 161, 163, 164, 165, 167, 168, 170^2, 171, 172, 174, 176, 178, 179^3, 180, 181, 182, 183^2, 184^2, 185^2, 187^2, 188^4, 191, 192, 193, 194, 195^2, 197^2, 198^3, 200^2, 201, 202^2, 203, 204, 206^2, 207^3, 208^2, 209^2, 211^3, 212, 213^3, 214^2, 215^4, 216^2, 217, 218^3, 220, 221^2, 224^3, 225, 227^3, 228, 230, 231, 232, 233^2, 235, 237^4, 238, 239^2, 240^3, 243^3, 244^4, 245^3, 246, 248^2, 251, 252, 253^2, 254, 256, 257, 258, 259, 261, 262^3, 263^4, 264, 266^2, 269, 271, 277^2, 279, 281, 284^2, 286^2, 287^2, 290^2, 296^2, 297, 299^2, 307, 309, 310, 314, 315, 320, 326, 327, 328, 334, 336, 337, 348, 360, 368^2, 379, 410, 411, 414, 423, 439, 458, 461, 485, 487, 489, 515, 647, 812]
ids = [612, 725, 1089, 488, 39, 928, 1372, 760, 1055, 801, ...]

====================================================================================

UMI info for barcode CTCGTCAGTGTGAATA-1 contig 1 = TGGGGCTCCA...
umi AAACTTGGGC = 195 reads: +77 -1XX +310 invalidated
umi AAAGCATGTA = 121 reads: +77 -1XX +310 invalidated
umi AAATGTTGGA = 200 reads: +77 -1XX +310 invalidated
umi AAATTCTCTG = 159 reads: +77 -1XX +310 invalidated
umi AACGAACGTC = 172 reads: +388 validated
umi AACGCTTCAG = 74 reads: +77 -1XX +310 invalidated
umi AAGAATCTGT = 241 reads: +388 validated
umi AAGAGACAGA = 221 reads: +77 -1XX +310 invalidated
umi AATACTAGGG = 110 reads: +77 -1XX +310 invalidated
umi AATCTGTGGC = 138 reads: +77 -1XX +310 invalidated
umi AATGATGTCC = 247 reads: +77 -1XX +310 invalidated
umi ACAAGGAGTA = 238 reads: +77 -1XX +310 invalidated
umi ACGAGTTCCA = 237 reads: +77 -1XX +310 invalidated
umi ACGATAGGTC = 254 reads: +77 -1XX +310 invalidated
umi ACTACCGTCC = 130 reads: +77 -1XX +310 invalidated
umi ACTTATCTGT = 189 reads: +77 -1XX +310 invalidated
umi AGAAGGTCCA = 815 reads: -269X +119 invalidated
umi AGATAGGGTG = 213 reads: +388 validated
umi AGCTACGGGA = 208 reads: +77 -1XX +5 -1X +1 -4X +299 invalidated
umi AGCTTAACAT = 191 reads: +77 -1XX +310 invalidated
umi AGTATGGCTC = 182 reads: +388 validated
umi AGTCCTGTGC = 139 reads: +42 -1 +34 -1XX +310 invalidated
umi ATACGGACTA = 271 reads: -14X +63 -1XX +310 invalidated
umi ATAGAGTCCG = 187 reads: +388 validated
umi ATAGCCCTCC = 157 reads: +77 -1XX +310 invalidated
umi ATATAACCTG = 144 reads: +77 -1XX +290 -14 +6 invalidated
umi ATATTATACC = 270 reads: +77 -1XX +310 invalidated
umi ATCCGTCCCC = 11 reads: -388 non-validated
umi ATCGGTTCCA = 158 reads: +77 -1XX +310 invalidated
umi ATCTCAGTGG = 199 reads: +77 -1XX +310 invalidated
umi ATGCTTGGTG = 250 reads: +77 -1XX +310 invalidated
umi ATGTCTCGCT = 435 reads: +77 -1XX +310 invalidated
umi ATTCCAGTAA = 166 reads: +77 -1XX +310 invalidated
umi CAAACGTCAC = 289 reads: +77 -1XX +310 invalidated
umi CAAGTCGCGT = 189 reads: +77 -1XX +310 invalidated
umi CATACGTCCA = 211 reads: +77 -1XX +310 invalidated
umi CATATAAAGG = 231 reads: +77 -1XX +310 invalidated
umi CATATGCACG = 242 reads: +77 -1XX +310 invalidated
umi CATTGGGGCC = 250 reads: +388 validated
umi CCATAACAAC = 206 reads: +77 -1XX +310 invalidated
umi CCATTATCAT = 64 reads: +357 -7 +24 non-validated
umi CCCCTTTTAC = 201 reads: +77 -1XX +310 invalidated
umi CCCGCACAGT = 219 reads: +77 -1XX +310 invalidated
umi CCCTAGCAAA = 251 reads: +77 -1XX +310 invalidated
umi CCGATTCCAG = 208 reads: +77 -1XX +310 invalidated
umi CCGCTGCAAC = 440 reads: -135X +253 invalidated
umi CCGTATATAC = 422 reads: +77 -1XX +310 invalidated
umi CCTCATGCGC = 100 reads: +77 -1XX +310 invalidated
umi CCTCGTATCT = 254 reads: +77 -1XX +310 invalidated
umi CCTTCATCGC = 251 reads: +77 -1XX +310 invalidated
umi CCTTGTCCGA = 250 reads: +77 -1XX +310 invalidated
umi CGACTAGTCC = 236 reads: +388 validated
umi CGACTCTGGT = 504 reads: +77 -1XX +310 invalidated
umi CGCAACTGTC = 488 reads: +77 -1XX +310 invalidated
umi CGGCCACTTC = 234 reads: +77 -1XX +310 invalidated
umi CGTCCAACTT = 141 reads: +77 -1XX +310 invalidated
umi CGTTAGGGGT = 239 reads: +388 validated
umi CTATTACGCG = 102 reads: +388 validated
umi CTATTGCGAA = 1 reads: -388 non-validated
umi CTCACTGCAT = 273 reads: +77 -1XX +310 invalidated
umi CTCCATACTG = 198 reads: +77 -1XX +310 invalidated
umi CTCGAATAGT = 197 reads: +388 validated
umi CTCTGTGACC = 186 reads: +388 validated
umi CTGACGTCAT = 295 reads: +77 -1XX +310 invalidated
umi CTGAGTAATA = 211 reads: +77 -1XX +310 invalidated
umi CTTCGTCTAC = 252 reads: +77 -1XX +310 invalidated
umi CTTCTATCTG = 176 reads: +77 -1XX +310 invalidated
umi CTTGTGAGGG = 138 reads: +77 -1XX +310 invalidated
umi CTTTCTACAA = 245 reads: +77 -1XX +310 invalidated
umi CTTTTGGCAT = 248 reads: +77 -1XX +310 invalidated
umi GAAGGTGTGC = 399 reads: +77 -1XX +310 invalidated
umi GAATCACTTC = 259 reads: +77 -1XX +310 invalidated
umi GAGAGGATCC = 241 reads: +77 -1XX +310 invalidated
umi GCATTTAGGA = 163 reads: +324 -1 +63 non-validated
umi GCCCTAGGTT = 232 reads: +77 -1XX +310 invalidated
umi GCTCTCTTAT = 492 reads: -151X +237 invalidated
umi GCTCTTCGAT = 130 reads: +77 -1XX +310 invalidated
umi GCTTCCGCTT = 179 reads: +77 -1XX +310 invalidated
umi GCTTTTAAGA = 146 reads: +77 -1XX +310 invalidated
umi GGACCGGCGG = 157 reads: +77 -1XX +245 -1XX +64 invalidated
umi GGCACTTAGG = 251 reads: +77 -1XX +310 invalidated
umi GGCAGAAGCC = 224 reads: +77 -1XX +310 invalidated
umi GGCTCCTTTT = 78 reads: +77 -1XX +310 invalidated
umi GGGGAGCCTC = 196 reads: +77 -1XX +310 invalidated
umi GGTAATTTCC = 159 reads: +77 -1XX +310 invalidated
umi GGTCTACGTG = 210 reads: +77 -1XX +310 invalidated
umi GGTGCGATCC = 194 reads: +77 -1XX +310 invalidated
umi GTAGTACCAT = 218 reads: +77 -1XX +310 invalidated
umi GTAGTCGGGC = 191 reads: +77 -1XX +310 invalidated
umi GTCAACCATC = 217 reads: +77 -1XX +310 invalidated
umi GTCCTAATAC = 168 reads: +388 validated
umi GTCCTCTCTT = 125 reads: +77 -1XX +310 invalidated
umi GTGCCTTTCA = 268 reads: +77 -1XX +310 invalidated
umi GTGTTTCCTT = 129 reads: +77 -1XX +310 invalidated
umi GTTCATAGCG = 125 reads: +77 -1XX +310 invalidated
umi GTTTGTGGAT = 3 reads: -388 non-validated
umi GTTTTGTTGG = 85 reads: +77 -1XX +310 invalidated
umi TAAAGTGGGA = 204 reads: +388 validated
umi TAATTCCCAC = 276 reads: +77 -1XX +310 invalidated
umi TACATCCATT = 256 reads: +77 -1XX +310 invalidated
umi TACATGCTGT = 411 reads: -380 +8 non-validated
umi TACCGACTCC = 275 reads: +77 -1XX +310 invalidated
umi TACCGCACCA = 183 reads: +77 -1XX +310 invalidated
umi TATCCATCCG = 23 reads: -354X +1 -4XX +2 -4XX +2 -4XX +1 -2XX +1 -6XX +1 -4XX +2 invalidated
umi TATCCTCCCC = 186 reads: +77 -1XX +310 invalidated
umi TATCGGCTTT = 243 reads: +77 -1XX +310 invalidated
umi TATTCTTGCC = 218 reads: +77 -1XX +310 invalidated
umi TCAGTGCATT = 208 reads: +77 -1XX +310 invalidated
umi TCATCTACCT = 132 reads: +77 -1XX +310 invalidated
umi TCCGTTTCTT = 211 reads: +77 -1XX +310 invalidated
umi TCCTACATGG = 136 reads: +77 -1XX +310 invalidated
umi TCCTTGGCAC = 255 reads: +77 -1XX +310 invalidated
umi TCGTATTGGT = 275 reads: +77 -1XX +310 invalidated
umi TCTATCTAGC = 124 reads: +21 -5X +3 -7XX +1 -1XX +4 -1XX +34 -1XX +243 -11 +56 invalidated
umi TCTTAATTGG = 276 reads: +77 -1XX +310 invalidated
umi TCTTTAACCG = 195 reads: +77 -1XX +310 invalidated
umi TGAACTCAGC = 228 reads: +77 -1XX +310 invalidated
umi TGACCAAGAG = 210 reads: +77 -1XX +310 invalidated
umi TGCCATATGG = 210 reads: +388 validated
umi TGGGATGGGT = 147 reads: +77 -1XX +310 invalidated
umi TGGTTTTTAA = 186 reads: +388 validated
umi TGTACATTAG = 193 reads: +77 -1XX +310 invalidated
umi TGTATAACTT = 97 reads: +77 -1XX +310 invalidated
umi TGTATTTGCA = 75 reads: +77 -1XX +310 invalidated
umi TGTTCCCCAA = 134 reads: +77 -1XX +310 invalidated
umi TGTTCGGGTT = 143 reads: +77 -1XX +310 invalidated
umi TGTTTATTAT = 256 reads: +77 -1XX +310 invalidated
umi TTAACCCTAG = 103 reads: +77 -1XX +310 invalidated
umi TTAGGTCCAT = 279 reads: +77 -1XX +310 invalidated
umi TTAGTTCTGC = 208 reads: +77 -1XX +310 invalidated
umi TTCCGTTGGA = 227 reads: +77 -1XX +310 invalidated
umi TTCGGGGAAG = 224 reads: +77 -1XX +310 invalidated
umi TTCTACCGGA = 184 reads: +77 -1XX +310 invalidated
umi TTGACGGCCT = 222 reads: +77 -1XX +310 invalidated
umi TTGATCAGTT = 234 reads: +77 -1XX +310 invalidated
umi TTTATTGGAC = 146 reads: +77 -1XX +310 invalidated
umi TTTTACCCTC = 202 reads: +77 -1XX +310 invalidated

UMI info for barcode CTCGTCAGTGTGAATA-1 contig 2 = GAGCTCTGGG...
umi AAAAGTGTAG = 215 reads: +406 validated
umi ACCCTTAGGG = 262 reads: -372X +2 -5X +2 -1XX +1 -1XX +1 -2XX +1 -2XX +1 -2XX +1 -1XX +1 -1XX +2 -4XX +3 invalidated
umi ACGTATGCTT = 148 reads: +406 validated
umi ACTTAAATGC = 209 reads: -372X +1 -1X +1 -8X +1 -11X +2 -1XX +1 -6XX +1 invalidated
umi AGCGTTGCAG = 182 reads: +406 validated
umi AGGTCTTGCA = 140 reads: +406 validated
umi ATATAGAATA = 169 reads: +389 -17 non-validated
umi ATTGACCCTC = 225 reads: +406 validated
umi CAATATGGGC = 246 reads: +406 validated
umi CCACTTATCT = 205 reads: +406 validated
umi CCTACTCCAC = 223 reads: +406 validated
umi CCTCTGCCCA = 139 reads: +406 validated
umi CCTTCGTGTC = 389 reads: -372X +2 -5X +2 -1XX +1 -1XX +1 -2XX +1 -2XX +1 -2XX +1 -1XX +1 -1XX +2 -4XX +3 invalidated
umi CGACGCGACC = 41 reads: +320 -86 non-validated
umi CGTCTGTGTC = 149 reads: -403X +1 -2X invalidated
umi CTTCAAGGCT = 77 reads: +352 -54 non-validated
umi GACAACAATA = 92 reads: +380 -1 +10 -15 non-validated
umi GGTGTCTAAA = 112 reads: +406 validated
umi GTGGTTGCGA = 135 reads: +390 -1 +15 non-validated
umi TAAATTTCGT = 206 reads: +406 validated
umi TAACATCATA = 182 reads: +406 validated
umi TACCGTTGCC = 60 reads: +400 -6 non-validated
umi TCCCTACTTC = 210 reads: +406 validated
umi TCCTAAGCTG = 218 reads: +406 validated
umi TCCTGTGGCT = 147 reads: +397 -9 non-validated
umi TCGTTAGGTC = 96 reads: +406 validated
umi TCTCCCTTCC = 1 reads: -373 +13 -1X +1 -1X +12 -1X +4 invalidated
umi TGCGTCGCAG = 219 reads: +395 -11 non-validated
umi TGTTACGGTC = 213 reads: +406 validated
umi TTACAATCTC = 129 reads: +406 validated
umi TTCTCGTCTC = 161 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=645]
46-398 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=17)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
434-645 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 129 umis using 4463 reads
cdr3 = CSAWDSSLNVWVF at 367, score = 7 + 8
umis assigned: [11, 12, 25, 26, 37, 39, 52, 53, 72, 81] and 127 others
of which 137 are surviving nonsolos
reads assigned: 27331
start codons at 46, 185, 375, 392
confident = true

TIG 2[bases=557]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=19)
436-486 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
486-557 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 18 umis using 209 reads
cdr3 = CVKEEDAFDIW at 422, score = 9 + 8
umis assigned: [3, 125, 167, 198, 231, 247, 285, 374, 404, 472] and 21 others
of which 31 are surviving nonsolos
reads assigned: 5098
start codons at 80, 231, 236, 297, 383, 438, 467
confident = true

REJECT CONTIGS

TIG 1[bases=318]
4-138 ==> 2516-2650 on rc of segment before IGHD1-14 exon 1 [len=2650] (mis=0)
165-216 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=1)
216-318 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [1122]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 39, 234, 295
confident = false
did not find CDR3

TIG 2[bases=571]
2-81 ==> 5529-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
36-396 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=5)
397-435 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWGLLLHASSTNSSITF at 356, score = 4 + 8
umis assigned: [9, 43, 89, 105, 106, 108, 137, 200, 212, 225] and 54 others
of which 64 are surviving nonsolos
reads assigned: 17015
start codons at 36, 69, 105, 193, 355, 375, 477
confident = false
not full
frameshifted full length transcript of length 571
VJ delta = 30
not full
now this is a cell
paired!

AACAGCCTGAGAGCTGAGGACACGGCTCTTTATTACTGTGTTAAAGAGGAGGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> GGACTCCAGCCTGACGACGAGGCTGACTATTACTGCTCAGCATGGGACAGCAGCCTCAATGTTTGGGTGTTCGGCGGAGGGACCAAACTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.472 = CTCGTCAGTGTTCGAT-1

using 424 reads

====================================================================================

graph has 188 edges initially, 36 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 178, 241]
surviving nonsolo ucounts = 2[178, 241]
ids = [1, 3]

====================================================================================

UMI info for barcode CTCGTCAGTGTTCGAT-1 contig 1 = GGAATCAGTC...
umi CCGGGGGCTT = 232 reads: +388 validated

UMI info for barcode CTCGTCAGTGTTCGAT-1 contig 2 = GTCAGTCTCA...
umi CATTACTCCA = 174 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-505 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 26, 32, 101, 237, 456
confident = false

TIG 2[bases=502]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=10)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-502 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQSYTTLLTF at 350, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.475 = CTCGTCAGTTACAGAA-1

using 209 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 202]
surviving nonsolo ucounts = 1[202]
ids = [2]

====================================================================================

UMI info for barcode CTCGTCAGTTACAGAA-1 contig 1 = GGGGAGCTCT...
umi CGCAAGGCTC = 199 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=542]
83-398 ==> 0-315 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=20)
456-504 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
504-542 ==> 0-38 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARETDYGDYGYFDTW at 425, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 83, 239, 300, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.476 = CTCGTCAGTTACGCGC-1

using 272 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^3, 3, 258]
surviving nonsolo ucounts = 1[258]
ids = [3]

====================================================================================

UMI info for barcode CTCGTCAGTTACGCGC-1 contig 1 = AGCTACAACA...
umi AGGGGCCGAA = 246 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=520]
0-29 ==> 146-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
29-392 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=23)
393-432 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
432-520 ==> 0-88 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQQYFSAPYHTF at 368, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 29, 98, 351, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.477 = CTCGTCAGTTCCAACA-1

using 645 reads

====================================================================================

graph has 216 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2^2, 3, 146, 203, 287]
surviving nonsolo ucounts = 3[146, 203, 287]
ids = [7, 2, 0]

====================================================================================

UMI info for barcode CTCGTCAGTTCCAACA-1 contig 1 = GCTGGGGTCT...
umi CGGGTAGCGC = 194 reads: +385 validated

UMI info for barcode CTCGTCAGTTCCAACA-1 contig 2 = AATACTTTCT...
umi ACGCGATGTC = 284 reads: +439 validated

UMI info for barcode CTCGTCAGTTCCAACA-1 contig 3 = CCTGGGTCAG...
umi TTGCAAACCA = 141 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=524]
41-358 ==> 0-317 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
388-426 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=6)
426-524 ==> 0-98 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CSSYTSTSTVF at 365, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 41, 198, 249, 252
confident = false

TIG 2[bases=589]
0-38 ==> 26-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=0)
38-265 ==> 0-227 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=8)
268-394 ==> 227-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=14)
430-477 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
477-589 ==> 0-112 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 28 reads
cdr3 = CARIKYNWKDFKRSYCGMDVW at 383, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 17, 38, 82, 189, 290, 305, 342, 434
confident = false
see insertion of CAC at pos 227 on |192|IGHV4-4|L-REGION+V-REGION|

TIG 3[bases=472]
0-52 ==> 0-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
52-400 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=13)
405-443 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
443-472 ==> 0-29 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CQLFISSPPGLTF at 376, score = 9 + 9
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 139
start codons at 52, 260
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.483 = CTCGTCAGTTTGTGTG-1

using 349 reads

====================================================================================

graph has 112 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[32, 313]
surviving nonsolo ucounts = 2[32, 313]
ids = [1, 4]

====================================================================================

UMI info for barcode CTCGTCAGTTTGTGTG-1 contig 1 = GGGGAGGAAC...
umi TGCTGCAAAG = 330 reads: +91 -5X +292 invalidated

GOOD CONTIGS

TIG 1[bases=560]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=9)
386-424 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQRSTWPPRITF at 357, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 36, 241, 244, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.489 = CTCGTCATCACCGGGT-1

using 220 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 5, 209]
surviving nonsolo ucounts = 1[209]
ids = [1]

====================================================================================

UMI info for barcode CTCGTCATCACCGGGT-1 contig 1 = GAGCTACCAC...
umi CGAGTCCATG = 198 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=501]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=10)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
430-501 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CHQYFGTPFTF at 369, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.499 = CTCGTCATCCATGAAC-1

using 36519 reads

====================================================================================

graph has 15028 edges initially, 117 edges after simplification

total ucounts = 1629
nonsolo ucounts = 841[2^278, 3^177, 4^90, 5^45, 6^32, 7^18, 8^7, 9^16, 10^4, 11^2, 12^2, 13, 15, 16, 23, 28, 55, 58, 64, 66, 71, 75, 81, 85, 89, 94, 102, 108, 109, 110, 111, 113, 114, 115, 117, 118, 122^2, 127, 128, 130, 132, 135^2, 137, 138, 141, 142, 143, 146, 147^3, 150, 151, 152, 153^2, 155^2, 156, 157, 162^2, 167, 169, 171, 174, 175, 176, 181, 182^5, 186, 187, 188, 189^2, 190, 191^2, 192, 193, 194, 195, 197^2, 198, 201^2, 204^2, 205, 206, 207, 208, 209, 210^2, 211, 212, 213, 214^2, 215, 216, 217, 218^2, 219^2, 222, 223, 224, 225^2, 226^3, 227, 228, 230^2, 231, 232^2, 235^2, 237^3, 238, 239, 240^2, 241^2, 242, 243, 244, 249, 250^2, 253^2, 254, 257, 258^4, 260, 261, 262, 263^2, 267, 270, 273, 279, 283^3, 286, 288, 289, 291, 292, 293, 295, 297, 299, 306^2, 315, 381, 402, 488]
surviving nonsolo ucounts = 158[55, 75, 85, 89, 94, 102, 108, 110, 111, 113, 115, 117, 118, 122^2, 127, 128, 130, 132, 135^2, 137, 138, 141, 142, 143, 146, 147^3, 150, 151, 152, 153^2, 155^2, 156, 157, 162^2, 167, 169, 171, 174, 175, 176, 181, 182^5, 186, 187, 188, 189^2, 190, 191^2, 192, 193, 194, 195, 197^2, 198, 201^2, 204^2, 205, 206, 207, 208, 209, 210^2, 211, 212, 213, 214^2, 215, 216, 217, 218^2, 219^2, 222, 223, 224, 225^2, 226^3, 227, 228, 230^2, 231, 232^2, 235^2, 237^3, 238, 239, 240^2, 241^2, 242, 243, 244, 249, 250^2, 253^2, 254, 257, 258^4, 260, 261, 262, 263^2, 267, 270, 273, 279, 283^3, 286, 288, 289, 291, 292, 293, 295, 297, 299, 306^2, 315, 381, 402, 488]
ids = [367, 1259, 1255, 546, 660, 474, 418, 1313, 215, 959, ...]

====================================================================================

UMI info for barcode CTCGTCATCCATGAAC-1 contig 1 = AGCCCTCAGA...
umi AACCGTCTCT = 219 reads: +430 validated
umi ACCCAAGGAC = 142 reads: +410 -5 +15 non-validated
umi AGAATCCGGC = 113 reads: +398 -22 +10 non-validated
umi ATAGTCTGGC = 151 reads: +430 validated
umi ATCATGTTGC = 210 reads: +430 validated
umi ATCCTATTTG = 61 reads: +49 -4XX +42 -1 +271 -63 invalidated
umi ATGGAAAGGA = 133 reads: +430 validated
umi CACAGCGTTT = 110 reads: +430 validated
umi CATACTCTCA = 218 reads: +430 validated
umi CCCTTTTTGG = 89 reads: +430 validated
umi CCGCAGTCTT = 144 reads: +91 -2X +1 -2XX +6 -4XX +324 invalidated
umi CCTTCCTTTG = 130 reads: +430 validated
umi CGGAACGATT = 126 reads: +388 -1 +16 -25 non-validated
umi CGGGTTTATA = 95 reads: +430 validated
umi CTACTCTGTT = 153 reads: +413 -1 +1 -15 non-validated
umi CTCAACTACT = 169 reads: +85 -1XX +315 -1 +4 -24 invalidated
umi CTGACTCGTT = 177 reads: +430 validated
umi CTTTCAATTG = 145 reads: +430 validated
umi GAGCTCTTTC = 142 reads: +362 -2 +57 -9 non-validated
umi GAGGTTTGGC = 188 reads: +430 validated
umi GCTACCGAAT = 204 reads: +430 validated
umi GGCACCCCTT = 177 reads: +430 validated
umi TACCCAGCAA = 136 reads: +95 -1XX +9 -1XX +324 invalidated
umi TCATACTCCC = 170 reads: +430 validated
umi TCCCGTATGG = 84 reads: +95 -1XX +334 invalidated
umi TCCCTCGACC = 74 reads: +95 -1X +180 -5 +134 -15 invalidated
umi TCCGGGAACC = 149 reads: +430 validated
umi TCTACCTATA = 170 reads: +430 validated
umi TCTAGTTTCT = 110 reads: +201 -1XX +228 invalidated
umi TCTCTCTCAT = 280 reads: +1 -1XX +6 -1XX +6 -1XX +2 -8XX +1 -376X +1 -1XX +1 -3XX +1 -7XX +1 -3XX +1 -3XX +2 -1XX +2 invalidated
umi TGTGCTCGGC = 164 reads: +430 validated
umi TTAAGTTGTA = 157 reads: +430 validated
umi TTAATAGGGT = 123 reads: +430 validated
umi TTCTGAAATG = 132 reads: +429 -1 non-validated
umi TTGACGCAAG = 115 reads: +415 -15 non-validated

UMI info for barcode CTCGTCATCCATGAAC-1 contig 2 = TGGGAGGAGT...
umi AAAAAGCTTA = 186 reads: +382 validated
umi AAATACTAGT = 260 reads: +382 validated
umi AACAACCGAC = 186 reads: +382 validated
umi AACTCTCCAG = 238 reads: +382 validated
umi AAGGAGGGTC = 215 reads: +382 validated
umi AATAACCGCT = 194 reads: +382 validated
umi AATGCCCTCC = 227 reads: +382 validated
umi AATTTGCAAT = 183 reads: +382 validated
umi ACAGGTATGT = 189 reads: +382 validated
umi ACCGTATCCT = 136 reads: +382 validated
umi ACTAGTCGTG = 225 reads: +382 validated
umi ACTATCTCTC = 149 reads: +382 validated
umi AGCCGGCCAA = 286 reads: +382 validated
umi AGCGCAGCCC = 309 reads: +382 validated
umi AGCTTGTCGC = 238 reads: +382 validated
umi AGGCAGCACT = 220 reads: +382 validated
umi AGGCGTCCAT = 284 reads: +382 validated
umi AGTCCATGAG = 233 reads: +382 validated
umi AGTGTACATA = 240 reads: +382 validated
umi AGTTTTCTCA = 257 reads: +382 validated
umi ATAATGCTTA = 193 reads: +382 validated
umi ATAGAGGTCC = 214 reads: +382 validated
umi ATATGTCGGC = 188 reads: +382 validated
umi ATCCAATTAC = 266 reads: +382 validated
umi ATCCAGCCCC = 226 reads: +382 validated
umi ATCGATTCAA = 298 reads: +382 validated
umi ATGACTTCTG = 246 reads: +382 validated
umi ATGATGCTTT = 231 reads: +382 validated
umi ATGCCAGTAC = 137 reads: +382 validated
umi ATGGCTTCCA = 255 reads: +382 validated
umi ATGTTTGACC = 287 reads: +382 validated
umi ATTCACTCTT = 210 reads: +382 validated
umi ATTCCGTCTT = 220 reads: +382 validated
umi ATTGATCAAC = 123 reads: +382 validated
umi CACAATGTCG = 292 reads: +382 validated
umi CACATGGATA = 189 reads: +382 validated
umi CACCGAAGTA = 207 reads: +382 validated
umi CACTCAAACA = 158 reads: +382 validated
umi CAGTCAGTCC = 240 reads: +382 validated
umi CATCAACTTT = 176 reads: +382 validated
umi CATCGTTTCG = 259 reads: +382 validated
umi CATTTCACTA = 253 reads: +382 validated
umi CCACGTGTTT = 245 reads: +382 validated
umi CCCCTTCCGC = 225 reads: +382 validated
umi CCGTTTGCAT = 192 reads: +382 validated
umi CCTACTGTTC = 138 reads: +382 validated
umi CGAACTTGGC = 216 reads: +382 validated
umi CGAGCTCCCA = 178 reads: +382 validated
umi CGCAACCCTT = 315 reads: +133 -1XX +1 -3XX +2 -6XX +1 -7XX +1 -2XX +1 -50X +1 -6XX +1 -2XX +1 -7XX +156 invalidated
umi CTACCCGCGT = 397 reads: +382 validated
umi CTACGCTCAC = 268 reads: +382 validated
umi CTATGCATAG = 197 reads: +382 validated
umi CTGTCTCCTC = 212 reads: +382 validated
umi CTTCTACGGC = 232 reads: +382 validated
umi GAACACGGAA = 214 reads: +382 validated
umi GAATGGCCGA = 241 reads: +382 validated
umi GACCCGTCTT = 218 reads: +382 validated
umi GAGCTGTCAA = 260 reads: +382 validated
umi GCAAATTGCC = 269 reads: +382 validated
umi GCATGTGTTT = 241 reads: +382 validated
umi GCCACTATCA = 210 reads: +382 validated
umi GCCTTAGCTC = 222 reads: +382 validated
umi GCGCCTTTAA = 228 reads: +382 validated
umi GCTATACCTT = 223 reads: +382 validated
umi GCTTCTTGTA = 110 reads: +382 validated
umi GGATTCCTTC = 289 reads: +382 validated
umi GGCACCCGTG = 297 reads: +382 validated
umi GGGCGCACCC = 240 reads: +382 validated
umi GTAGGATCTC = 317 reads: +382 validated
umi GTAGGCTGTA = 154 reads: +382 validated
umi GTATCAAGGA = 253 reads: +382 validated
umi GTCGAATACC = 201 reads: +382 validated
umi GTGACCTATT = 238 reads: +382 validated
umi GTTAGGCTCC = 244 reads: +382 validated
umi GTTCAGTACA = 489 reads: +382 validated
umi TAAAAATGGC = 143 reads: +382 validated
umi TAAAACCGGC = 280 reads: +382 validated
umi TAAAGTGGGC = 208 reads: +382 validated
umi TAAGATTCAC = 222 reads: +382 validated
umi TAATGTGATA = 199 reads: +382 validated
umi TAATTGCTAT = 255 reads: +382 validated
umi TAATTTTTCT = 224 reads: +382 validated
umi TACAATCTCA = 227 reads: +382 validated
umi TACTCAGCTG = 150 reads: +382 validated
umi TACTCCCAAT = 173 reads: +382 validated
umi TAGTCGTAGT = 195 reads: +382 validated
umi TATCCACGGT = 253 reads: +382 validated
umi TATGTATTAT = 277 reads: +382 validated
umi TATTACCGGA = 409 reads: +133 -1XX +1 -3XX +2 -6XX +1 -7XX +1 -2XX +1 -2XX +1 -35X +2 -10X +1 -6XX +1 -2XX +1 -7XX +156 invalidated
umi TCAGATCCTA = 175 reads: +382 validated
umi TCAGCGGCCT = 209 reads: +382 validated
umi TCAGTCATAT = 197 reads: +382 validated
umi TCCACTAGAC = 275 reads: +382 validated
umi TCCAGCCACT = 205 reads: +382 validated
umi TCCAGCCCTT = 127 reads: +382 validated
umi TCCGTCAGTC = 261 reads: +382 validated
umi TCCTATTAGT = 227 reads: +382 validated
umi TCTACGCTCC = 181 reads: +382 validated
umi TCTTATCTAT = 272 reads: +382 validated
umi TCTTTTTTCT = 246 reads: +382 validated
umi TGAACCGGCA = 238 reads: +382 validated
umi TGACGCCTCT = 287 reads: +382 validated
umi TGATCAGTGA = 221 reads: +382 validated
umi TGCCGTGTGT = 260 reads: +382 validated
umi TGCGCAGGTA = 153 reads: +382 validated
umi TGGCATGCTG = 255 reads: +382 validated
umi TGTGGATTCA = 210 reads: +382 validated
umi TTAACCCACC = 186 reads: +382 validated
umi TTATGTTCTG = 145 reads: +382 validated
umi TTCCTTTCAG = 180 reads: +382 validated
umi TTCTGAGGGT = 220 reads: +382 validated
umi TTTACTCAAG = 184 reads: +382 validated
umi TTTATATCCG = 248 reads: +382 validated
umi TTTCGAGGCT = 205 reads: +382 validated
umi TTTTGTATTA = 221 reads: +382 validated
umi TTTTTTCTGA = 238 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=669]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=1)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=36)
463-509 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
509-669 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 24 umis using 274 reads
cdr3 = CARESYVGLYSSTSYPDYW at 421, score = 8 + 7
umis assigned: [41, 145, 215, 295, 313, 321, 353, 418, 471, 546] and 25 others
of which 34 are surviving nonsolos
reads assigned: 5006
start codons at 79, 228, 235, 314, 356, 382, 437, 563
confident = true

TIG 2[bases=555]
37-285 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
381-419 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 115 umis using 4177 reads
cdr3 = CLHYDNRRRTF at 358, score = 9 + 8
umis assigned: [1, 16, 23, 52, 62, 75, 90, 104, 127, 157] and 106 others
of which 116 are surviving nonsolos
reads assigned: 25841
start codons at 37, 93, 106, 245, 368, 461
confident = true
now this is a cell
paired!

GCTGTTTATTACTGTGCGAGAGAATCTTATGTCGGGCTCTATTCTTCAACCAGTTATCCCGACTACTGGGGTCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GTCTCCAGCCTGCAACCTGAAGATTTTGCCACCTATTATTGTCTACACTATGATAATCGCCGTCGCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.505 = CTCGTCATCCTAGTGA-1

using 548 reads

====================================================================================

graph has 202 edges initially, 16 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 208, 330]
surviving nonsolo ucounts = 2[208, 330]
ids = [8, 4]

====================================================================================

UMI info for barcode CTCGTCATCCTAGTGA-1 contig 1 = GGGGTCACAA...
umi TTTAACATGT = 209 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=556]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=2)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
432-556 ==> 0-124 on |306|IGLC2|C-REGION| [len=317] (mis=3)
junction support: 1 umis using 25 reads
cdr3 = CCSYAGSSTLGVVF at 362, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 207
start codons at 38, 177, 239, 246, 372
confident = false

REJECT CONTIGS

TIG 1[bases=488]
0-37 ==> 214-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
25-84 ==> 5638-5697 on segment before IGLV3-29 exon 1 [len=6000] (mis=4)
37-355 ==> 0-318 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=0)
351-488 ==> 29-166 on |305|IGLC1|C-REGION| [len=317] (mis=0)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 37, 98, 236, 239, 335, 454
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.508 = CTCGTCATCCTGTACC-1

using 23 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.518 = CTCGTCATCGTCGTTC-1

using 288 reads

====================================================================================

graph has 94 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 106, 173]
surviving nonsolo ucounts = 3[2, 106, 173]
ids = [7, 3, 6]

====================================================================================

UMI info for barcode CTCGTCATCGTCGTTC-1 contig 1 = GGAGTGCTTT...
umi TCGCAACCTA = 103 reads: +436 validated

UMI info for barcode CTCGTCATCGTCGTTC-1 contig 2 = AGCTGTGGGC...
umi ATAATTTCCT = 2 reads: -269 +5 -2 +3 -2 +2 -1 +7 -1 +2 -2 +1 -1 +5 -2X +1 -1 +3 -1 +8 -1 +2 -2 +1 -57 invalidated
umi TTAATTTCCA = 1 reads: -272 +4 -1X +2 -1 +3 -1 +2 -1 +3 -1 +5 -1 +4 -1 +2 -1 +14 -5 +2 -1 +1 -54 invalidated
umi TTAGTTTCCT = 167 reads: +382 validated
umi TTATTTTACT = 2 reads: -105 +58 -219 non-validated

GOOD CONTIGS

TIG 1[bases=478]
19-390 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=8)
407-455 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
455-478 ==> 0-23 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARAHGDYYTLLDFW at 379, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 101
start codons at 19, 40, 84, 170, 370
confident = false

TIG 2[bases=510]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-510 ==> 0-88 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CNSRDSSGNHLVF at 355, score = 8 + 9
umis assigned: [1, 4, 6, 7]
of which 2 are surviving nonsolos
reads assigned: 171
start codons at 40, 159, 188, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.519 = CTCGTCATCGTGACAT-1

using 81 reads

====================================================================================

graph has 91 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 10[2, 3^3, 4, 5, 7^3, 37]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.531 = CTCGTCATCTCTTATG-1

using 253 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[2^4, 4, 5, 230]
surviving nonsolo ucounts = 1[230]
ids = [10]

====================================================================================

UMI info for barcode CTCGTCATCTCTTATG-1 contig 1 = ACACAGCATG...
umi TACATATCCC = 215 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=480]
7-358 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
358-395 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
395-480 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYNSYPLTF at 334, score = 8 + 9
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 7, 13, 69, 82, 218, 221, 314, 437
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.537 = CTCGTCATCTTCCTTC-1

using 13 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.541 = CTCTAATAGAAGGTTT-1

using 1028 reads

====================================================================================

graph has 318 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 4, 326, 692]
surviving nonsolo ucounts = 2[326, 692]
ids = [6, 4]

====================================================================================

UMI info for barcode CTCTAATAGAAGGTTT-1 contig 1 = AGTCCCAACC...
umi CGCGTTGCAT = 688 reads: +388 validated
umi CTTTAACTAG = 324 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 11-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
20-371 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=24)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 153 reads
cdr3 = CQQYDDLPITF at 347, score = 9 + 8
umis assigned: [4, 6]
of which 2 are surviving nonsolos
reads assigned: 999
start codons at 20, 26, 82, 95, 357, 360, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.547 = CTCTAATAGAGTGACC-1

using 77 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 13[2^2, 3, 4^2, 5^2, 6, 7, 8^3, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.550 = CTCTAATAGATCGGGT-1

using 564 reads

====================================================================================

graph has 202 edges initially, 12 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[3, 5, 11, 66, 475]
surviving nonsolo ucounts = 2[66, 475]
ids = [5, 2]

====================================================================================

UMI info for barcode CTCTAATAGATCGGGT-1 contig 1 = GGAGTCAGTC...
umi CCATGTTTTT = 480 reads: +381 -2XX +2 invalidated

GOOD CONTIGS

TIG 1[bases=547]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 0 umis using 0 reads
cdr3 = CQQYDNLPTF at 353, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 469
start codons at 26, 32, 88, 101, 240, 363, 453
confident = false

REJECT CONTIGS

TIG 1[bases=556]
0-66 ==> 5542-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
21-381 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=3)
382-420 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWGLLLHASSTDSSITF at 341, score = 4 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 65
start codons at 21, 54, 90, 178, 340, 360, 462
confident = false
not full
frameshifted full length transcript of length 556
VJ delta = 30
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.551 = CTCTAATAGATGTAAC-1

using 53 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 48]
surviving nonsolo ucounts = 1[48]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.556 = CTCTAATAGCGTTCCG-1

using 278 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 5, 263]
surviving nonsolo ucounts = 1[263]
ids = [7]

====================================================================================

UMI info for barcode CTCTAATAGCGTTCCG-1 contig 1 = GAGTCAGACC...
umi TAAGGTCGTC = 266 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=546]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
372-410 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYNSYFTF at 352, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 25, 31, 87, 100, 332, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.558 = CTCTAATAGCTGAACG-1

using 322 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[320]
surviving nonsolo ucounts = 1[320]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.559 = CTCTAATAGGACTGGT-1

using 201 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[199]
surviving nonsolo ucounts = 1[199]
ids = [1]

====================================================================================

UMI info for barcode CTCTAATAGGACTGGT-1 contig 1 = GCTGGGGTCA...
umi CGTATTCCTG = 199 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=567]
0-41 ==> 121-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
41-381 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
435-567 ==> 0-132 on |306|IGLC2|C-REGION| [len=317] (mis=3)
junction support: 1 umis using 34 reads
cdr3 = CCSEAGGGVPGLLF at 365, score = 7 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 41, 195
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.566 = CTCTAATAGGTGTTAA-1

using 186 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[5, 6, 7, 161]
surviving nonsolo ucounts = 1[161]
ids = [5]

====================================================================================

UMI info for barcode CTCTAATAGGTGTTAA-1 contig 1 = AGCATCATCC...
umi GGCATTGCTA = 156 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=507]
0-61 ==> 243-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
61-414 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=33)
438-491 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=7)
junction support: 1 umis using 16 reads
cdr3 = CARNPGDNSWDSYFHLDLW at 403, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 155
start codons at 61, 215, 255, 259, 325, 358
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.573 = CTCTAATAGTGTTAGA-1

using 945 reads

====================================================================================

graph has 356 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2, 3^2, 6, 244, 680]
surviving nonsolo ucounts = 2[244, 680]
ids = [2, 11]

====================================================================================

UMI info for barcode CTCTAATAGTGTTAGA-1 contig 1 = AGAAGCAGAG...
umi ATTAGCCACT = 243 reads: +382 validated

UMI info for barcode CTCTAATAGTGTTAGA-1 contig 2 = TGGGGAGGTG...
umi TGCGCGCATG = 681 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=551]
0-28 ==> 12-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
28-365 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
372-410 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
410-551 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CNSRDSSGNHVVF at 343, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 28, 147, 176, 227, 326, 371
confident = false

TIG 2[bases=549]
50-405 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=26)
409-447 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
447-549 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 72 reads
cdr3 = CAKDMRYW at 392, score = 9 + 7
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 673
start codons at 50, 195, 201, 206, 285, 353, 404, 465, 526
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.580 = CTCTAATCAATCGGTT-1

using 285 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[7, 272]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.592 = CTCTAATCAGAGCCAA-1

using 958 reads

====================================================================================

graph has 416 edges initially, 10 edges after simplification

total ucounts = 8
nonsolo ucounts = 7[2, 3, 5, 133, 195, 214, 405]
surviving nonsolo ucounts = 4[133, 195, 214, 405]
ids = [7, 2, 4, 1]

====================================================================================

UMI info for barcode CTCTAATCAGAGCCAA-1 contig 1 = GGAGTCAGTC...
umi ATCTTATGAT = 382 reads: -349 +1 -5X +1 -3XX +1 -9XX +1 -1XX +3 -3XX +1 -1XX +1 -3XX +1 -1XX invalidated
umi CGCATCGCTT = 215 reads: +385 validated

UMI info for barcode CTCTAATCAGAGCCAA-1 contig 2 = GGGGTCTCAG...
umi ATTATAACCC = 190 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQYDNLPTF at 353, score = 9 + 8
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 588
start codons at 26, 32, 88, 101, 240, 363, 453
confident = true

TIG 2[bases=547]
0-38 ==> 3-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
38-389 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
426-547 ==> 0-121 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CSSYTSSSTVVF at 362, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 38, 195, 239, 246
confident = true

REJECT CONTIGS

TIG 1[bases=461]
0-365 ==> 6-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
382-430 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
430-461 ==> 0-31 on |40|IGHG1|C-REGION| [len=884] (mis=0)
cdr3 = CARYFAFVNYYFDKW at 354, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 128
start codons at 15, 59
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.593 = CTCTAATCAGATGAGC-1

using 370 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4^2, 358]
surviving nonsolo ucounts = 1[358]
ids = [3]

====================================================================================

UMI info for barcode CTCTAATCAGATGAGC-1 contig 1 = AGACCCTGTC...
umi GTGCATGGCA = 342 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=450]
0-26 ==> 27-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
26-371 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=1)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
411-450 ==> 0-39 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQYYSYPPYTF at 347, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 26, 82, 95, 231
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.594 = CTCTAATCAGCATACT-1

using 177 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 4, 169]
surviving nonsolo ucounts = 1[169]
ids = [3]

====================================================================================

UMI info for barcode CTCTAATCAGCATACT-1 contig 1 = AGCTTCAGCT...
umi CATGGTAACT = 166 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-556 ==> 0-121 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.604 = CTCTAATCATCCCACT-1

using 18 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.606 = CTCTAATCATCGACGC-1

using 411 reads

====================================================================================

graph has 150 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 14, 390]
surviving nonsolo ucounts = 1[390]
ids = [3]

====================================================================================

UMI info for barcode CTCTAATCATCGACGC-1 contig 1 = GGAGAAGAGC...
umi TAACGCTCAG = 392 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQYGSSPPTF at 360, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 386
start codons at 36, 244, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.610 = CTCTAATCATGGTCTA-1

using 209 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 3[2, 3, 193]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode CTCTAATCATGGTCTA-1 contig 1 = GAGGGTCCTG...
umi TTAGGGCTCT = 173 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=497]
59-407 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=5)
441-492 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
junction support: 1 umis using 8 reads
cdr3 = CARDSNSSGYYEGGWFDPW at 404, score = 9 + 7
umis assigned: [12]
of which 0 are surviving nonsolos
reads assigned: 169
start codons at 15, 59, 103
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.612 = CTCTAATCATGTCCTC-1

using 26 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[26]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.620 = CTCTAATGTAATAGCA-1

using 338 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 3, 326]
surviving nonsolo ucounts = 1[326]
ids = [1]

====================================================================================

UMI info for barcode CTCTAATGTAATAGCA-1 contig 1 = GCTGGGGTCT...
umi CACGTATTCG = 317 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=585]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-402 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=5)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
429-585 ==> 0-156 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CSSYTSSSTLVF at 365, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 315
start codons at 41, 198, 242, 249, 561
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.621 = CTCTAATGTACAGCAG-1

using 218 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 209]
surviving nonsolo ucounts = 1[209]
ids = [0]

====================================================================================

UMI info for barcode CTCTAATGTACAGCAG-1 contig 1 = GAGCCCCAGC...
umi AACAGCTTCA = 208 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=512]
0-67 ==> 169-236 on |168|IGHV3-74|5'UTR| [len=236] (mis=0)
67-398 ==> 0-331 on |169|IGHV3-74|L-REGION+V-REGION| [len=351] (mis=17)
439-476 ==> 26-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
476-512 ==> 0-36 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CTNLYHFGSEVW at 409, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 67, 223, 284
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.625 = CTCTAATGTACGAAAT-1

using 332 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[6, 324]
surviving nonsolo ucounts = 1[324]
ids = [3]

====================================================================================

UMI info for barcode CTCTAATGTACGAAAT-1 contig 1 = GGAGGAACTG...
umi TTCTCTCGTT = 321 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=555]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 44 reads
cdr3 = CQQYNNWPLYTF at 355, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 34, 103, 239, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.627 = CTCTAATGTAGCGTGA-1

using 346 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 338]
surviving nonsolo ucounts = 1[338]
ids = [5]

====================================================================================

UMI info for barcode CTCTAATGTAGCGTGA-1 contig 1 = GGAACTGCTC...
umi GGTCATTGGG = 311 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=502]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
416-502 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQYNNWPPWTF at 352, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 31, 100, 236, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.628 = CTCTAATGTATATGGA-1

using 240 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 4, 231]
surviving nonsolo ucounts = 1[231]
ids = [1]

====================================================================================

UMI info for barcode CTCTAATGTATATGGA-1 contig 1 = GATCAGGACT...
umi ATCACCCAGT = 222 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=498]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-498 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.632 = CTCTAATGTCAACTGT-1

using 336 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 4, 324]
surviving nonsolo ucounts = 1[324]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.658 = CTCTAATTCAAGCCTA-1

using 234 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 3^2, 219]
surviving nonsolo ucounts = 1[219]
ids = [8]

====================================================================================

UMI info for barcode CTCTAATTCAAGCCTA-1 contig 1 = GGCCTAAGGA...
umi GGCTAGCAGT = 212 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=560]
0-34 ==> 217-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
34-376 ==> 0-342 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=11)
378-416 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
416-560 ==> 0-144 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CHVWDSSSDSVVF at 349, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 207
start codons at 34, 95, 236, 332
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.661 = CTCTAATTCACATGCA-1

using 2729 reads

====================================================================================

graph has 3857 edges initially, 28 edges after simplification

total ucounts = 1189
nonsolo ucounts = 589[2^224, 3^147, 4^77, 5^56, 6^35, 7^18, 8^13, 9^9, 10, 11^4, 12, 13, 15^2, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.663 = CTCTAATTCACGCGGT-1

using 196 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[194]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode CTCTAATTCACGCGGT-1 contig 1 = GAGGGTCCTG...
umi GCTACCATCT = 192 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=569]
59-407 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=11)
436-486 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
486-569 ==> 0-83 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 23 reads
cdr3 = CARDLLWFGETRAFDIW at 404, score = 9 + 8
umis assigned: [0]
of which 0 are surviving nonsolos
reads assigned: 188
start codons at 15, 59, 103, 421, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.664 = CTCTAATTCACTATTC-1

using 533 reads

====================================================================================

graph has 168 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 165, 361]
surviving nonsolo ucounts = 2[165, 361]
ids = [7, 6]

====================================================================================

UMI info for barcode CTCTAATTCACTATTC-1 contig 1 = AGCTCTGGGA...
umi TACCAGACTC = 167 reads: +436 validated

UMI info for barcode CTCTAATTCACTATTC-1 contig 2 = GAGCTACAAC...
umi GTACGGTTCC = 350 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=550]
0-79 ==> 1-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
79-430 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=14)
467-515 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
515-550 ==> 0-35 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CARESFAYCSADCHKYYFDYW at 421, score = 8 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 162
start codons at 79, 235, 286, 296, 382
confident = false

TIG 2[bases=522]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=9)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
430-522 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 66 reads
cdr3 = CQHYYSIPPTF at 369, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 349
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.665 = CTCTAATTCAGCAACT-1

using 314 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[3, 303]
surviving nonsolo ucounts = 1[303]
ids = [4]

====================================================================================

UMI info for barcode CTCTAATTCAGCAACT-1 contig 1 = GAAGAGCTGC...
umi CAACGTGCTT = 279 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=471]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=12)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-471 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYDSSPLTF at 357, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.673 = CTCTAATTCCTTAATC-1

using 358 reads

====================================================================================

graph has 148 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 9[2^4, 3^2, 9, 132, 199]
surviving nonsolo ucounts = 2[132, 199]
ids = [5, 9]

====================================================================================

UMI info for barcode CTCTAATTCCTTAATC-1 contig 1 = GAATCAGTCC...
umi GTATTATCCT = 121 reads: +388 validated

UMI info for barcode CTCTAATTCCTTAATC-1 contig 2 = TGGGGGCTGT...
umi TACTTTTCAC = 2 reads: -1 +3 -2 +3 -1 +1 -1 +6 -1X +6 -3 +4 -2 +11 -1 +8 -328 invalidated
umi TACTTTTCCG = 193 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=474]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-474 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 119
start codons at 25, 31, 100, 236, 455
confident = false

TIG 2[bases=530]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=4)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
425-530 ==> 0-105 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQSADSSGTYVVF at 358, score = 8 + 8
umis assigned: [8, 9]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 43, 104, 173, 191, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.675 = CTCTAATTCCTTGGTC-1

using 612 reads

====================================================================================

graph has 268 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 3[4, 225, 374]
surviving nonsolo ucounts = 2[225, 374]
ids = [5, 8]

====================================================================================

UMI info for barcode CTCTAATTCCTTGGTC-1 contig 1 = AGAGCTGCTC...
umi TCAGACCGTA = 351 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=479]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
419-479 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYGSSPPYTF at 355, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 348
start codons at 31, 239, 365, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.676 = CTCTAATTCGGCCGAT-1

using 190 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 181]
surviving nonsolo ucounts = 1[181]
ids = [6]

====================================================================================

UMI info for barcode CTCTAATTCGGCCGAT-1 contig 1 = AGCTTCAGCT...
umi TGCATCTAGG = 181 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=511]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=2)
396-434 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
434-511 ==> 0-77 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CAAWDDSLSGLVF at 367, score = 7 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 179
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.678 = CTCTAATTCGTACCGG-1

using 216 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 5, 204]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode CTCTAATTCGTACCGG-1 contig 1 = GACTTTCTGA...
umi TTTGAATCCG = 200 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=542]
36-384 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=11)
413-463 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
463-542 ==> 0-79 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 28 reads
cdr3 = CARDLLWFGETRAFDIW at 381, score = 9 + 8
umis assigned: [5]
of which 0 are surviving nonsolos
reads assigned: 198
start codons at 36, 80, 398, 444
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.689 = CTCTAATTCTTCTGGC-1

using 276 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 4, 265]
surviving nonsolo ucounts = 1[265]
ids = [4]

====================================================================================

UMI info for barcode CTCTAATTCTTCTGGC-1 contig 1 = AGAGCTCTGG...
umi GCTCTTGTAC = 262 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=5)
390-429 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYGSSPCSF at 368, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 44, 354, 378, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.693 = CTCTACGAGAAGATTC-1

using 319 reads

====================================================================================

graph has 154 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[4, 87, 220]
surviving nonsolo ucounts = 2[87, 220]
ids = [7, 6]

====================================================================================

UMI info for barcode CTCTACGAGAAGATTC-1 contig 1 = CCCCTCCTTG...
umi GTCCAGTGCG = 208 reads: +436 validated

UMI info for barcode CTCTACGAGAAGATTC-1 contig 2 = TCTCGGGACG...
umi TACTAAATAA = 86 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=539]
0-40 ==> 19-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
40-393 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
442-476 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
476-539 ==> 0-63 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 382, score = 7 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 40, 238, 243, 260, 304, 337, 530
confident = false

TIG 2[bases=435]
18-358 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
375-403 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
403-435 ==> 0-32 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 16 reads
cdr3 = CFSYGTSGRTF at 342, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 83
start codons at 18, 226, 352
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.695 = CTCTACGAGAAGGGTA-1

using 23 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.704 = CTCTACGAGCAATCTC-1

using 318 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[312]
surviving nonsolo ucounts = 1[312]
ids = [3]

====================================================================================

UMI info for barcode CTCTACGAGCAATCTC-1 contig 1 = GAATCAGTCC...
umi CACGCCTCCA = 311 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.705 = CTCTACGAGCAGATCG-1

using 324 reads

====================================================================================

graph has 104 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[3^3, 4, 21, 287]
surviving nonsolo ucounts = 1[287]
ids = [0]

====================================================================================

UMI info for barcode CTCTACGAGCAGATCG-1 contig 1 = TGATCAGGAC...
umi AAAGGACAGC = 281 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=564]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=2)
390-428 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CMQALQTSITF at 367, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 31, 64, 100, 188, 350, 370, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.708 = CTCTACGAGCGTGAAC-1

using 987 reads

====================================================================================

graph has 334 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[4, 5^2, 141, 196, 632]
surviving nonsolo ucounts = 3[141, 196, 632]
ids = [9, 7, 6]

====================================================================================

UMI info for barcode CTCTACGAGCGTGAAC-1 contig 1 = AGGAGTCAGA...
umi GATACTCATT = 629 reads: -208 +180 non-validated
umi TTTTCATACC = 143 reads: +388 validated

UMI info for barcode CTCTACGAGCGTGAAC-1 contig 2 = GAGCTCTGGG...
umi TTAGACTGTT = 192 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-362 ==> 0-335 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=11)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 162 reads
cdr3 = CQHYDSFPLTF at 354, score = 8 + 9
umis assigned: [6, 9]
of which 2 are surviving nonsolos
reads assigned: 764
start codons at 27, 33, 87, 102, 334, 364, 457
confident = true

TIG 2[bases=537]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=19)
455-501 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
501-537 ==> 0-36 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARDGGPIQVWYLTFW at 422, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 189
start codons at 80, 231, 236, 294, 297, 315, 383, 432, 451
confident = true
now this is a cell
paired!

GAGGACACGGCTTTGTATTACTGTGCGAGAGATGGGGGCCCGATACAAGTATGGTATTTGACCTTCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACACTATGACAGTTTTCCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.714 = CTCTACGAGGACCACA-1

using 17888 reads

====================================================================================

graph has 9192 edges initially, 128 edges after simplification

total ucounts = 1694
nonsolo ucounts = 807[2^285, 3^164, 4^105, 5^66, 6^46, 7^37, 8^25, 9^12, 10^2, 11^5, 12^6, 13^2, 14^3, 15^2, 16^2, 17, 25, 27, 41, 55, 83, 85, 89, 90, 111, 128, 153, 160, 176, 194, 204, 213, 222, 226, 227, 230, 231, 232^2, 234, 241^2, 247, 249, 269, 281, 284, 288, 290, 293, 306, 311, 347, 399, 443, 509, 632, 754, 1953, 2047]
surviving nonsolo ucounts = 40[27, 41, 55, 83, 85, 90, 153, 160, 176, 194, 204, 213, 222, 226, 227, 230, 231, 232^2, 234, 241^2, 247, 249, 269, 281, 284, 288, 290, 293, 306, 311, 347, 399, 443, 509, 632, 754, 1953, 2047]
ids = [553, 321, 1130, 1039, 972, 1147, 301, 768, 1020, 456, ...]

====================================================================================

UMI info for barcode CTCTACGAGGACCACA-1 contig 1 = GGAGTCTCCC...
umi AGTCCCTTTC = 40 reads: +5 -1 +313 -1 +25 -22 +5 -1 +51 non-validated
umi CAGTGTAGTT = 26 reads: +344 -80 non-validated
umi CGTACCCCGT = 243 reads: +424 validated
umi CGTAGCATCA = 158 reads: +409 -15 non-validated
umi CTCTGTTAGT = 191 reads: +424 validated
umi GAGAAGGTCT = 81 reads: +424 validated
umi GATTTAGGGT = 176 reads: +422 -2 non-validated
umi GCATAAAGGG = 84 reads: +424 validated
umi GGCTCTGTCA = 54 reads: +390 -1 +1 -2 +28 -1 +1 non-validated
umi GGCTGCTCGA = 232 reads: +400 -1 +1 -1 +1 -1 +3 -3X +2 -1 +10 invalidated
umi TCTCAATAAC = 304 reads: +424 validated
umi TTCAATCGGA = 290 reads: +424 validated

UMI info for barcode CTCTACGAGGACCACA-1 contig 2 = GGCTGGGGTC...
umi AAAATTCCAT = 222 reads: +385 validated
umi AACGGACCAT = 228 reads: +385 validated
umi ACACTAGAGT = 243 reads: +385 validated
umi ACACTATCTT = 639 reads: -351 +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi ACCATTCGTA = 2091 reads: -345X +1 -1XX +1 -3XX +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi ACGTACTCAG = 790 reads: -345X +1 -1XX +1 -3XX +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi ACTGCAGCAC = 509 reads: +385 validated
umi ACTTTCTCCG = 454 reads: -345X +1 -1X +1 -3XX +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi AGACAGGCCT = 248 reads: +385 validated
umi AGGGCTACCT = 155 reads: +385 validated
umi ATTCACTTTC = 270 reads: +385 validated
umi ATTTAAGGCT = 246 reads: +385 validated
umi ATTTTATGAG = 195 reads: +385 validated
umi CAAGCATACC = 286 reads: +385 validated
umi CAGCCCTCCA = 296 reads: +385 validated
umi CATAGATCCT = 233 reads: +385 validated
umi GAGTTGCGCT = 239 reads: +385 validated
umi GATTTTGGGT = 224 reads: +385 validated
umi GGGTCAACCA = 90 reads: -215 +170 non-validated
umi TATTTCCTGG = 269 reads: -259X +1 -4X +1 -2XX +1 -6XX +6 -5XX +3 -5XX +92 invalidated
umi TCAAGCGGCT = 226 reads: +385 validated
umi TGCTAGTCTG = 2025 reads: -345X +1 -1XX +1 -3XX +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi TGGGCCAGGT = 219 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=553]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=0)
433-483 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
495-553 ==> 13-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 92 reads
cdr3 = CARHKIYSGWSDAFDIW at 401, score = 8 + 8
umis assigned: [321, 553, 766, 768, 865, 972, 1020, 1039, 1130, 1133] and 2 others
of which 12 are surviving nonsolos
reads assigned: 1835
start codons at 59, 233, 257, 392, 435, 464
confident = true

TIG 2[bases=638]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-388 ==> 0-346 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=0)
389-427 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
427-638 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 17 umis using 700 reads
cdr3 = CCSYAGSFYVF at 366, score = 8 + 8
umis assigned: [8, 58, 140, 141, 177, 213, 242, 260, 266, 301] and 13 others
of which 23 are surviving nonsolos
reads assigned: 9911
start codons at 42, 181, 199, 243, 250, 253, 349, 376, 391, 559
confident = true

REJECT CONTIGS

TIG 1[bases=564]
0-63 ==> 5937-6000 on segment before IGKV2D-40 exon 1 [len=6000] (mis=2)
23-69 ==> 3411-3457 on segment before IGKV2OR2-2 exon 1 [len=3837] (mis=2)
30-390 ==> 0-360 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=7)
390-428 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [378, 961, 1449, 1586]
of which 4 are surviving nonsolos
reads assigned: 1209
start codons at 30, 63, 99, 187, 250, 349, 369, 470
confident = false
did not find CDR3
now this is a cell
paired!

GACACCGCCATGTATTACTGTGCGAGACATAAAATTTACAGTGGCTGGTCGGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> ATCTCTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCTGCTCATATGCAGGCAGCTTTTATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.715 = CTCTACGAGGAGTTTA-1

using 352 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 346]
surviving nonsolo ucounts = 1[346]
ids = [2]

====================================================================================

UMI info for barcode CTCTACGAGGAGTTTA-1 contig 1 = GAGCTACAAC...
umi CCAGTCACTA = 341 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=516]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
393-430 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
430-516 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYYSTRLTF at 369, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 332
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.725 = CTCTACGAGTGTACGG-1

using 9036 reads

====================================================================================

graph has 4561 edges initially, 88 edges after simplification

total ucounts = 764
nonsolo ucounts = 361[2^111, 3^67, 4^52, 5^39, 6^22, 7^14, 8^10, 9^4, 10^4, 11^3, 13, 14^2, 51, 58, 74, 92, 101, 111, 131, 139, 166, 188, 191, 202, 208, 209, 212, 234, 240, 242, 274, 275^2, 278, 280, 308, 310, 314, 318, 335, 346, 365, 371, 449]
surviving nonsolo ucounts = 31[58, 74, 92, 101, 111, 131, 139, 166, 188, 191, 202, 208, 209, 212, 234, 240, 242, 274, 275^2, 278, 280, 308, 310, 314, 318, 335, 346, 365, 371, 449]
ids = [188, 390, 369, 532, 152, 440, 405, 380, 176, 426, ...]

====================================================================================

UMI info for barcode CTCTACGAGTGTACGG-1 contig 1 = GGAGTCTCCC...
umi ACCCTGTATT = 194 reads: +421 validated
umi ATACTATGGG = 374 reads: +421 validated
umi ATCCGCAGGG = 102 reads: +421 validated
umi ATTGGAAGGG = 186 reads: +421 validated
umi CTTTGTCTTG = 93 reads: +331 -1 +3 -1 +85 non-validated
umi GACATGATTT = 163 reads: +421 validated
umi GAGGCACTAT = 217 reads: +421 validated
umi GCCGAATGAC = 277 reads: +421 validated
umi GCGAAACCCC = 183 reads: +421 validated
umi GCTTTGCATT = 293 reads: +421 validated
umi GGTTATGCGG = 317 reads: +404 -17 non-validated
umi TCCCTCTCGC = 274 reads: +421 validated
umi TCCTAGGGTT = 230 reads: +421 validated
umi TGGTGTACCA = 222 reads: +405 -1 +4 -11 non-validated

UMI info for barcode CTCTACGAGTGTACGG-1 contig 2 = AGAGCTCTGG...
umi ACGTTGTCAT = 315 reads: +385 validated
umi AGGAACCGGA = 450 reads: +385 validated
umi ATTAAGGGGT = 208 reads: +385 validated
umi CAAAGTTGGG = 60 reads: +8 -1 +376 non-validated
umi CCCCCCCGGT = 320 reads: +385 validated
umi CGAAAGCTAG = 214 reads: +385 validated
umi CGGCGCCTCA = 195 reads: +385 validated
umi CTTAGGATTC = 365 reads: +385 validated
umi GGACGATCCT = 347 reads: +385 validated
umi GTGGGTCGTG = 339 reads: +385 validated
umi TGAGGATGCA = 276 reads: +385 validated
umi TTGGCATATC = 275 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=551]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=2)
417-480 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=2)
480-551 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 9 umis using 153 reads
cdr3 = CARRYHDYYYYYMDVW at 401, score = 8 + 7
umis assigned: [69, 136, 152, 176, 369, 380, 389, 421, 426, 453] and 4 others
of which 14 are surviving nonsolos
reads assigned: 3072
start codons at 59, 233, 257, 392, 437
confident = true

TIG 2[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
390-429 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 12 umis using 528 reads
cdr3 = CQQYGSSLYTF at 368, score = 9 + 8
umis assigned: [81, 111, 168, 188, 255, 294, 315, 360, 456, 514] and 2 others
of which 12 are surviving nonsolos
reads assigned: 3310
start codons at 44, 252, 378, 471
confident = true

REJECT CONTIGS

TIG 1[bases=836]
0-19 ==> 1748-1767 on rc of segment before IGHD2-21 exon 1 [len=2489] (mis=0)
0-19 ==> 1780-1799 on rc of segment before IGHD2-21 exon 1 [len=2489] (mis=0)
0-19 ==> 1828-1847 on rc of segment before IGHD2-21 exon 1 [len=2489] (mis=0)
0-19 ==> 1893-1912 on rc of segment before IGHD2-21 exon 1 [len=2489] (mis=0)
0-19 ==> 1925-1944 on rc of segment before IGHD2-21 exon 1 [len=2489] (mis=0)
0-19 ==> 1989-2008 on rc of segment before IGHD2-21 exon 1 [len=2489] (mis=0)
0-19 ==> 2021-2040 on rc of segment before IGHD2-21 exon 1 [len=2489] (mis=0)
49-70 ==> 1768-1789 on rc of segment before IGHD2-21 exon 1 [len=2489] (mis=1)
49-70 ==> 1913-1934 on rc of segment before IGHD2-21 exon 1 [len=2489] (mis=1)
93-151 ==> 1878-1936 on rc of segment before IGHD2-21 exon 1 [len=2489] (mis=7)
93-151 ==> 1942-2000 on rc of segment before IGHD2-21 exon 1 [len=2489] (mis=5)
93-151 ==> 1974-2032 on rc of segment before IGHD2-21 exon 1 [len=2489] (mis=6)
171-206 ==> 1780-1815 on rc of segment before IGHD2-21 exon 1 [len=2489] (mis=0)
171-206 ==> 1925-1960 on rc of segment before IGHD2-21 exon 1 [len=2489] (mis=0)
195-263 ==> 2029-2097 on rc of segment before IGHD2-21 exon 1 [len=2489] (mis=4)
314-359 ==> 2149-2194 on rc of segment before IGHD2-21 exon 1 [len=2489] (mis=0)
360-652 ==> 2197-2489 on rc of segment before IGHD2-21 exon 1 [len=2489] (mis=23)
686-734 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
734-836 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [390, 440, 532]
of which 3 are surviving nonsolos
reads assigned: 297
start codons at 88, 287, 362, 365, 407, 413, 454, 752, 813
confident = false
did not find CDR3
now this is a cell
paired!

TCGGACACCGCCATGTATTACTGTGCGAGACGATACCACGACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACTCTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.729 = CTCTACGAGTTCCACA-1

using 69 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 13[2^2, 3^2, 4^2, 5, 6^2, 7, 8^2, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.732 = CTCTACGCAAAGCGGT-1

using 17003 reads

====================================================================================

graph has 7832 edges initially, 40 edges after simplification

total ucounts = 1148
nonsolo ucounts = 584[2^181, 3^114, 4^79, 5^53, 6^30, 7^21, 8^18, 9^11, 10^3, 11^3, 12^5, 13^5, 15, 16^3, 24, 29^2, 32, 45, 48, 65, 68, 86, 148, 172, 177, 197, 207, 215, 217, 219, 223^2, 231, 233, 235, 240, 243^2, 245, 247, 252, 254, 262, 266, 270^2, 276, 278, 279, 281, 282, 292, 299, 302, 307, 310^3, 311, 314, 316, 337, 340, 345, 362, 386, 397, 413, 585, 786]
surviving nonsolo ucounts = 51[65, 68, 86, 148, 172, 177, 197, 207, 215, 217, 219, 223^2, 231, 233, 235, 240, 243^2, 245, 247, 252, 254, 262, 266, 270^2, 276, 278, 279, 281, 282, 292, 299, 302, 307, 310^3, 311, 314, 316, 337, 340, 345, 362, 386, 397, 413, 585, 786]
ids = [965, 77, 1009, 146, 803, 661, 86, 197, 109, 1026, ...]

====================================================================================

UMI info for barcode CTCTACGCAAAGCGGT-1 contig 1 = ACTTTCTGAG...
umi ACTTCCCTAT = 238 reads: +442 validated
umi AGCACGACTC = 307 reads: -74X +1 -2X +365 invalidated
umi ATACAGGGCG = 311 reads: +442 validated
umi CTACTCTCTT = 361 reads: +442 validated
umi GATACTGTCT = 347 reads: +442 validated
umi TAAGCAGCCT = 231 reads: +442 validated
umi TCGTGTGATA = 384 reads: -85 +1 -6X +1 -2XX +2 -3XX +1 -15XX +1 -2XX +323 invalidated
umi TCTGGGTAAG = 64 reads: +403 -12 +27 non-validated
umi TGCTCATGCC = 88 reads: +441 -1 non-validated

UMI info for barcode CTCTACGCAAAGCGGT-1 contig 2 = GCTCTGCTTC...
umi AACAGGGTGA = 7 reads: -391 non-validated
umi AATAGGGATG = 299 reads: +391 validated
umi ACACTCTTGC = 196 reads: +391 validated
umi ACCAAGCTAT = 282 reads: +391 validated
umi ACCCGTATGG = 213 reads: +391 validated
umi ACGCTGGGCG = 268 reads: +391 validated
umi AGAAACCGCG = 149 reads: +391 validated
umi AGCTGGTTGT = 299 reads: +391 validated
umi AGGGTGACAC = 207 reads: +391 validated
umi AGGTTCCGAA = 307 reads: +391 validated
umi ATCGGAAGGA = 284 reads: +391 validated
umi ATGCACTCTG = 269 reads: +391 validated
umi CATAGATCTA = 275 reads: +391 validated
umi CCATATCAAC = 338 reads: +391 validated
umi CCCGGCAGTG = 275 reads: +391 validated
umi GACCTGGGAT = 247 reads: +391 validated
umi GAGAATTATT = 249 reads: +391 validated
umi GAGAGCTAGG = 221 reads: +391 validated
umi GAGATTCTTA = 219 reads: +391 validated
umi GAGTCGGGTC = 317 reads: +391 validated
umi GCCGTACCTT = 238 reads: +391 validated
umi GCGACCACAA = 312 reads: +391 validated
umi GCGCCAATGC = 438 reads: +120 -4XX +3 -2XX +1 -1XX +1 -4XX +2 -2XX +1 -1XX +1 -1XX +1 -96XX +1 -2XX +1 -2XX +2 -1XX +1 -4XX +136 invalidated
umi GCGGAAGATA = 177 reads: +391 validated
umi GCGGCTACCT = 331 reads: +391 validated
umi GGAGACTCGG = 244 reads: +391 validated
umi GTAGCAGATA = 217 reads: +391 validated
umi GTGCAACGGA = 499 reads: -359X +1 -2XX +2 -4XX +2 -4XX +1 -9XX +1 -4XX +1 -1XX invalidated
umi GTTCTTCATT = 270 reads: +391 validated
umi TAACCATTGG = 318 reads: +391 validated
umi TAATACTAGT = 171 reads: +391 validated
umi TACCCATCGT = 240 reads: +391 validated
umi TAGCTCCGGG = 276 reads: +391 validated
umi TCATGTGCGT = 256 reads: +391 validated
umi TCCAGTTGGA = 244 reads: +391 validated
umi TCTCCTCGGT = 264 reads: +391 validated
umi TGGGTTTCCG = 312 reads: +391 validated
umi TGGTTATGTA = 221 reads: +391 validated
umi TTAGCATGGT = 235 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=579]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-238 ==> 0-203 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=10)
435-477 ==> 19-61 on |58|IGHJ6|J-REGION| [len=61] (mis=2)
477-579 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 8 umis using 249 reads
cdr3 = CARVQSLKQGAISTTYYYNALDVW at 374, score = 8 + 7
umis assigned: [141, 174, 220, 491, 612, 799, 948, 965, 1009]
of which 9 are surviving nonsolos
reads assigned: 2284
start codons at 35, 79, 495, 556
confident = true

TIG 2[bases=653]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=20)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-653 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 37 umis using 1724 reads
cdr3 = CQCYDNSLTGWGF at 375, score = 8 + 8
umis assigned: [20, 57, 86, 102, 109, 122, 146, 186, 197, 202] and 29 others
of which 39 are surviving nonsolos
reads assigned: 9994
start codons at 51, 205, 358, 385, 521
confident = true
now this is a cell
paired!

GCGCGAGTCCAATCTCTGAAACAGGGAGCTATTTCCACTACCTACTACTACAACGCTCTGGACGTCTGGGGCGAAGGGACCACCGTCACCGTCTCCTCAG <==> GGACTCCAGGCTGAGGATGAGGCTGATTATTACTGCCAGTGTTATGACAACAGCCTGACTGGTTGGGGATTCGGCGGAGGGACCAAGCTGACCGTCCTAA

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.734 = CTCTACGCAACGATGG-1

using 284 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 4^2, 269]
surviving nonsolo ucounts = 1[269]
ids = [7]

====================================================================================

UMI info for barcode CTCTACGCAACGATGG-1 contig 1 = GATCAGGACT...
umi TCCTGCTACC = 264 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=510]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-356 ==> 0-326 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=11)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
427-510 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CMNTLPGGFTF at 366, score = 8 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.737 = CTCTACGCAATAACGA-1

using 8155 reads

====================================================================================

graph has 3511 edges initially, 52 edges after simplification

total ucounts = 375
nonsolo ucounts = 181[2^61, 3^28, 4^23, 5^10, 6^11, 7^6, 8^5, 9^2, 10, 11, 13, 16, 43, 55, 65, 93, 99, 108, 118, 120, 171, 173, 180, 191, 196, 203, 226, 227, 229, 244, 268, 284, 291^2, 292, 307, 313, 336, 342, 350, 366, 518, 698]
surviving nonsolo ucounts = 29[55, 65, 93, 99, 108, 120, 171, 173, 180, 191, 196, 203, 226, 227, 229, 244, 268, 284, 291^2, 292, 307, 313, 336, 342, 350, 366, 518, 698]
ids = [345, 74, 256, 28, 188, 295, 19, 182, 184, 320, ...]

====================================================================================

UMI info for barcode CTCTACGCAATAACGA-1 contig 1 = GGGGGCACCA...
umi ACGACGCTCT = 332 reads: +385 validated
umi ACTTTCGCCA = 101 reads: +385 validated
umi AGGTCCGTAG = 292 reads: +385 validated
umi CCATACGATG = 217 reads: +385 validated
umi CTGGATTCTC = 171 reads: +385 validated
umi GGATGTACCT = 362 reads: +385 validated
umi TCACTCCCAA = 288 reads: +385 validated
umi TCATATGTAC = 115 reads: +385 validated
umi TCTCTACAAA = 345 reads: +385 validated
umi TGATAAGGGA = 190 reads: +385 validated
umi TGCATATGAA = 286 reads: +385 validated
umi TGTTAGGCAT = 54 reads: +385 validated
umi TTGTTTACCA = 517 reads: +385 validated

UMI info for barcode CTCTACGCAATAACGA-1 contig 2 = GGAGCCCCAG...
umi ACGTAAGGTC = 167 reads: +406 validated
umi AGCCGCGCCA = 292 reads: +392 -1 +5 -1 +1 -1 +3 -2 non-validated
umi CACGTATGGC = 66 reads: +382 -24 non-validated
umi CATGATTTTC = 316 reads: +406 validated
umi CCACGCTTTT = 311 reads: +406 validated
umi CGAAGCATAA = 241 reads: +406 validated
umi CGTACTTTAC = 199 reads: +405 -1X invalidated
umi CTCTCCGTAC = 227 reads: +406 validated
umi CTGTTTTCGT = 180 reads: +396 -10 non-validated
umi CTTCAACTCT = 107 reads: +400 -6 non-validated
umi GCGACTCCTC = 205 reads: +406 validated
umi GCTTTAACCA = 343 reads: +391 -1 +14 non-validated
umi GTCACCTCCC = 264 reads: +406 validated
umi GTCTGTAGGC = 92 reads: +406 validated
umi TTCTTTTACC = 230 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=630]
0-34 ==> 0-34 on |387|IGLV7-46|5'UTR| [len=34] (mis=3)
34-385 ==> 0-351 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=16)
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
419-630 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 13 umis using 535 reads
cdr3 = CLLSYSDSWVF at 358, score = 8 + 8
umis assigned: [17, 28, 41, 101, 182, 235, 288, 295, 309, 320] and 3 others
of which 13 are surviving nonsolos
reads assigned: 3238
start codons at 34, 242, 341
confident = true

TIG 2[bases=545]
0-68 ==> 168-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=1)
68-421 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=19)
428-474 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=7)
474-545 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 11 umis using 190 reads
cdr3 = CATMVLPGDYW at 410, score = 8 + 7
umis assigned: [19, 33, 74, 88, 97, 135, 149, 174, 184, 188] and 5 others
of which 15 are surviving nonsolos
reads assigned: 3166
start codons at 68, 285, 371, 419
confident = true
now this is a cell
paired!

AACAGTCTGAGAGTCGAGGACACGGCTGTGTATTACTGTGCAACCATGGTTCTGCCCGGGGACTACTGGGGCCGGGGAACCCTGGTCACCGTATCCTCAG <==> CTTTCGGGTGCGCAGCCTGAGGATGAGGCTGAGTATTACTGCTTGCTCTCCTATAGTGATTCTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTCG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.743 = CTCTACGCACAACGCC-1

using 107 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[107]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.747 = CTCTACGCACCAGGCT-1

using 348 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^2, 3, 334]
surviving nonsolo ucounts = 1[334]
ids = [6]

====================================================================================

UMI info for barcode CTCTACGCACCAGGCT-1 contig 1 = GAATCAGTCC...
umi CCTTCATGAC = 334 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 332
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.751 = CTCTACGCACGGTTTA-1

using 455 reads

====================================================================================

graph has 208 edges initially, 6 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2^3, 3^2, 219, 220]
surviving nonsolo ucounts = 2[219, 220]
ids = [9, 8]

====================================================================================

UMI info for barcode CTCTACGCACGGTTTA-1 contig 1 = ACCCAAAAAC...
umi TCAGCTCCGC = 217 reads: +436 validated
umi TCGGCCCCCG = 210 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=531]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-531 ==> 0-41 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 38 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [8, 9]
of which 2 are surviving nonsolos
reads assigned: 422
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.763 = CTCTACGCAGCGTCCA-1

using 644 reads

====================================================================================

graph has 215 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[172, 470]
surviving nonsolo ucounts = 2[172, 470]
ids = [0, 2]

====================================================================================

UMI info for barcode CTCTACGCAGCGTCCA-1 contig 1 = GAGGAGTCAG...
umi CCTTGAATCG = 472 reads: +388 validated

UMI info for barcode CTCTACGCAGCGTCCA-1 contig 2 = GCTCTGCTTC...
umi AAACGACACG = 170 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=552]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQSYTTLLTF at 355, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 464
start codons at 28, 34, 90, 103, 458
confident = false

TIG 2[bases=577]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-577 ==> 0-132 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 165
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.770 = CTCTACGCAGGCTCAC-1

using 174 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 7, 8, 151]
surviving nonsolo ucounts = 1[151]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.772 = CTCTACGCAGTCACTA-1

using 212 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[211]
surviving nonsolo ucounts = 1[211]
ids = [1]

====================================================================================

UMI info for barcode CTCTACGCAGTCACTA-1 contig 1 = GAGCTCTGGG...
umi TGCAGTTGGT = 205 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=542]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=3)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=15)
459-510 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=1)
510-542 ==> 0-32 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARGAGYDFLSGHHWFDPW at 422, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 80, 236, 287, 294, 297, 315, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.780 = CTCTACGCATCATCCC-1

using 9 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.782 = CTCTACGCATCGTCGG-1

using 681 reads

====================================================================================

graph has 200 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^2, 181, 238, 256]
surviving nonsolo ucounts = 3[181, 238, 256]
ids = [0, 4, 6]

====================================================================================

UMI info for barcode CTCTACGCATCGTCGG-1 contig 1 = CAGTCTCAGT...
umi CAGATTGCTT = 181 reads: +385 validated

UMI info for barcode CTCTACGCATCGTCGG-1 contig 2 = CCACATCCCT...
umi TCATGTGGGT = 231 reads: +421 validated

UMI info for barcode CTCTACGCATCGTCGG-1 contig 3 = GGGGGGGGTC...
umi GTTCCTGACT = 238 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=542]
0-21 ==> 2-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
21-374 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
369-406 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
406-542 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQQSYSTLTF at 348, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 21, 27, 83, 96, 232, 448
confident = false

TIG 2[bases=472]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
42-395 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=1)
415-463 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
junction support: 1 umis using 20 reads
cdr3 = CARVPRIAAAYAFDYW at 384, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 42, 193, 198, 240, 245, 262, 339
confident = false

TIG 3[bases=545]
42-393 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=6)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
430-545 ==> 0-115 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CSSYTSSSTWVF at 366, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 42, 199, 243, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.785 = CTCTACGCATGAACCT-1

using 105 reads

====================================================================================

graph has 159 edges initially, 4 edges after simplification

total ucounts = 19
nonsolo ucounts = 18[2^7, 3^3, 4, 7^2, 8, 10, 11, 12, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.799 = CTCTACGGTAATCACC-1

using 328 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 4[2^2, 3, 312]
surviving nonsolo ucounts = 1[312]
ids = [5]

====================================================================================

UMI info for barcode CTCTACGGTAATCACC-1 contig 1 = GGGAGTCTCA...
umi GTAAACTAGC = 314 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=544]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQSYSTPSF at 350, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 23, 29, 85, 98, 234, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.819 = CTCTACGGTCGGCACT-1

using 269 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 8, 257]
surviving nonsolo ucounts = 1[257]
ids = [4]

====================================================================================

UMI info for barcode CTCTACGGTCGGCACT-1 contig 1 = AGTGCTTTCT...
umi TAGTAGCGGC = 241 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=476]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=2)
386-406 ==> 7-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=0)
413-459 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
junction support: 1 umis using 20 reads
cdr3 = CARYGSGSYYRTSPHYW at 377, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 17, 38, 82, 168, 387
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.822 = CTCTACGGTCTCTTTA-1

using 70 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[10, 53]
surviving nonsolo ucounts = 1[53]
ids = [8]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.831 = CTCTACGGTGCTCTTC-1

using 23 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.857 = CTCTACGGTTTGTTGG-1

using 251 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 3[2^2, 236]
surviving nonsolo ucounts = 1[236]
ids = [6]

====================================================================================

UMI info for barcode CTCTACGGTTTGTTGG-1 contig 1 = GTCAGTCTCA...
umi CTCTGCACTA = 228 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=494]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
408-494 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQSYSTPSF at 350, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 23, 29, 85, 98, 234, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.861 = CTCTACGTCAAAGTAG-1

using 535 reads

====================================================================================

graph has 254 edges initially, 24 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 260, 269]
surviving nonsolo ucounts = 2[260, 269]
ids = [1, 0]

====================================================================================

UMI info for barcode CTCTACGTCAAAGTAG-1 contig 1 = GTCAGACCCA...
umi AATCTGTGCT = 250 reads: +388 validated
umi ACTCAGTGGT = 74 reads: +48 -1XX +8 -1XX +7 -1XX +1 -1XX +24 -1XX +3 -1XX +7 -1XX +5 -1XX +17 -109 +5 -1XX +5 -1XX +14 -1XX +4 -2XX +29 -1XX +20 -1XX +2 -4XX +4 -1XX +3 -1XX +1 -1XX +1 -2XX +2 -1XX +2 -1XX +2 -2 +1 -1X +6 -1XX +4 -2XX +8 -2XX +4 -1XX +7 invalidated

GOOD CONTIGS

TIG 1[bases=501]
0-23 ==> 6-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
23-374 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=2)
373-411 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
411-501 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLQDYNYPFTF at 350, score = 9 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 317
start codons at 23, 29, 85, 98, 180, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.862 = CTCTACGTCAACACAC-1

using 439 reads

====================================================================================

graph has 294 edges initially, 54 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[3, 6, 187, 235]
surviving nonsolo ucounts = 2[187, 235]
ids = [8, 6]

====================================================================================

UMI info for barcode CTCTACGTCAACACAC-1 contig 1 = GGCTGGGGTC...
umi GGGCCTGTTA = 186 reads: +391 validated

UMI info for barcode CTCTACGTCAACACAC-1 contig 2 = GGGGTCTCAG...
umi CTCCGGGCCG = 237 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=567]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-384 ==> 0-342 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=7)
395-433 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
433-567 ==> 0-134 on |305|IGLC1|C-REGION| [len=317] (mis=4)
junction support: 1 umis using 29 reads
cdr3 = CCSYAGDYIFYVF at 366, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 42, 181, 199, 250, 253, 349, 376, 397
confident = false

TIG 2[bases=557]
0-38 ==> 3-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
38-383 ==> 0-345 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
385-423 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
423-557 ==> 0-134 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CSSYTSSFVVF at 362, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 38, 195, 239, 246
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.865 = CTCTACGTCAAGAAGT-1

using 469 reads

====================================================================================

graph has 158 edges initially, 6 edges after simplification

total ucounts = 17
nonsolo ucounts = 7[2^2, 3, 10, 96, 143, 203]
surviving nonsolo ucounts = 3[96, 143, 203]
ids = [2, 10, 11]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.878 = CTCTACGTCAGTACGT-1

using 316 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[2^3, 3, 4, 6, 292]
surviving nonsolo ucounts = 1[292]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.880 = CTCTACGTCAGTGCAT-1

using 473 reads

====================================================================================

graph has 146 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 213, 254]
surviving nonsolo ucounts = 2[213, 254]
ids = [3, 4]

====================================================================================

UMI info for barcode CTCTACGTCAGTGCAT-1 contig 1 = GGCTTTCTGA...
umi GGTGTTTCCG = 203 reads: +451 validated

UMI info for barcode CTCTACGTCAGTGCAT-1 contig 2 = AGAGCTGCTC...
umi TTCCAGCATG = 252 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=487]
15-386 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
418-466 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
466-487 ==> 0-21 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CARGSGILVIAIEDYYFDHW at 375, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 15, 36, 80, 166, 253
confident = false

TIG 2[bases=549]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-368 ==> 0-337 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=14)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYDRSWTF at 355, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 31, 365, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.881 = CTCTACGTCAGTTAGC-1

using 273 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[268]
surviving nonsolo ucounts = 1[268]
ids = [3]

====================================================================================

UMI info for barcode CTCTACGTCAGTTAGC-1 contig 1 = GTCAGACCCA...
umi GGGAGCTGTA = 269 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 24-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=9)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQANSFPLTF at 350, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 23, 29, 85, 98, 237, 255, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.884 = CTCTACGTCATTATCC-1

using 15956 reads

====================================================================================

graph has 10572 edges initially, 156 edges after simplification

total ucounts = 2228
nonsolo ucounts = 1139[2^407, 3^250, 4^151, 5^98, 6^60, 7^35, 8^28, 9^23, 10^9, 11^9, 12^4, 13^3, 14^2, 15^4, 16^4, 17, 19^2, 20, 21, 26^2, 32, 34, 50, 52, 54, 59, 89, 107, 151, 163, 164, 178, 181, 183, 189, 195, 197, 198, 200, 202^2, 207, 210, 213, 217^2, 219^2, 232, 234, 238^2, 240, 248, 254, 267, 272, 277^2, 279^2, 364, 680, 868, 967]
surviving nonsolo ucounts = 40[59, 89, 107, 151, 163, 164, 178, 181, 183, 189, 195, 197, 198, 200, 202^2, 207, 210, 213, 217^2, 219^2, 232, 234, 238^2, 240, 248, 254, 267, 272, 277^2, 279^2, 364, 680, 868, 967]
ids = [1981, 1332, 998, 309, 1303, 435, 1229, 333, 1769, 394, ...]

====================================================================================

UMI info for barcode CTCTACGTCATTATCC-1 contig 1 = AGCTCTGAGA...
umi AAGTAATTAC = 221 reads: +397 -24 non-validated
umi AGCAATTCAG = 209 reads: +19 -12X +1 -3XX +1 -1XX +1 -1XX +2 -3XX +1 -1XX +352 -1 +1 -1 +20 invalidated
umi AGCCGCTGCG = 166 reads: +421 validated
umi CACTCTAATT = 283 reads: +421 validated
umi CTCTGCTTCC = 280 reads: +421 validated
umi CTTCCTAATC = 238 reads: +406 -15 non-validated
umi GACTACGCGG = 276 reads: +391 -16 +14 non-validated
umi GATACTTCCC = 204 reads: +421 validated
umi GGCTTATCTC = 86 reads: +309 -16 +56 -40 non-validated
umi TCCTGAGCTA = 184 reads: +421 validated
umi TCGTACCGAT = 248 reads: +421 validated
umi TGTCGGACAC = 59 reads: +421 validated

UMI info for barcode CTCTACGTCATTATCC-1 contig 2 = GGGGTCACAA...
umi AAGATTCTTG = 196 reads: +388 validated
umi ACCTAACTGG = 216 reads: +388 validated
umi ACTATAGCCC = 179 reads: +388 validated
umi ACTTTGCGTC = 188 reads: +388 validated
umi AGTACTGATA = 235 reads: +388 validated
umi ATTAGCCCAT = 205 reads: +388 validated
umi CAGATATAAC = 219 reads: +388 validated
umi CCACGCATTG = 245 reads: +388 validated
umi CCGCTTTATT = 197 reads: +388 validated
umi CGAGCCTCGC = 203 reads: +388 validated
umi CGCCACCTCC = 203 reads: +255 -1XX +132 invalidated
umi GAAAGAATAC = 241 reads: +388 validated
umi GAAATTTCAG = 106 reads: +388 validated
umi GACGTATTGG = 677 reads: -272X +116 invalidated
umi GACTCCGCAC = 212 reads: +388 validated
umi GCTATCTTAC = 217 reads: +388 validated
umi GCTCAGATGT = 177 reads: +388 validated
umi GGCCCACATG = 162 reads: +388 validated
umi GTCACCGGTG = 255 reads: +388 validated
umi GTGCTCATAC = 202 reads: +388 validated
umi GTTGCACACT = 993 reads: +47 -4XX +1 -3XX +1 -3XX +1 -5XX +1 -251XX +1 -16XX +1 -2XX +51 invalidated
umi TAAACTACCC = 203 reads: +388 validated
umi TAGCTCCGGG = 278 reads: +388 validated
umi TCCACCCTGC = 888 reads: +47 -4XX +1 -3XX +1 -3XX +1 -5XX +1 -8XX +1 -242X +1 -16XX +1 -2XX +51 invalidated
umi TCGGCACGTG = 236 reads: +388 validated
umi TTAGCAATGT = 267 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=571]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=28)
449-500 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=3)
500-571 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 107 reads
cdr3 = CAKGKAAGIIDWFDPW at 421, score = 9 + 7
umis assigned: [125, 424, 435, 675, 951, 977, 1048, 1083, 1332, 1769] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2404
start codons at 79, 230, 382
confident = true

TIG 2[bases=637]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=18)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
426-637 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 23 umis using 781 reads
cdr3 = CCSYAGGSTWVF at 362, score = 8 + 8
umis assigned: [100, 271, 333, 394, 486, 596, 686, 718, 772, 831] and 16 others
of which 26 are surviving nonsolos
reads assigned: 7235
start codons at 38, 177, 246, 372
confident = true
now this is a cell
paired!

GAGGACACGGCCGTATATTACTGTGCGAAAGGGAAAGCAGCGGGTATTATTGACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGACGAGGCTGACTATTATTGTTGCTCCTATGCAGGTGGTTCCACTTGGGTGTTCGGCGGAGGGACCAAATTGACTGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.890 = CTCTACGTCCCACTTG-1

using 361 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[360]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.894 = CTCTACGTCCGAAGAG-1

using 102 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 99]
surviving nonsolo ucounts = 1[99]
ids = [0]

====================================================================================

UMI info for barcode CTCTACGTCCGAAGAG-1 contig 1 = CAGCTTCAGC...
umi ACATTGCCTT = 95 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=513]
0-47 ==> 9-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
47-398 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
435-513 ==> 0-78 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CAAWDDSLSGWVF at 368, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 94
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.897 = CTCTACGTCCGTAGGC-1

using 802 reads

====================================================================================

graph has 268 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2, 3, 7, 228, 254, 306]
surviving nonsolo ucounts = 3[228, 254, 306]
ids = [7, 6, 1]

====================================================================================

UMI info for barcode CTCTACGTCCGTAGGC-1 contig 1 = GCTCTGCTTC...
umi ATCCAGCTCT = 285 reads: +391 validated
umi GTACGACCCG = 238 reads: +391 validated
umi TTCGCGATTC = 213 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=610]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-610 ==> 0-168 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 123 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [1, 6, 7]
of which 3 are surviving nonsolos
reads assigned: 721
start codons at 51, 205, 208, 259, 358, 385
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.925 = CTCTACGTCTTTAGGG-1

using 303 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^3, 292]
surviving nonsolo ucounts = 1[292]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.927 = CTCTGGTAGAAACGAG-1

using 1086 reads

====================================================================================

graph has 434 edges initially, 6 edges after simplification

total ucounts = 20
nonsolo ucounts = 8[2^3, 4, 5^2, 250, 804]
surviving nonsolo ucounts = 2[250, 804]
ids = [2, 15]

====================================================================================

UMI info for barcode CTCTGGTAGAAACGAG-1 contig 1 = GGGGAGGAAC...
umi ACCGCATTTA = 247 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=560]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=11)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQHYNNWPPRYTF at 357, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 36, 108, 244, 466
confident = false

REJECT CONTIGS

TIG 1[bases=310]
0-142 ==> 211-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=8)
135-174 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
174-310 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQSYSTPSF at 116, score = 9 + 7
umis assigned: [15]
of which 1 are surviving nonsolos
reads assigned: 787
start codons at 0, 216
confident = false
not full
VJ delta = 17
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.947 = CTCTGGTAGCAATCTC-1

using 448 reads

====================================================================================

graph has 170 edges initially, 6 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[177, 267]
surviving nonsolo ucounts = 2[177, 267]
ids = [5, 2]

====================================================================================

UMI info for barcode CTCTGGTAGCAATCTC-1 contig 1 = TGGGGAGGAA...
umi CATATTCCTT = 36 reads: -317 +3 -1XX +1 -5XX +2 -2XX +1 -2XX +1 -1XX +2 -2XX +1 -1XX +1 -3XX +1 -2XX +2 -1XX +22 -1XX +2 -2XX +6 invalidated
umi TAGCCATCCA = 177 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=558]
0-37 ==> 60-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
37-382 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
384-422 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQQYNNWPPWTF at 358, score = 9 + 8
umis assigned: [2, 5]
of which 2 are surviving nonsolos
reads assigned: 209
start codons at 37, 106, 242, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.952 = CTCTGGTAGCCACGCT-1

using 2375 reads

====================================================================================

graph has 2702 edges initially, 30 edges after simplification

total ucounts = 882
nonsolo ucounts = 386[2^150, 3^87, 4^44, 5^36, 6^27, 7^14, 8^6, 9^6, 10^4, 11^3, 12^2, 13^2, 14, 15, 18, 155, 275]
surviving nonsolo ucounts = 2[155, 275]
ids = [20, 786]

====================================================================================

UMI info for barcode CTCTGGTAGCCACGCT-1 contig 1 = GCTCTGCTTC...
umi AACATGTTTG = 153 reads: +394 validated

UMI info for barcode CTCTGGTAGCCACGCT-1 contig 2 = GCAGGAGTCA...
umi TGGCCCTTGT = 271 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=599]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-599 ==> 0-154 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [20]
of which 1 are surviving nonsolos
reads assigned: 151
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false

TIG 2[bases=553]
0-29 ==> 18-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
29-380 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQSYRRPITF at 356, score = 8 + 8
umis assigned: [786]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 29, 35, 91, 104, 240, 339, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.955 = CTCTGGTAGCGAAGGG-1

using 20 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.956 = CTCTGGTAGCGATATA-1

using 139 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[132]
surviving nonsolo ucounts = 1[132]
ids = [2]

====================================================================================

UMI info for barcode CTCTGGTAGCGATATA-1 contig 1 = GAGTCTCCCT...
umi CATGGGTTCC = 130 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=531]
0-58 ==> 1-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
58-411 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=18)
426-479 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=1)
479-531 ==> 0-52 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CASASGHDYDWYFDLW at 400, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 130
start codons at 58, 232, 256, 391
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.960 = CTCTGGTAGCGTAATA-1

using 240 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2^2, 229]
surviving nonsolo ucounts = 1[229]
ids = [4]

====================================================================================

UMI info for barcode CTCTGGTAGCGTAATA-1 contig 1 = GCTCTGCTTC...
umi GTCAGTTCTA = 227 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=592]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=4)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
442-592 ==> 0-150 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQSYDSSLSALVF at 375, score = 8 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.966 = CTCTGGTAGCTACCGC-1

using 520 reads

====================================================================================

graph has 270 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[2^3, 3, 6, 226, 274]
surviving nonsolo ucounts = 2[226, 274]
ids = [5, 1]

====================================================================================

UMI info for barcode CTCTGGTAGCTACCGC-1 contig 1 = AGCTTCAGCT...
umi GCAGTTATCA = 226 reads: +388 validated

UMI info for barcode CTCTGGTAGCTACCGC-1 contig 2 = AGCTCTGAGA...
umi CATGTGTATT = 269 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=530]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-530 ==> 0-27 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.969 = CTCTGGTAGCTCCTTC-1

using 173 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 169]
surviving nonsolo ucounts = 1[169]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.975 = CTCTGGTAGCTTCGCG-1

using 38 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[38]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.978 = CTCTGGTAGGACATTA-1

using 326 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 317]
surviving nonsolo ucounts = 1[317]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.981 = CTCTGGTAGGCCATAG-1

using 6232 reads

====================================================================================

graph has 7051 edges initially, 158 edges after simplification

total ucounts = 1464
nonsolo ucounts = 984[2^233, 3^176, 4^118, 5^97, 6^78, 7^63, 8^38, 9^48, 10^21, 11^19, 12^24, 13^19, 14^15, 15^6, 16^14, 17^5, 18^3, 20, 21, 22, 44, 59, 83, 290]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=421]
0-174 ==> 2169-2343 on rc of segment before IGHD2-2 exon 1 [len=2436] (mis=2)
172-247 ==> 2361-2436 on rc of segment before IGHD2-2 exon 1 [len=2436] (mis=0)
308-350 ==> 21-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
350-421 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [1200]
of which 0 are surviving nonsolos
reads assigned: 286
start codons at 22, 28, 69
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.982 = CTCTGGTAGGCTCTTA-1

using 22 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 4, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.992 = CTCTGGTAGTCATCCA-1

using 15 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1017 = CTCTGGTCAAGTAATG-1

using 208 reads

====================================================================================

graph has 108 edges initially, 12 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[2^2, 3, 7^2, 10, 172]
surviving nonsolo ucounts = 2[7, 172]
ids = [5, 11]

====================================================================================

UMI info for barcode CTCTGGTCAAGTAATG-1 contig 1 = AGAGCTGCTC...
umi CTAGCTCTGT = 4 reads: -29 +23 -1X +3 -1X +2 -1X +2 -1X +2 -1X +3 -1X +15 -1X +10 -1X +47 -1X +4 -1X +1 -2X +4 -8X +1 -3X +1 -1X +2 -2X +1 -52X +5 -1X +7 -1X +30 -1X +11 -101 invalidated
umi TTGTGTAGTC = 155 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=493]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
416-493 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQHATSPFTF at 355, score = 9 + 8
umis assigned: [5, 11]
of which 2 are surviving nonsolos
reads assigned: 159
start codons at 31, 239, 365, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1027 = CTCTGGTCAATTGCTG-1

using 262 reads

====================================================================================

graph has 138 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2, 3, 4^2, 18, 224]
surviving nonsolo ucounts = 2[18, 224]
ids = [12, 3]

====================================================================================

UMI info for barcode CTCTGGTCAATTGCTG-1 contig 1 = AGTGCTTTCT...
umi AGCCAAACCC = 216 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=546]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
420-468 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
468-546 ==> 0-78 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARGSGILVIAIEDYYFDHW at 377, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 17, 38, 82, 168, 255, 522
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1053 = CTCTGGTCAGACACTT-1

using 189 reads

====================================================================================

graph has 266 edges initially, 4 edges after simplification

total ucounts = 158
nonsolo ucounts = 10[2^4, 3^3, 6, 8, 10]
surviving nonsolo ucounts = 6[2^4, 3, 10]
ids = [61, 78, 81, 147, 87, 72]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1055 = CTCTGGTCAGAGCCAA-1

using 320 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 10[2^4, 3^2, 4, 6, 11, 277]
surviving nonsolo ucounts = 1[277]
ids = [15]

====================================================================================

UMI info for barcode CTCTGGTCAGAGCCAA-1 contig 1 = TGGGGACCCA...
umi TGCTGCATCA = 282 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=548]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=5)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=21)
409-429 ==> 0-20 on |13|IGHD2-15|D-REGION| [len=31] (mis=3)
442-477 ==> 11-46 on |54|IGHJ4|J-REGION| [len=46] (mis=1)
477-548 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARTYCSGGTCYDGW at 401, score = 8 + 7
umis assigned: [15]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 59, 210, 257, 262, 279, 323, 356, 435, 438
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1056 = CTCTGGTCAGATCCAT-1

using 632 reads

====================================================================================

graph has 300 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[16, 610]
surviving nonsolo ucounts = 1[610]
ids = [2]

====================================================================================

UMI info for barcode CTCTGGTCAGATCCAT-1 contig 1 = GGAGTCAGAC...
umi CCGCCAGGTA = 615 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 21-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=25)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 100 reads
cdr3 = CQQGNSFPYTF at 353, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 598
start codons at 26, 32, 88, 101, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1066 = CTCTGGTCAGCTTCGG-1

using 455 reads

====================================================================================

graph has 150 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[4^2, 177, 266]
surviving nonsolo ucounts = 2[177, 266]
ids = [6, 0]

====================================================================================

UMI info for barcode CTCTGGTCAGCTTCGG-1 contig 1 = GAGAAGCGCT...
umi TCTGCGGTTC = 168 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=513]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=20)
385-423 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
423-513 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQQYGSSSPWTF at 359, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 35, 243, 369, 465
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1077 = CTCTGGTCATAAGACA-1

using 13610 reads

====================================================================================

graph has 10040 edges initially, 106 edges after simplification

total ucounts = 2234
nonsolo ucounts = 1224[2^416, 3^246, 4^178, 5^123, 6^78, 7^54, 8^27, 9^14, 10^10, 11^11, 12^15, 13^6, 14^4, 15^2, 16^2, 17^2, 19, 20, 28, 42, 47, 48^2, 61, 62, 68, 142, 177, 188, 189, 197, 215, 227, 242, 261, 264, 269, 292, 301, 306, 312, 313, 316, 318, 342, 349, 354, 356, 357, 368, 372, 414]
surviving nonsolo ucounts = 29[42, 47, 48, 61, 142, 177, 188, 189, 197, 227, 242, 261, 264, 269, 292, 301, 306, 312, 313, 316, 318, 342, 349, 354, 356, 357, 368, 372, 414]
ids = [1188, 684, 346, 1564, 793, 1195, 2085, 171, 1026, 1128, ...]

====================================================================================

UMI info for barcode CTCTGGTCATAAGACA-1 contig 1 = AGAGCTCTGG...
umi AGCAGGGTAT = 186 reads: +379 -1 +3 -1 +1 non-validated
umi ATGGACCAGA = 364 reads: +385 validated
umi CACCCGTTGT = 366 reads: +385 validated
umi CATTCCGATA = 303 reads: +385 validated
umi CCAGCCAGCT = 305 reads: +385 validated
umi CCGATCCCCC = 357 reads: +385 validated
umi CCGGCCTCGC = 344 reads: +385 validated
umi CCGTAATCTT = 417 reads: +385 validated
umi CGGTTACGAC = 269 reads: +385 validated
umi CTATAAGCTG = 321 reads: +385 validated
umi CTCGATATGT = 195 reads: +385 validated
umi CTTGCCTTCG = 223 reads: +385 validated
umi GAGCAGCTCC = 175 reads: +385 validated
umi GCACTATATG = 312 reads: +385 validated
umi GTGGTTTTAG = 368 reads: +385 validated
umi TAACCTTCAT = 22 reads: +6 -1 +3 -9XX +30 -1XX +1 -17XX +3 -6XX +3 -305XX invalidated
umi TACCTACAGT = 261 reads: +385 validated
umi TAGCGAGCAT = 311 reads: +385 validated
umi TCACCTCTAC = 269 reads: +385 validated
umi TCCTAAATGA = 354 reads: +385 validated
umi TCCTGTCTAT = 321 reads: +385 validated
umi TTACTAATTC = 300 reads: +385 validated
umi TTCCTATCAG = 190 reads: +385 validated
umi TTTCTGTACG = 358 reads: +385 validated

UMI info for barcode CTCTGGTCATAAGACA-1 contig 2 = AGCTCTCAGA...
umi CAATAACTCT = 45 reads: +293 -1 +74 -1 +13 -1 +24 -41 non-validated
umi CCCTTCCGGT = 47 reads: +429 -19 non-validated
umi CCTTGTTAGT = 143 reads: +429 -1 +18 non-validated
umi GAGAAATCGT = 2 reads: -415 +7 -1X +2 -1X +3 -2X +4 -1X +10 -1X +1 invalidated
umi GCCGTATGAG = 246 reads: +448 validated
umi TACTGTACCG = 2 reads: -433 +2 -1X +10 -1X +1 invalidated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=12)
390-429 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 22 umis using 1008 reads
cdr3 = CQQYGRSPYSF at 368, score = 9 + 7
umis assigned: [171, 278, 377, 513, 558, 699, 711, 715, 876, 960] and 14 others
of which 23 are surviving nonsolos
reads assigned: 6760
start codons at 44, 378, 471
confident = true

TIG 2[bases=596]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=13)
478-527 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
527-596 ==> 0-69 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 2 umis using 30 reads
cdr3 = CARHFDWSGYLVVVPAHPRYGMDVW at 421, score = 9 + 7
umis assigned: [346, 684, 793, 1188, 1261, 1564]
of which 6 are surviving nonsolos
reads assigned: 475
start codons at 79, 230, 235, 382, 484
confident = true
now this is a cell
paired!

AGACACTTCGATTGGAGTGGTTATTTAGTGGTGGTGCCTGCTCACCCTCGTTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTATATTACTGTCAGCAGTATGGTAGATCGCCCTACAGTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1080 = CTCTGGTCATACTCTT-1

using 203 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[7, 195]
surviving nonsolo ucounts = 1[195]
ids = [0]

====================================================================================

UMI info for barcode CTCTGGTCATACTCTT-1 contig 1 = GTGGGCTCAG...
umi AACCGGCACG = 193 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=508]
0-36 ==> 4-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
36-373 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=14)
377-415 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
415-508 ==> 0-93 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CHSRDSRGPWVF at 351, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 189
start codons at 36, 155, 235, 334
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1081 = CTCTGGTCATAGACTC-1

using 550 reads

====================================================================================

graph has 252 edges initially, 6 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[2^2, 3, 4, 79, 179, 276]
surviving nonsolo ucounts = 3[79, 179, 276]
ids = [3, 8, 4]

====================================================================================

UMI info for barcode CTCTGGTCATAGACTC-1 contig 1 = ACCCAAAAAC...
umi TCTCTACGTA = 171 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=546]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-546 ==> 0-56 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 54, 252, 257, 274, 318, 351
confident = false

REJECT CONTIGS

TIG 1[bases=488]
0-74 ==> 5666-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=11)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
411-488 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQNNSYAAPF at 350, score = 7 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 23, 29, 85, 98, 330, 369, 453
confident = false
not full
full length stopped transcript of length 488
frameshifted full length stopped transcript of length 488
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1082 = CTCTGGTCATATACCG-1

using 125 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[3^2, 7, 9, 22, 75]
surviving nonsolo ucounts = 1[75]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1090 = CTCTGGTCATCGGTTA-1

using 282 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 4, 5, 266]
surviving nonsolo ucounts = 1[266]
ids = [8]

====================================================================================

REJECT CONTIGS

TIG 1[bases=500]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-34 ==> 5703-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
33-289 ==> 0-256 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=9)
290-382 ==> 256-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=5) [SHIFT!]
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
419-500 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYGYSPRTF at 358, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 33, 241, 368, 461
confident = false
not full
frameshifted full length stopped transcript of length 500
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1095 = CTCTGGTCATGCCTTC-1

using 22 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[10, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1098 = CTCTGGTCATGTCCTC-1

using 23 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1104 = CTCTGGTGTAAGGATT-1

using 6569 reads

====================================================================================

graph has 6167 edges initially, 70 edges after simplification

total ucounts = 1850
nonsolo ucounts = 921[2^346, 3^234, 4^142, 5^64, 6^49, 7^35, 8^11, 9^11, 10^9, 11^2, 12^2, 13, 14, 17, 64, 65, 94, 99, 114, 128, 190, 193, 233, 241, 255, 281, 494]
surviving nonsolo ucounts = 12[2, 4, 64, 99, 114, 190, 193, 233, 241, 255, 281, 494]
ids = [562, 278, 1185, 1264, 729, 1782, 1499, 1442, 1447, 852, ...]

====================================================================================

UMI info for barcode CTCTGGTGTAAGGATT-1 contig 1 = GCTGGGGTCT...
umi CACATACGTG = 283 reads: +385 validated
umi CCTTTATTCT = 113 reads: +385 validated
umi CGGCATGTAT = 489 reads: +385 validated
umi GGTGAGTGTA = 64 reads: +385 validated
umi TCACGCTCTC = 239 reads: +385 validated
umi TCACTGAGGC = 238 reads: +385 validated
umi TCCCTTCATT = 193 reads: +385 validated
umi TTGGAAGCCA = 185 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=637]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-385 ==> 0-344 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=11)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
426-637 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 8 umis using 279 reads
cdr3 = CSSYAGSLVVF at 365, score = 8 + 8
umis assigned: [417, 729, 789, 1185, 1442, 1447, 1499, 1782]
of which 8 are surviving nonsolos
reads assigned: 1782
start codons at 41, 249, 348, 375
confident = true

REJECT CONTIGS

TIG 1[bases=471]
21-379 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=15)
422-471 ==> 0-49 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
cdr3 = CAHTFLGGYCSGDACSSGSDAFDIW at 366, score = 7 + 8
umis assigned: [852, 1264]
of which 2 are surviving nonsolos
reads assigned: 294
start codons at 21, 65, 244, 247, 250, 327, 336, 424, 453
confident = false
VJ delta = 12
not full
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1121 = CTCTGGTGTATTCTCT-1

using 231 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[3, 5, 94, 123]
surviving nonsolo ucounts = 2[94, 123]
ids = [4, 3]

====================================================================================

UMI info for barcode CTCTGGTGTATTCTCT-1 contig 1 = AGGAGTCAGA...
umi CTACCCTCAC = 125 reads: +388 validated
umi CTACCCTCGA = 96 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=9)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 27 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 215
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1135 = CTCTGGTGTCGCGGTT-1

using 214 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[209]
surviving nonsolo ucounts = 1[209]
ids = [3]

====================================================================================

UMI info for barcode CTCTGGTGTCGCGGTT-1 contig 1 = GAGAAGAGCT...
umi GATCGCCGTA = 204 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=509]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
385-423 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
423-509 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQQYGSSPPWTF at 359, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 35, 243, 369, 465
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1146 = CTCTGGTGTGAAGGCT-1

using 63 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 4^2, 46]
surviving nonsolo ucounts = 1[46]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1194 = CTCTGGTTCACGCATA-1

using 8 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1198 = CTCTGGTTCAGGCGAA-1

using 60 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 7[2^5, 5, 38]
surviving nonsolo ucounts = 1[38]
ids = [7]

====================================================================================

REJECT CONTIGS

TIG 1[bases=400]
0-339 ==> 9-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
337-376 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
376-400 ==> 0-24 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYGSSPHTF at 315, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 33
start codons at 199, 325
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1202 = CTCTGGTTCATCTGCC-1

using 38 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 29]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1209 = CTCTGGTTCCACGCAG-1

using 161 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[158]
surviving nonsolo ucounts = 1[158]
ids = [3]

====================================================================================

UMI info for barcode CTCTGGTTCCACGCAG-1 contig 1 = GAATCAGTCC...
umi GGGGGTAAAG = 147 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=487]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-487 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 144
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1215 = CTCTGGTTCCCGGATG-1

using 287 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 5[3^2, 4^2, 264]
surviving nonsolo ucounts = 1[264]
ids = [12]

====================================================================================

UMI info for barcode CTCTGGTTCCCGGATG-1 contig 1 = AGTCAGTCTC...
umi TTCTGTGTCC = 265 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
24-377 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQSYTTPWTF at 351, score = 9 + 8
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 24, 30, 99, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1228 = CTCTGGTTCCTTGACC-1

using 563 reads

====================================================================================

graph has 242 edges initially, 6 edges after simplification

total ucounts = 13
nonsolo ucounts = 10[3^2, 4^2, 5, 6, 8, 14, 220, 293]
surviving nonsolo ucounts = 2[220, 293]
ids = [3, 7]

====================================================================================

UMI info for barcode CTCTGGTTCCTTGACC-1 contig 1 = GAGTCAGACT...
umi CAGGACATGT = 189 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=454]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-364 ==> 0-339 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=5)
363-401 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
401-454 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYETF at 352, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 25, 31, 87, 100, 236, 239, 332, 362, 443
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1233 = CTCTGGTTCGATGAGG-1

using 506 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 215, 281]
surviving nonsolo ucounts = 2[215, 281]
ids = [7, 6]

====================================================================================

UMI info for barcode CTCTGGTTCGATGAGG-1 contig 1 = CGAGCCCAGC...
umi GAGAACTCCT = 270 reads: +415 validated
umi GGTGCCGGGA = 203 reads: +411 -1XX +3 invalidated

GOOD CONTIGS

TIG 1[bases=521]
0-67 ==> 0-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
67-420 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=2)
429-482 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=0)
482-521 ==> 0-39 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CASATRSYWYFDLW at 409, score = 9 + 7
umis assigned: [6, 7]
of which 2 are surviving nonsolos
reads assigned: 468
start codons at 67, 218, 223, 281, 284, 370, 500
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1239 = CTCTGGTTCGTCTGAA-1

using 618 reads

====================================================================================

graph has 248 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2^2, 5^2, 107, 182, 311]
surviving nonsolo ucounts = 3[107, 182, 311]
ids = [9, 7, 4]

====================================================================================

UMI info for barcode CTCTGGTTCGTCTGAA-1 contig 1 = AGCTTCAGCT...
umi CCTGCACTCA = 315 reads: +388 validated
umi GTCTATGTCG = 183 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 77 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [4, 7]
of which 2 are surviving nonsolos
reads assigned: 490
start codons at 47, 201, 351, 376, 381
confident = true

REJECT CONTIGS

TIG 1[bases=474]
0-63 ==> 5937-6000 on segment before IGLV3-10 exon 1 [len=6000] (mis=0)
48-144 ==> 11247-11343 on segment before IGLV3-6 exon 1 [len=11502] (mis=4)
98-445 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=0)
442-474 ==> 0-32 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 102
start codons at 98, 159, 228, 246, 297, 359, 396
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1243 = CTCTGGTTCTAACTGG-1

using 10976 reads

====================================================================================

graph has 5107 edges initially, 170 edges after simplification

total ucounts = 800
nonsolo ucounts = 537[2^114, 3^72, 4^59, 5^61, 6^50, 7^31, 8^31, 9^20, 10^19, 11^11, 12^8, 13^5, 14^5, 15^5, 16^6, 17^6, 18, 22, 23, 31, 88, 141, 142, 149, 156, 159, 187, 189, 191, 217, 229, 241, 250, 255, 269, 274, 281, 289, 299, 303, 321, 324, 325, 328, 354, 370, 372, 384, 390, 396]
surviving nonsolo ucounts = 29[88, 141, 142, 149, 156, 159, 187, 189, 191, 217, 229, 241, 250, 255, 269, 274, 281, 289, 299, 303, 321, 324, 328, 354, 370, 372, 384, 390, 396]
ids = [733, 4, 527, 292, 514, 509, 688, 80, 467, 264, ...]

====================================================================================

UMI info for barcode CTCTGGTTCTAACTGG-1 contig 1 = AGTGCTTTCT...
umi AAATGTCAAG = 1 reads: -402X +3 -1X +15 -2X +19 invalidated
umi ACCGATCATC = 284 reads: +442 validated
umi CCAATCTGGG = 217 reads: +442 validated
umi CCCGAACTTA = 368 reads: +442 validated
umi CCCGGTGTAT = 4 reads: -391 +1 -3XX +1 -1XX +1 -2XX +5 -3XX +13 -2XX +19 invalidated
umi CGATTTGCCA = 230 reads: +436 -1 +2 -1 +2 non-validated
umi CTCTATATTG = 243 reads: +442 validated
umi GACGGTTATA = 255 reads: +392 -1 +49 non-validated
umi GCGTCATTGC = 159 reads: +442 validated
umi GCTAGTGGGG = 161 reads: +442 validated
umi GCTTTCGAGG = 144 reads: -1 +441 non-validated
umi TCCTGAATAC = 186 reads: +442 validated
umi TGCGCGCCTG = 295 reads: +442 validated
umi TGCGTCGTAG = 88 reads: +427 -15 non-validated

UMI info for barcode CTCTGGTTCTAACTGG-1 contig 2 = GAAGAGCTGC...
umi ACCTTTGGTT = 193 reads: +385 validated
umi ACGTATGCTT = 307 reads: +385 validated
umi ACTATCCACT = 329 reads: -32X +353 invalidated
umi AGCTCAGGTA = 330 reads: +385 validated
umi CTCTATTCAT = 326 reads: +385 validated
umi GTACGTCATT = 246 reads: +385 validated
umi TACAACTATA = 271 reads: +385 validated
umi TATTTGGTAA = 379 reads: +385 validated
umi TCCAACGTAA = 367 reads: +385 validated
umi TCCCTATGCC = 272 reads: +385 validated
umi TTACAAATGT = 158 reads: +6 -1XX +49 -1XX +1 -1XX +1 -1XX +4 -1XX +3 -1XX +4 -1XX +10 -1XX +10 -2XX +6 -1XX +32 -1XX +9 -1XX +5 -2XX +1 -5XX +1 -3XX +1 -3XX +1 -1XX +1 -45 +1 -1XX +1 -1XX +12 -2XX +6 -1XX +8 -1XX +21 -1XX +10 -1XX +9 -1XX +3 -1XX +2 -1XX +6 -44X +2 -1X +6 -2XX +15 -1XX +7 invalidated

GOOD CONTIGS

TIG 1[bases=561]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=24)
411-459 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=7)
459-561 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 11 umis using 223 reads
cdr3 = CVRFGPNLSSWPTFDSW at 377, score = 9 + 6
umis assigned: [4, 62, 264, 286, 292, 344, 413, 457, 509, 514] and 4 others
of which 14 are surviving nonsolos
reads assigned: 2596
start codons at 17, 38, 82, 168, 477, 538
confident = true

TIG 2[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=23)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 500 reads
cdr3 = CHQYGSSPWTF at 357, score = 9 + 8
umis assigned: [80, 88, 95, 116, 414, 559, 609, 648, 669, 680] and 1 others
of which 10 are surviving nonsolos
reads assigned: 3118
start codons at 33, 241, 367, 460
confident = true
now this is a cell
paired!

GACACGGCTGTGTATTACTGTGTGAGATTTGGCCCCAATCTGAGCAGCTGGCCCACATTTGACTCCTGGGGCCAGGGAAATCTGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCGCTGTATTACTGTCACCAGTATGGTTCCTCACCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1249 = CTCTGGTTCTCAACTT-1

using 22 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1250 = CTCTGGTTCTCCCTGA-1

using 17 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1281 = CTGAAACAGCACCGTC-1

using 133 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 128]
surviving nonsolo ucounts = 1[128]
ids = [3]

====================================================================================

UMI info for barcode CTGAAACAGCACCGTC-1 contig 1 = AGGATTCAGG...
umi GCATCTGGGC = 126 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=464]
0-22 ==> 34-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
22-373 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=9)
372-410 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
410-464 ==> 0-54 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CAGWDDSLSGFVF at 343, score = 6 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 125
start codons at 22, 173, 176, 326, 351, 356
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1288 = CTGAAACAGCTAGTTC-1

using 762 reads

====================================================================================

graph has 726 edges initially, 8 edges after simplification

total ucounts = 189
nonsolo ucounts = 83[2^35, 3^15, 4^9, 5^6, 6^5, 7^2, 8, 9, 10, 13^2, 14^4, 28, 294]
surviving nonsolo ucounts = 1[294]
ids = [43]

====================================================================================

UMI info for barcode CTGAAACAGCTAGTTC-1 contig 1 = CAGGAGGCAG...
umi ATGAAGCGCG = 290 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=499]
31-382 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
419-499 ==> 0-80 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CSSYTSSSTVVF at 355, score = 8 + 8
umis assigned: [43]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 31, 188, 232, 239, 242
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1298 = CTGAAACAGTGGGATC-1

using 310 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[7, 301]
surviving nonsolo ucounts = 1[301]
ids = [2]

====================================================================================

UMI info for barcode CTGAAACAGTGGGATC-1 contig 1 = GTCAGACTCA...
umi TCATGTCTTT = 287 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=504]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-504 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYNSYPLTF at 350, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 285
start codons at 23, 29, 85, 98, 234, 237, 330, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1300 = CTGAAACAGTTCCACA-1

using 165 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[164]
surviving nonsolo ucounts = 1[164]
ids = [1]

====================================================================================

UMI info for barcode CTGAAACAGTTCCACA-1 contig 1 = GGGGAGGAAC...
umi CGCGTCGGCT = 145 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=512]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-512 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CLQYYNWPRTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 143
start codons at 36, 91, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1301 = CTGAAACCAACTGGCC-1

using 344 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[344]
surviving nonsolo ucounts = 1[344]
ids = [0]

====================================================================================

UMI info for barcode CTGAAACCAACTGGCC-1 contig 1 = AATCAGTCCC...
umi GACCAAGCCC = 348 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 3-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
24-375 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=6)
374-412 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQHKSYPFTF at 351, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 341
start codons at 24, 30, 99, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1302 = CTGAAACCAAGCGAGT-1

using 179 reads

====================================================================================

graph has 84 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 9[2, 4^3, 6, 8^2, 10, 131]
surviving nonsolo ucounts = 1[131]
ids = [4]

====================================================================================

UMI info for barcode CTGAAACCAAGCGAGT-1 contig 1 = AAAAACCACA...
umi TACTAAGTAC = 129 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=527]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-527 ==> 0-41 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 7 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 127
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1306 = CTGAAACCAATCCGAT-1

using 164 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[5, 155]
surviving nonsolo ucounts = 1[155]
ids = [5]

====================================================================================

UMI info for barcode CTGAAACCAATCCGAT-1 contig 1 = GAGTGCTCTC...
umi TTTCAGCCAA = 143 reads: +429 -2 +8 non-validated

GOOD CONTIGS

TIG 1[bases=463]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
411-457 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
junction support: 1 umis using 13 reads
cdr3 = CARGAARSGTVTLDYW at 378, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 139
start codons at 18, 39, 83, 169, 274
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1307 = CTGAAACCAATGGTCT-1

using 324 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 318]
surviving nonsolo ucounts = 1[318]
ids = [2]

====================================================================================

UMI info for barcode CTGAAACCAATGGTCT-1 contig 1 = TGATCAGGAC...
umi GACTACTCAA = 326 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=567]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
393-431 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
431-567 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=2)
junction support: 1 umis using 42 reads
cdr3 = CMQALQTPLFTF at 367, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 314
start codons at 31, 64, 100, 188, 350, 370, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1318 = CTGAAACCACGCTTTC-1

using 902 reads

====================================================================================

graph has 254 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[899]
surviving nonsolo ucounts = 1[899]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=410]
21-379 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=11)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 721
start codons at 21, 65, 244, 313, 327, 336
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1328 = CTGAAACCAGGTCTCG-1

using 286 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[283]
surviving nonsolo ucounts = 1[283]
ids = [2]

====================================================================================

UMI info for barcode CTGAAACCAGGTCTCG-1 contig 1 = GGAATCAGTC...
umi CTCAGACTAC = 283 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1342 = CTGAAACGTAGGCATG-1

using 11431 reads

====================================================================================

graph has 3913 edges initially, 32 edges after simplification

total ucounts = 401
nonsolo ucounts = 174[2^51, 3^26, 4^19, 5^16, 6^8, 7^3, 8^7, 9^2, 10^3, 11, 13^2, 15, 114, 168, 188, 203, 215, 221, 227, 228, 235, 238, 254, 265, 267, 273, 276, 278, 296^2, 306, 317, 318, 325, 326, 340, 350, 358, 359, 363, 368, 383, 398, 414, 453, 460, 563]
surviving nonsolo ucounts = 34[114, 168, 188, 203, 215, 221, 227, 228, 235, 238, 254, 265, 267, 273, 276, 278, 296, 306, 317, 318, 325, 326, 340, 350, 358, 359, 363, 368, 383, 398, 414, 453, 460, 563]
ids = [45, 375, 147, 102, 14, 48, 55, 264, 242, 180, ...]

====================================================================================

UMI info for barcode CTGAAACGTAGGCATG-1 contig 1 = GGGAGAGGAG...
umi AATATATCCG = 217 reads: +430 validated
umi AGGAATCCGT = 114 reads: +430 validated
umi CACATTCAGG = 205 reads: +430 validated
umi CGCTCTTTGT = 192 reads: +430 validated
umi CTCTTCGGCT = 566 reads: -84X +346 invalidated
umi TGACACCCGT = 317 reads: -398X +1 -20X +2 -1XX +1 -6XX +1 invalidated

UMI info for barcode CTGAAACGTAGGCATG-1 contig 2 = GGGGAGGAAC...
umi AAATTGACCA = 322 reads: +382 validated
umi AGGGCTGCAC = 218 reads: +382 validated
umi AGGTTTAGGC = 221 reads: +382 validated
umi ATTAACTCAG = 303 reads: +382 validated
umi ATTTAGCTGA = 405 reads: +382 validated
umi CATTTTGCAC = 362 reads: +382 validated
umi CGCCTTGTGT = 403 reads: +43 -2XX +2 -6XX +1 -2XX +326 invalidated
umi CGTTGGCGGG = 279 reads: +382 validated
umi CTATAAAGTA = 299 reads: +382 validated
umi CTCAAACTTT = 418 reads: +382 validated
umi CTCTGACCTG = 237 reads: +382 validated
umi CTGAGCCGGC = 278 reads: +382 validated
umi GAAACTCCGA = 367 reads: +382 validated
umi GCACCTCGCC = 309 reads: +382 validated
umi GGAAAACGCC = 359 reads: +382 validated
umi GGGATCGTCC = 235 reads: -139X +22 -3 +218 invalidated
umi GTGCCACTGT = 457 reads: +382 validated
umi GTGTAATCAG = 229 reads: +382 validated
umi GTTAGAATTC = 327 reads: +382 validated
umi TAACGTTACC = 276 reads: +104 -1XX +277 invalidated
umi TACGTCCGGT = 332 reads: +382 validated
umi TCGTTAGACT = 454 reads: +382 validated
umi TGAACATGTC = 277 reads: +382 validated
umi TGCACTTCTC = 267 reads: +382 validated
umi TGCCCAGGCA = 252 reads: +382 validated
umi TGTCAGCACA = 366 reads: +382 validated
umi TTACGATTCA = 325 reads: +382 validated
umi TTCAGTGTGT = 169 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=574]
0-73 ==> 7-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
73-424 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=6)
428-449 ==> 0-21 on |14|IGHD2-2|D-REGION| [len=31] (mis=1)
455-503 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
503-574 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 124 reads
cdr3 = CATLKGIVVVPDGYYFDYW at 415, score = 9 + 7
umis assigned: [14, 45, 102, 147, 181, 338]
of which 6 are surviving nonsolos
reads assigned: 1582
start codons at 73, 224, 229, 287, 290, 308, 376, 449
confident = true

TIG 2[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
380-418 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 28 umis using 1429 reads
cdr3 = CQQRSNWPITF at 357, score = 9 + 8
umis assigned: [4, 48, 55, 88, 92, 117, 146, 161, 170, 173] and 18 others
of which 28 are surviving nonsolos
reads assigned: 8594
start codons at 36, 241, 244, 460
confident = true
now this is a cell
paired!

GCTGTGTATTACTGTGCGACGCTTAAGGGTATTGTAGTAGTACCAGATGGATACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCCGATCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1360 = CTGAAACGTGTTTGGT-1

using 16 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1363 = CTGAAACGTTCCCGAG-1

using 42 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 33]
surviving nonsolo ucounts = 1[33]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1383 = CTGAAACTCGCGGATC-1

using 235 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 230]
surviving nonsolo ucounts = 1[230]
ids = [1]

====================================================================================

UMI info for barcode CTGAAACTCGCGGATC-1 contig 1 = AGCTTCAGCT...
umi GTCTATTACA = 225 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
434-494 ==> 0-60 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CAAWDDSLSGWVF at 367, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1389 = CTGAAACTCGTACGGC-1

using 306 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[305]
surviving nonsolo ucounts = 1[305]
ids = [0]

====================================================================================

UMI info for barcode CTGAAACTCGTACGGC-1 contig 1 = GAGCTGCTCA...
umi AAAAACACTC = 293 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=505]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-366 ==> 0-336 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
412-505 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 47 reads
cdr3 = CQQYRNSITF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 286
start codons at 30
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1390 = CTGAAACTCGTCCGTT-1

using 223 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 215]
surviving nonsolo ucounts = 1[215]
ids = [0]

====================================================================================

UMI info for barcode CTGAAACTCGTCCGTT-1 contig 1 = AAGCTCAGCT...
umi ACCACGTATC = 214 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=540]
0-52 ==> 4-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
52-403 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=3)
399-437 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
437-540 ==> 0-103 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CAAWDDSLSWVF at 373, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 52, 206, 356, 381, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1393 = CTGAAACTCGTTGACA-1

using 4247 reads

====================================================================================

graph has 3289 edges initially, 36 edges after simplification

total ucounts = 616
nonsolo ucounts = 297[2^128, 3^61, 4^34, 5^22, 6^10, 7^14, 8^5, 9^2, 10^3, 15, 28, 80, 90, 96, 115, 145, 152, 188, 190, 205, 214, 216, 223, 230, 247, 280, 282]
surviving nonsolo ucounts = 16[2, 28, 80, 90, 96, 115, 145, 188, 190, 205, 214, 216, 223, 230, 247, 282]
ids = [76, 332, 184, 159, 145, 149, 15, 361, 379, 602, ...]

====================================================================================

UMI info for barcode CTGAAACTCGTTGACA-1 contig 1 = AGCTCTGAGA...
umi AACTCACATC = 144 reads: +440 -1 +2 -23 non-validated
umi CACTGATCCG = 95 reads: +371 -1X +85 -9 invalidated
umi CAGGCAGCCT = 116 reads: +395 -51 +5 -1 +14 non-validated
umi CATGCCTCTT = 88 reads: +451 -15 non-validated
umi CCCATATCAT = 77 reads: +423 -43 non-validated
umi GCGTTTGACT = 189 reads: +434 -1 +18 -1 +11 -1 non-validated
umi TACCCAGGGC = 217 reads: +466 validated
umi TGCATAGTAT = 214 reads: +466 validated
umi TTGGGATTCT = 195 reads: +466 validated

UMI info for barcode CTGAAACTCGTTGACA-1 contig 2 = GTGGGCTCAG...
umi CACTGGGGAA = 254 reads: +379 validated
umi CAGTTGCGCC = 7 reads: -377X +2 invalidated
umi TTATCGCCAT = 218 reads: +379 validated
umi TTTTCGCTGC = 215 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=616]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=1)
459-490 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=1)
497-545 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
545-616 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 3 umis using 36 reads
cdr3 = CAKDLYTIIPAARNYYDSSGYYYSGFYFDYW at 421, score = 9 + 7
umis assigned: [15, 145, 149, 159, 184, 361, 452, 534, 602]
of which 9 are surviving nonsolos
reads assigned: 1315
start codons at 79, 230, 235, 382, 467
confident = true

TIG 2[bases=552]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=4)
376-414 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=5)
414-552 ==> 0-138 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 116 reads
cdr3 = CYSTDSSGNPSF at 350, score = 7 + 8
umis assigned: [146, 153, 567, 615]
of which 4 are surviving nonsolos
reads assigned: 670
start codons at 35, 96, 165, 183, 234, 296, 333, 546
confident = true
now this is a cell
paired!

ATACCCGCCGCGCGGAATTACTATGATAGTAGTGGTTATTACTACTCCGGCTTCTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGTGGGGCCCAGGTGGAGGATGAAGCTGACTACTACTGTTACTCAACAGACAGCAGTGGTAATCCCTCCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1395 = CTGAAACTCTAGCACA-1

using 319 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 7, 306]
surviving nonsolo ucounts = 1[306]
ids = [2]

====================================================================================

UMI info for barcode CTGAAACTCTAGCACA-1 contig 1 = TGGGGGAGGA...
umi CAACATCGGG = 293 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
33-384 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
421-494 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 360, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 286
start codons at 33, 39, 108, 244, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1399 = CTGAAACTCTGGTATG-1

using 352 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 344]
surviving nonsolo ucounts = 1[344]
ids = [4]

====================================================================================

UMI info for barcode CTGAAACTCTGGTATG-1 contig 1 = GTCAGACTCA...
umi TTCCGTTACT = 348 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYNGQSRAF at 350, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 343
start codons at 23, 29, 98, 234, 237, 330, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1403 = CTGAAGTAGAAGGGTA-1

using 874 reads

====================================================================================

graph has 376 edges initially, 8 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2, 7, 10, 218, 316, 317]
surviving nonsolo ucounts = 3[218, 316, 317]
ids = [5, 4, 2]

====================================================================================

UMI info for barcode CTGAAGTAGAAGGGTA-1 contig 1 = AGGAGTCAGA...
umi GACTAACGGA = 309 reads: +388 validated

UMI info for barcode CTGAAGTAGAAGGGTA-1 contig 2 = GAGAAGAGCT...
umi GTCAGTAACG = 201 reads: +385 validated

UMI info for barcode CTGAAGTAGAAGGGTA-1 contig 3 = ATCACATAAC...
umi CATCCGTATT = 312 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=503]
0-27 ==> 2-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
27-378 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=22)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
415-503 ==> 0-88 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CLQDHNYPFTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 27, 33, 89, 102, 184, 457
confident = false

TIG 2[bases=508]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=15)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
420-508 ==> 0-88 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQQYGSFPPTF at 359, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 35, 243, 246, 369, 462
confident = false

TIG 3[bases=517]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=1)
58-336 ==> 0-278 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=22)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
479-517 ==> 0-38 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CARDGGTEARQYSAYW at 400, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 16, 58, 209, 256, 278, 322, 355, 410
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1410 = CTGAAGTAGATAGGAG-1

using 1414 reads

====================================================================================

graph has 550 edges initially, 48 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[133, 203, 216, 346, 513]
surviving nonsolo ucounts = 5[133, 203, 216, 346, 513]
ids = [4, 0, 7, 1, 3]

====================================================================================

UMI info for barcode CTGAAGTAGATAGGAG-1 contig 1 = GCTCTGCTTC...
umi CGTTAGTCGC = 510 reads: +394 validated
umi CTTCTTGCAT = 129 reads: +394 validated

UMI info for barcode CTGAAGTAGATAGGAG-1 contig 2 = AGCTTCAGCT...
umi ACCCGGATTC = 198 reads: +388 validated
umi CAGACAGTCA = 347 reads: +388 validated
umi TTTTTGAACT = 219 reads: +350 -3XX +3 -1XX +31 invalidated

GOOD CONTIGS

TIG 1[bases=584]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=1)
407-445 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
445-584 ==> 0-139 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 104 reads
cdr3 = CQSYDSSLSGCVVF at 375, score = 8 + 8
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 621
start codons at 51, 205, 208, 259, 358, 385
confident = true

TIG 2[bases=573]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
434-573 ==> 0-139 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 75 reads
cdr3 = CAAWDDSLSGWVF at 367, score = 7 + 8
umis assigned: [0, 1, 7]
of which 3 are surviving nonsolos
reads assigned: 744
start codons at 46, 200, 350, 375, 380
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1413 = CTGAAGTAGCGAAGGG-1

using 61 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[61]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1415 = CTGAAGTAGCGGCTTC-1

using 14 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1422 = CTGAAGTAGGATGGAA-1

using 354 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 6[2^3, 3, 4, 333]
surviving nonsolo ucounts = 1[333]
ids = [1]

====================================================================================

UMI info for barcode CTGAAGTAGGATGGAA-1 contig 1 = GGAGAAGAGC...
umi CCAACGGCGG = 316 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=522]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
424-522 ==> 0-98 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYGSSPPYTF at 360, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 36, 244, 370, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1423 = CTGAAGTAGGCAATTA-1

using 5992 reads

====================================================================================

graph has 5510 edges initially, 135 edges after simplification

total ucounts = 1131
nonsolo ucounts = 879[2^145, 3^117, 4^104, 5^90, 6^74, 7^68, 8^50, 9^50, 10^37, 11^29, 12^20, 13^28, 14^18, 15^11, 16^11, 17^7, 18^4, 19^4, 20^4, 22^2, 24^2, 26, 29, 37, 45]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1425 = CTGAAGTAGGCAGTCA-1

using 391 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[390]
surviving nonsolo ucounts = 1[390]
ids = [1]

====================================================================================

UMI info for barcode CTGAAGTAGGCAGTCA-1 contig 1 = GGAGGAACTG...
umi TGATTGTATG = 367 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=500]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-500 ==> 0-87 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CQQRSNWLTF at 355, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 361
start codons at 34, 239, 242, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1427 = CTGAAGTAGGCGATAC-1

using 217 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3^2, 208]
surviving nonsolo ucounts = 1[208]
ids = [0]

====================================================================================

UMI info for barcode CTGAAGTAGGCGATAC-1 contig 1 = TGATCAGGAC...
umi AACACATTAC = 205 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=476]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
393-431 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
431-476 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CMQALQTPLFTF at 367, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 31, 64, 100, 188, 350, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1436 = CTGAAGTAGTTAAGTG-1

using 374 reads

====================================================================================

graph has 145 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 11[2^2, 3^3, 4, 5, 6, 7, 13, 323]
surviving nonsolo ucounts = 1[323]
ids = [6]

====================================================================================

UMI info for barcode CTGAAGTAGTTAAGTG-1 contig 1 = GAAGAGCTGC...
umi CCCTTGTTCC = 325 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYGSSPMYTF at 357, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 320
start codons at 33, 82, 241, 340, 381, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1447 = CTGAAGTCAATAAGCA-1

using 72 reads

====================================================================================

graph has 34 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 16, 48]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1459 = CTGAAGTCAGCAGTTT-1

using 135 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3, 4, 5, 120]
surviving nonsolo ucounts = 1[120]
ids = [6]

====================================================================================

UMI info for barcode CTGAAGTCAGCAGTTT-1 contig 1 = GAGGAATCAG...
umi TGTGAACTTT = 114 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=484]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=4)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
416-484 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CLQHNSNPLTF at 355, score = 9 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 112
start codons at 28, 34, 103, 185, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1461 = CTGAAGTCAGCCTTTC-1

using 826 reads

====================================================================================

graph has 240 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 237, 585]
surviving nonsolo ucounts = 2[237, 585]
ids = [3, 1]

====================================================================================

UMI info for barcode CTGAAGTCAGCCTTTC-1 contig 1 = GCTGTGGGTC...
umi GTAAACCACG = 579 reads: +382 validated
umi TTAATTATCA = 231 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=573]
0-38 ==> 5-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
38-375 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=1)
382-420 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
420-573 ==> 0-153 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 124 reads
cdr3 = CQSADSSGTYVVF at 353, score = 8 + 8
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 800
start codons at 38, 99, 168, 186, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1464 = CTGAAGTCAGGAATCG-1

using 655 reads

====================================================================================

graph has 228 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[267, 383]
surviving nonsolo ucounts = 2[267, 383]
ids = [5, 2]

====================================================================================

UMI info for barcode CTGAAGTCAGGAATCG-1 contig 1 = GGAGGAACTG...
umi CTTTATGGAC = 272 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=549]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQRSNWLTF at 355, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 34, 239, 242, 455
confident = false

REJECT CONTIGS

TIG 1[bases=521]
33-53 ==> 587-607 on segment after IGFBP2 exon 1 [len=6000] (mis=1)
39-59 ==> 5418-5438 on rc of segment before IGSF22 exon 23 [len=6000] (mis=1)
206-236 ==> 33-63 on segment before IGLV8-61 exon 1 [len=11825] (mis=2)
265-285 ==> 0-20 on segment before IGLV1-47 exon 1 [len=4359] (mis=2)
324-362 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
362-521 ==> 0-159 on |305|IGLC1|C-REGION| [len=317] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 345
start codons at 61, 122, 125, 176, 275, 302, 326, 494
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1468 = CTGAAGTCATACCATG-1

using 15 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1473 = CTGAAGTCATTAGGCT-1

using 225 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 4[2, 3, 4, 203]
surviving nonsolo ucounts = 1[203]
ids = [0]

====================================================================================

UMI info for barcode CTGAAGTCATTAGGCT-1 contig 1 = GTCAGTCTCA...
umi AATCAAGACA = 200 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=13)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQTYSTLVTF at 350, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1477 = CTGAAGTGTAGAGGAA-1

using 302 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 6, 291]
surviving nonsolo ucounts = 1[291]
ids = [1]

====================================================================================

UMI info for barcode CTGAAGTGTAGAGGAA-1 contig 1 = GGGGAGGAAC...
umi CCTTTCTATG = 292 reads: +265 -1XX +1 -1XX +120 invalidated
umi GGTTTTACTG = 6 reads: -139X +1 -3X +1 -6X +1 -1X +7 -1X +1 -1X +8 -1X +23 -37 +7 -2X +3 -1 +6 -1 +39 -1X +2 -1X +20 -1X +2 -1 +12 -2X +1 -3X +1 -1X +2 -2X +3 -2X +1 -20X +7 -1X +12 invalidated

GOOD CONTIGS

TIG 1[bases=464]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=19)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
424-464 ==> 0-40 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQRYNWPREYTF at 357, score = 9 + 8
umis assigned: [1, 3]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 36, 241
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1488 = CTGAAGTGTCTAGCGC-1

using 241 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 236]
surviving nonsolo ucounts = 1[236]
ids = [1]

====================================================================================

UMI info for barcode CTGAAGTGTCTAGCGC-1 contig 1 = CTGGGCCTAA...
umi GAATCGCCTG = 229 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=588]
0-37 ==> 214-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
37-380 ==> 0-343 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=10)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
419-588 ==> 0-169 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQVWDSSSDLVVF at 352, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 37, 98, 239, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1490 = CTGAAGTGTCTCTCTG-1

using 735 reads

====================================================================================

graph has 214 edges initially, 12 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[344, 387]
surviving nonsolo ucounts = 2[344, 387]
ids = [4, 0]

====================================================================================

UMI info for barcode CTGAAGTGTCTCTCTG-1 contig 1 = GGAGTCAGTC...
umi ATGATAGCTG = 385 reads: +388 validated

UMI info for barcode CTGAAGTGTCTCTCTG-1 contig 2 = GGGAGGAACT...
umi GTTCTTACCT = 340 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=550]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 66 reads
cdr3 = CQQSYTTLLTF at 353, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 382
start codons at 26, 32, 88, 101, 237, 456
confident = false

TIG 2[bases=547]
0-35 ==> 12-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
35-380 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CQQRSNWPL at 356, score = 9 + 6
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 338
start codons at 35, 240, 243, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1498 = CTGAAGTTCAAAGACA-1

using 335 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 21
nonsolo ucounts = 10[2^2, 3^3, 4^3, 5, 294]
surviving nonsolo ucounts = 1[294]
ids = [6]

====================================================================================

UMI info for barcode CTGAAGTTCAAAGACA-1 contig 1 = AGCTTCAGCT...
umi CATAGACCCG = 292 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=500]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-500 ==> 0-65 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1505 = CTGAAGTTCAGCATGT-1

using 371 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 364]
surviving nonsolo ucounts = 1[364]
ids = [1]

====================================================================================

UMI info for barcode CTGAAGTTCAGCATGT-1 contig 1 = GAAGAGCTGC...
umi CCGATGACGG = 353 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=497]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=8)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-497 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQQYGSSPGTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 350
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1517 = CTGAAGTTCGCCCTTA-1

using 275 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 269]
surviving nonsolo ucounts = 1[269]
ids = [2]

====================================================================================

UMI info for barcode CTGAAGTTCGCCCTTA-1 contig 1 = GCTCTGCTTC...
umi TCACCGGCTT = 265 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=572]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-384 ==> 0-333 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=11)
404-442 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
442-572 ==> 0-130 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQSNANNLDGFVF at 375, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 51, 175, 205, 208, 358, 385, 400
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1522 = CTGAAGTTCGGTGTCG-1

using 189 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[189]
surviving nonsolo ucounts = 1[189]
ids = [0]

====================================================================================

UMI info for barcode CTGAAGTTCGGTGTCG-1 contig 1 = GGGGAGGAAC...
umi ATACTCACCG = 175 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=503]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-503 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CLQYYNWPRTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 172
start codons at 36, 91, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1536 = CTGATAGAGAGAGCTC-1

using 413 reads

====================================================================================

graph has 132 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[134, 274]
surviving nonsolo ucounts = 2[134, 274]
ids = [2, 0]

====================================================================================

UMI info for barcode CTGATAGAGAGAGCTC-1 contig 1 = ATCAGTCCCA...
umi AGACAGAATG = 273 reads: +388 validated

UMI info for barcode CTGATAGAGAGAGCTC-1 contig 2 = AGTGACTCCT...
umi ATAATCTAGA = 113 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 23, 29, 98, 234, 453
confident = false

TIG 2[bases=465]
0-20 ==> 4-24 on |93|IGHV2-26|5'UTR| [len=24] (mis=0)
20-370 ==> 0-350 on |94|IGHV2-26|L-REGION+V-REGION| [len=357] (mis=24)
387-438 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
438-465 ==> 0-27 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CASAAAPGDWFDPW at 365, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 112
start codons at 20, 176, 243, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1545 = CTGATAGAGGAGTCTG-1

using 412 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 3^2, 4, 395]
surviving nonsolo ucounts = 1[395]
ids = [1]

====================================================================================

UMI info for barcode CTGATAGAGGAGTCTG-1 contig 1 = GGAGAAGAGC...
umi AGCTTTCGGT = 376 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=510]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
386-424 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
424-510 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYGSSPGWTF at 360, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 370
start codons at 36, 244, 370, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1547 = CTGATAGAGGCACATG-1

using 335 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3, 7, 9, 313]
surviving nonsolo ucounts = 1[313]
ids = [0]

====================================================================================

UMI info for barcode CTGATAGAGGCACATG-1 contig 1 = GGGGGCTTTC...
umi ACAATGACTC = 303 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=576]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
421-469 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
469-576 ==> 0-107 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CARGSGILVIAIEDYYFDHW at 378, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 18, 39, 83, 169, 256, 523
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1551 = CTGATAGAGTCCATAC-1

using 228 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 221]
surviving nonsolo ucounts = 1[221]
ids = [0]

====================================================================================

UMI info for barcode CTGATAGAGTCCATAC-1 contig 1 = AGCTTCAGCT...
umi CGAGTCGCCG = 215 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=508]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-508 ==> 0-73 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1552 = CTGATAGAGTGCCAGA-1

using 400 reads

====================================================================================

graph has 148 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[6, 15, 118, 259]
surviving nonsolo ucounts = 2[118, 259]
ids = [1, 2]

====================================================================================

UMI info for barcode CTGATAGAGTGCCAGA-1 contig 1 = TGTGGGTAGA...
umi ACAGTACTGA = 108 reads: +388 validated

UMI info for barcode CTGATAGAGTGCCAGA-1 contig 2 = GGGGCTCAGC...
umi GCAGCGGGTC = 254 reads: +388 validated
umi GTGACTATAC = 1 reads: -260 +3 -1X +11 -1X +20 -1X +5 -2X +4 -1X +3 -1X +3 -72 invalidated

GOOD CONTIGS

TIG 1[bases=497]
0-38 ==> 76-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
38-391 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=23)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
426-497 ==> 0-71 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CATWDDSLLGRVF at 359, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 107
start codons at 38, 249, 342, 367, 372
confident = false

TIG 2[bases=567]
126-477 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
476-514 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
514-567 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQQSYRRPITF at 453, score = 8 + 8
umis assigned: [2, 3]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 17, 38, 77, 126, 132, 188, 201, 337, 436, 556
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1556 = CTGATAGAGTTCGCAT-1

using 809 reads

====================================================================================

graph has 1234 edges initially, 8 edges after simplification

total ucounts = 386
nonsolo ucounts = 177[2^85, 3^43, 4^16, 5^12, 6^7, 7^5, 8^4, 9, 11, 13, 16, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1557 = CTGATAGCAAACTGTC-1

using 917 reads

====================================================================================

graph has 342 edges initially, 6 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[158, 235, 256, 261]
surviving nonsolo ucounts = 4[158, 235, 256, 261]
ids = [3, 7, 0, 6]

====================================================================================

UMI info for barcode CTGATAGCAAACTGTC-1 contig 1 = GGAGGAATCA...
umi ATATCTTTCG = 163 reads: +193 -1XX +194 invalidated
umi CTCCCGCTCC = 262 reads: +388 validated

UMI info for barcode CTGATAGCAAACTGTC-1 contig 2 = GGGAGGCCCA...
umi AGATGTTGTT = 250 reads: +388 validated

UMI info for barcode CTGATAGCAAACTGTC-1 contig 3 = TGGGGACCCA...
umi CTCGTGGTGC = 234 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=553]
29-380 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 67 reads
cdr3 = CLQYSSSPWTF at 356, score = 9 + 8
umis assigned: [3, 6]
of which 2 are surviving nonsolos
reads assigned: 412
start codons at 29, 35, 104, 240, 459
confident = true

TIG 2[bases=549]
53-392 ==> 0-339 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=13)
403-441 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
441-549 ==> 0-108 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CSSYTASSSWVF at 377, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 53, 261, 264
confident = true

TIG 3[bases=571]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=6)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
461-495 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
495-571 ==> 0-76 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 401, score = 7 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 59, 257, 262, 279, 323, 356, 549
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1568 = CTGATAGCACCACGTG-1

using 22 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1571 = CTGATAGCACTGCCAG-1

using 210 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[7, 202]
surviving nonsolo ucounts = 1[202]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=379]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-31 ==> 5706-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 158
start codons at 30, 238, 364
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1574 = CTGATAGCAGACGTAG-1

using 504 reads

====================================================================================

graph has 208 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 4, 497]
surviving nonsolo ucounts = 1[497]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=403]
28-150 ==> 231-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=5)
174-221 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
221-403 ==> 0-182 on |43|IGHG2|C-REGION| [len=977] (mis=1)
cdr3 = CARDRAATARLGGMDVW at 139, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 495
start codons at 100, 178
confident = false
VJ delta = 23
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1577 = CTGATAGCAGCGAACA-1

using 609 reads

====================================================================================

graph has 268 edges initially, 36 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 224, 380]
surviving nonsolo ucounts = 2[224, 380]
ids = [3, 2]

====================================================================================

UMI info for barcode CTGATAGCAGCGAACA-1 contig 1 = ACAAGAGGCA...
umi TTCAACCTTG = 237 reads: +242 -1XX +151 invalidated

UMI info for barcode CTGATAGCAGCGAACA-1 contig 2 = GCTCTGCTTC...
umi TCACCCCGGT = 381 reads: +117 -1XX +13 -1XX +2 -1XX +259 invalidated

GOOD CONTIGS

TIG 1[bases=636]
0-31 ==> 20-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
31-387 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=7)
387-425 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
425-636 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=4)
junction support: 1 umis using 39 reads
cdr3 = CQSYDSSLSGRWVF at 355, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 31, 185, 188, 239, 338, 365, 557
confident = false

TIG 2[bases=656]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=9)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-656 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=3)
junction support: 1 umis using 64 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 375
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1578 = CTGATAGCAGCTATTG-1

using 253 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[252]
surviving nonsolo ucounts = 1[252]
ids = [0]

====================================================================================

UMI info for barcode CTGATAGCAGCTATTG-1 contig 1 = AATCAGTCCC...
umi AGCCATCCCC = 234 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=487]
0-24 ==> 3-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
24-375 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=1)
374-412 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
412-487 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQHNSYPPTF at 351, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 24, 30, 99, 181, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1582 = CTGATAGCAGGAATCG-1

using 432 reads

====================================================================================

graph has 188 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 93, 331]
surviving nonsolo ucounts = 2[93, 331]
ids = [3, 0]

====================================================================================

UMI info for barcode CTGATAGCAGGAATCG-1 contig 1 = GAGTCAGACC...
umi AAATAAGGCG = 332 reads: +388 validated
umi GATGCTCGTC = 13 reads: -266 +8 -2XX +27 -1XX +4 -1XX +3 -1XX +1 -1XX +3 -2XX +9 -1X +5 -1X +3 -49 invalidated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQYHVYSITF at 352, score = 8 + 8
umis assigned: [0, 3]
of which 2 are surviving nonsolos
reads assigned: 339
start codons at 25, 31, 87, 100, 332, 365, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1584 = CTGATAGCAGTACACT-1

using 142 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[4, 45, 87]
surviving nonsolo ucounts = 1[45]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=316]
0-284 ==> 61-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=11)
283-316 ==> 0-33 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 32
start codons at 8, 144
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1592 = CTGATAGCATTGCGGC-1

using 94 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2, 4, 5^2, 8, 11, 55]
surviving nonsolo ucounts = 1[55]
ids = [9]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1595 = CTGATAGGTACAAGTA-1

using 341 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 9, 327]
surviving nonsolo ucounts = 1[327]
ids = [0]

====================================================================================

UMI info for barcode CTGATAGGTACAAGTA-1 contig 1 = CTCAGGAAGC...
umi CCCTAATTCC = 312 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=512]
0-31 ==> 55-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
31-384 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=11)
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
419-512 ==> 0-93 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 70 reads
cdr3 = CQSYDISIWVF at 358, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 31, 94, 185, 236, 242, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1602 = CTGATAGGTCAAAGAT-1

using 364 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[5, 359]
surviving nonsolo ucounts = 1[359]
ids = [0]

====================================================================================

UMI info for barcode CTGATAGGTCAAAGAT-1 contig 1 = GGGGAGGACT...
umi AACCACAGGC = 348 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=473]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=3)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
396-433 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
433-473 ==> 0-40 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CMQALQSPRGLTF at 366, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 340
start codons at 30, 63, 99, 187, 349, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1607 = CTGATAGGTCTAGTGT-1

using 50 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 41]
surviving nonsolo ucounts = 1[41]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1610 = CTGATAGGTGAAGGCT-1

using 383 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[382]
surviving nonsolo ucounts = 1[382]
ids = [0]

====================================================================================

UMI info for barcode CTGATAGGTGAAGGCT-1 contig 1 = AGAGCTGCTC...
umi GAAGCGCTCC = 388 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=23)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYGGSITF at 355, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 380
start codons at 31, 239, 365, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1611 = CTGATAGGTGAGGGTT-1

using 148 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[146]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1612 = CTGATAGGTGGAAAGA-1

using 146 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[143]
surviving nonsolo ucounts = 1[143]
ids = [1]

====================================================================================

UMI info for barcode CTGATAGGTGGAAAGA-1 contig 1 = AAAACCACAC...
umi CCTTTAGTAG = 138 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=496]
0-49 ==> 10-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
49-402 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
451-485 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 391, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 134
start codons at 49, 247, 252, 269, 313, 346
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1614 = CTGATAGGTGTGGTTT-1

using 68 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 11[2^3, 3^3, 6, 8, 11^2, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1620 = CTGATAGGTTCCCTTG-1

using 353 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[352]
surviving nonsolo ucounts = 1[352]
ids = [1]

====================================================================================

UMI info for barcode CTGATAGGTTCCCTTG-1 contig 1 = GAGCTACAAC...
umi TTATATTCCT = 331 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=498]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-498 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 329
start codons at 27, 30, 85, 99, 352, 382, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1624 = CTGATAGGTTTGACAC-1

using 314 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 3, 4^2, 298]
surviving nonsolo ucounts = 1[298]
ids = [1]

====================================================================================

UMI info for barcode CTGATAGGTTTGACAC-1 contig 1 = AGCTTCAGCT...
umi CTGATACTGC = 289 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=559]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-355 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-559 ==> 0-124 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CVAWDDSLYAWVF at 368, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 286
start codons at 47, 351, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1627 = CTGATAGTCACAACGT-1

using 312 reads

====================================================================================

graph has 143 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[310]
surviving nonsolo ucounts = 1[310]
ids = [1]

====================================================================================

UMI info for barcode CTGATAGTCACAACGT-1 contig 1 = CTGGGCCTCA...
umi GGAAAACACC = 299 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=546]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-377 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
413-546 ==> 0-133 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQAWDSSTVVF at 352, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 294
start codons at 37, 42, 98, 185, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1628 = CTGATAGTCACATACG-1

using 611 reads

====================================================================================

graph has 224 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3, 7, 169, 430]
surviving nonsolo ucounts = 2[169, 430]
ids = [2, 0]

====================================================================================

UMI info for barcode CTGATAGTCACATACG-1 contig 1 = CTCAGGAGGC...
umi CCTTTGGTGC = 166 reads: +388 validated

UMI info for barcode CTGATAGTCACATACG-1 contig 2 = GGGTGCTTTC...
umi CATGCGTTGC = 432 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=516]
33-394 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
383-421 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
421-516 ==> 0-95 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CSSYTSSSTLVF at 357, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 166
start codons at 33, 190, 234, 241, 244
confident = false

TIG 2[bases=537]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
418-466 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
466-537 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CARGPGIAAAAPLWGFDYW at 378, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 423
start codons at 18, 39, 83, 169
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1630 = CTGATAGTCATCGCTC-1

using 127 reads

====================================================================================

graph has 216 edges initially, 2 edges after simplification

total ucounts = 67
nonsolo ucounts = 25[2^13, 3^6, 4, 5, 6, 7^2, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1632 = CTGATAGTCATTGCGA-1

using 491 reads

====================================================================================

graph has 224 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[237, 250]
surviving nonsolo ucounts = 2[237, 250]
ids = [4, 3]

====================================================================================

UMI info for barcode CTGATAGTCATTGCGA-1 contig 1 = GAGCTGCTCA...
umi CCAGGATCGG = 246 reads: +385 validated

UMI info for barcode CTGATAGTCATTGCGA-1 contig 2 = GCTGTGGGTC...
umi CGCAGATTTG = 227 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=495]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=18)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-495 ==> 0-80 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYGTSPGTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 30, 238, 364, 457
confident = false

TIG 2[bases=528]
0-38 ==> 5-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
38-375 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=1)
379-417 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
417-528 ==> 0-111 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQSADSSGTYAF at 353, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 38, 99, 168, 186, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1633 = CTGATAGTCCAAACTG-1

using 155 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[4^2, 145]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1636 = CTGATAGTCCATGCTC-1

using 7415 reads

====================================================================================

graph has 3428 edges initially, 40 edges after simplification

total ucounts = 566
nonsolo ucounts = 249[2^93, 3^39, 4^36, 5^18, 6^19, 7^7, 8^2, 9, 10^2, 11, 12^2, 14, 15, 24, 25, 50, 161, 175^2, 188, 190, 191, 202, 204, 208, 244, 245, 246, 250, 258, 269, 288, 297^2, 300, 312, 316, 323, 399, 452]
surviving nonsolo ucounts = 25[25, 161, 175^2, 188, 190, 191, 202, 204, 208, 244, 245, 246, 250, 258, 269, 288, 297^2, 300, 312, 316, 323, 399, 452]
ids = [238, 161, 134, 390, 71, 274, 26, 259, 295, 562, ...]

====================================================================================

UMI info for barcode CTGATAGTCCATGCTC-1 contig 1 = TGAGCGCAGA...
umi AACCTGTCCA = 298 reads: +388 validated
umi AAGGAGGACA = 188 reads: +388 validated
umi ACCACTTCGC = 270 reads: +388 validated
umi ACTCGTCACT = 139 reads: +48 -1X +339 invalidated
umi ATACCCCCTG = 250 reads: +388 validated
umi ATGCGGCCGC = 174 reads: +388 validated
umi CGTATTCGCC = 246 reads: +388 validated
umi CTCATTGGTG = 203 reads: +388 validated
umi CTGAACTGGC = 191 reads: +388 validated
umi CTTGTCAGAG = 199 reads: +388 validated
umi GATTCATTAC = 262 reads: +388 validated
umi GTGTTAGAGA = 173 reads: +388 validated
umi GTTCGGCTAC = 240 reads: +388 validated
umi TTGCGCCGTG = 396 reads: +388 validated

UMI info for barcode CTGATAGTCCATGCTC-1 contig 2 = TGGGGGACTC...
umi CAGACTCGGG = 285 reads: +433 validated
umi CTTGCAGCCT = 243 reads: +433 validated
umi GCACAGTTCA = 294 reads: +433 validated
umi GGGTGTTGGG = 315 reads: +433 validated
umi GGTTTGCCGG = 451 reads: +433 validated
umi TGCAAAACGT = 271 reads: +433 validated
umi TTTGCTCGTA = 190 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=635]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=2)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 14 umis using 415 reads
cdr3 = CGTWDSSLSAWVF at 357, score = 6 + 8
umis assigned: [19, 26, 50, 71, 110, 134, 245, 259, 274, 295] and 4 others
of which 14 are surviving nonsolos
reads assigned: 3182
start codons at 36, 190, 241, 365
confident = true

TIG 2[bases=526]
22-380 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=6)
405-455 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
455-526 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 169 reads
cdr3 = CAHRHSSYDSGSRDTFDIW at 367, score = 7 + 7
umis assigned: [181, 291, 329, 364, 371, 487, 562]
of which 7 are surviving nonsolos
reads assigned: 2033
start codons at 22, 66, 328, 337, 389, 436
confident = true

REJECT CONTIGS

TIG 1[bases=555]
5-82 ==> 5533-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
35-395 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=9)
381-419 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=4)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWGLLLHARDTL at 355, score = 3 + 7
umis assigned: [108, 161, 238, 309]
of which 4 are surviving nonsolos
reads assigned: 792
start codons at 35, 68, 96, 104, 192, 354, 374, 461
confident = false
not full
frameshifted full length stopped transcript of length 555
VJ delta = 30
not full
now this is a cell
paired!

GGCACATATTACTGTGCACACCGACATTCCTCCTATGATTCGGGGAGTCGTGATACTTTTGATATCTGGGGCCAAGGGACCATGGTCATCGTCTCTTCAG <==> GGACTCCAGACTGGGGACGAGACCGATTATTACTGCGGAACATGGGATAGCAGCCTGAGTGCTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1640 = CTGATAGTCCTATGTT-1

using 186 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 182]
surviving nonsolo ucounts = 1[182]
ids = [3]

====================================================================================

UMI info for barcode CTGATAGTCCTATGTT-1 contig 1 = TCAGCTTCAG...
umi TCACAGTCGG = 182 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=561]
0-49 ==> 65-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
49-402 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
399-437 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
437-561 ==> 0-124 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CASWDDSLRGRVF at 370, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 49, 203, 353, 378, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1641 = CTGATAGTCCTTCAAT-1

using 309 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[306]
surviving nonsolo ucounts = 1[306]
ids = [1]

====================================================================================

UMI info for barcode CTGATAGTCCTTCAAT-1 contig 1 = GGATTCCGAG...
umi CCCGTTCGAG = 305 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=567]
0-53 ==> 168-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=0)
53-403 ==> 0-350 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=4)
417-465 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
465-567 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CARSIAAAGLFDYW at 392, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 53, 209, 353, 483, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1643 = CTGATAGTCGACAGCC-1

using 747 reads

====================================================================================

graph has 318 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[122, 253, 367]
surviving nonsolo ucounts = 3[122, 253, 367]
ids = [2, 6, 1]

====================================================================================

UMI info for barcode CTGATAGTCGACAGCC-1 contig 1 = GGGAGTCTCA...
umi ATGCAGCACC = 369 reads: +391 validated

UMI info for barcode CTGATAGTCGACAGCC-1 contig 2 = GCTCTGCTTC...
umi CAACCGCGCT = 1 reads: -187 +1 -4 +2 -2X +10 -1 +1 -1 +2 -1X +3 -1 +2 -1 +3 -5 +1 -2 +4 -1X +3 -1X +4 -148 invalidated
umi GTACCGCGCT = 246 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=550]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=0)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 66 reads
cdr3 = CQQSYSTPPGTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 360
start codons at 23, 29, 85, 98, 234, 456
confident = false

TIG 2[bases=606]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-391 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
442-606 ==> 0-164 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQSYDKSLRGAVF at 375, score = 7 + 8
umis assigned: [3, 6]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 51, 135, 208, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1645 = CTGATAGTCGACGGAA-1

using 243 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 234]
surviving nonsolo ucounts = 1[234]
ids = [0]

====================================================================================

UMI info for barcode CTGATAGTCGACGGAA-1 contig 1 = GAGACTCAGT...
umi ACATTAGGGT = 236 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=545]
21-372 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
372-409 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
409-545 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQYNSYPLTF at 348, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 21, 27, 83, 96, 232, 235, 328, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1647 = CTGATAGTCGGAGGTA-1

using 734 reads

====================================================================================

graph has 222 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[20, 301, 410]
surviving nonsolo ucounts = 2[301, 410]
ids = [3, 2]

====================================================================================

UMI info for barcode CTGATAGTCGGAGGTA-1 contig 1 = GAGCTGCTCA...
umi GCCGCACCCT = 377 reads: +385 validated
umi GCCGCACCGT = 278 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=509]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-509 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 97 reads
cdr3 = CQQYGSSPKTF at 354, score = 9 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 650
start codons at 30, 238, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1649 = CTGATAGTCGGTCTAA-1

using 195 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 186]
surviving nonsolo ucounts = 1[186]
ids = [7]

====================================================================================

UMI info for barcode CTGATAGTCGGTCTAA-1 contig 1 = GCTCTGCTTC...
umi GGGCATCCCG = 183 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=533]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-533 ==> 0-91 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 180
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1660 = CTGATCCAGACGCTTT-1

using 71 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 12[2^2, 3, 4^3, 5^2, 6, 9, 11, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1671 = CTGATCCAGCGCTTAT-1

using 1266 reads

====================================================================================

graph has 1896 edges initially, 16 edges after simplification

total ucounts = 578
nonsolo ucounts = 281[2^132, 3^62, 4^28, 5^27, 6^9, 7^4, 8^5, 9^5, 10^2, 11^3, 12^3, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1673 = CTGATCCAGCTAGCCC-1

using 583 reads

====================================================================================

graph has 216 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 245, 329]
surviving nonsolo ucounts = 2[245, 329]
ids = [3, 8]

====================================================================================

UMI info for barcode CTGATCCAGCTAGCCC-1 contig 1 = AGCTTCAGCT...
umi CGTTATGCGC = 249 reads: +388 validated

UMI info for barcode CTGATCCAGCTAGCCC-1 contig 2 = GAGGAATCAG...
umi TCGTTCTGGT = 313 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=533]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-533 ==> 0-98 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=476]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-476 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 305
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1675 = CTGATCCAGGAGCGAG-1

using 7851 reads

====================================================================================

graph has 4031 edges initially, 48 edges after simplification

total ucounts = 589
nonsolo ucounts = 286[2^81, 3^55, 4^27, 5^25, 6^13, 7^11, 8^7, 9^9, 10^4, 11^3, 12^8, 13^5, 14^2, 15^3, 16, 19^2, 20, 23, 122, 130, 133, 135, 155, 173, 175, 178, 184, 190, 197, 205, 206, 207, 209, 217, 218^2, 220, 246, 271, 273, 276, 281, 303, 307, 308, 555]
surviving nonsolo ucounts = 28[122, 130, 133, 135, 155, 173, 175, 178, 184, 190, 197, 205, 206, 207, 209, 217, 218^2, 220, 246, 271, 273, 276, 281, 303, 307, 308, 555]
ids = [260, 182, 22, 139, 215, 573, 247, 454, 385, 188, ...]

====================================================================================

UMI info for barcode CTGATCCAGGAGCGAG-1 contig 1 = GAGCTCTGGG...
umi AACTTCCACT = 133 reads: +409 validated
umi CAACTCGGAT = 130 reads: +409 validated
umi CCAGCAGTGT = 155 reads: +409 validated
umi CGGACGGACC = 176 reads: +409 validated
umi CGGGAATTGC = 309 reads: +409 validated
umi GGTTTTATGC = 192 reads: +407 -2 non-validated
umi TCTCTTCATT = 223 reads: +409 validated
umi TGAGTTTAAG = 553 reads: +409 validated

UMI info for barcode CTGATCCAGGAGCGAG-1 contig 2 = GCTGGGGTCT...
umi AACGGAACAG = 283 reads: +388 validated
umi ACAATGTTTA = 222 reads: +388 validated
umi ATCATCTGCA = 135 reads: +388 validated
umi ATTCATCTCT = 216 reads: +388 validated
umi CACACACTCC = 190 reads: +388 validated
umi CATATAGTCC = 221 reads: +388 validated
umi CGTGGTAAGG = 122 reads: +388 validated
umi GAATGCCTTT = 273 reads: +388 validated
umi GACGCAGTTC = 269 reads: +388 validated
umi GACTTAACAA = 209 reads: +388 validated
umi GGCCAACGGC = 187 reads: +388 validated
umi GTCACGTTCA = 247 reads: +388 validated
umi TAGAATTAAC = 205 reads: +388 validated
umi TAGACTTTAA = 208 reads: +388 validated
umi TAGACTTTCA = 178 reads: +388 validated
umi TCTGATCGGG = 218 reads: +388 validated
umi TTTCACCGTC = 175 reads: +388 validated
umi TTTTAGACAC = 302 reads: +388 validated
umi TTTTGGCCCT = 272 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=560]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=28)
441-489 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
489-560 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 132 reads
cdr3 = CARDSDWALDYW at 422, score = 8 + 6
umis assigned: [22, 182, 215, 247, 250, 406, 503, 516]
of which 8 are surviving nonsolos
reads assigned: 1832
start codons at 80, 133, 231, 236, 274, 297, 315, 383
confident = true

TIG 2[bases=640]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-379 ==> 0-338 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=9)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
429-640 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 19 umis using 639 reads
cdr3 = CSSYTTRKTWVF at 365, score = 8 + 8
umis assigned: [15, 54, 139, 171, 188, 202, 260, 311, 315, 321] and 9 others
of which 19 are surviving nonsolos
reads assigned: 4073
start codons at 41, 198, 242, 249
confident = true
now this is a cell
paired!

ACCGTGAGACCTGAAGACACGGCTGTGTATCACTGTGCGAGAGATTCAGACTGGGCCCTTGACTACTGGGGCCAGGGAGCCCTGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGACGAGGCTAATTATTATTGCAGCTCATATACGACCAGAAAGACTTGGGTGTTCGGCGGAGGGACCAAGTTGACCGTCCTAA

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1679 = CTGATCCAGGAGTTGC-1

using 360 reads

====================================================================================

graph has 106 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[154, 202]
surviving nonsolo ucounts = 2[154, 202]
ids = [5, 3]

====================================================================================

UMI info for barcode CTGATCCAGGAGTTGC-1 contig 1 = GACTCCTGTG...
umi TAGGATTCCT = 129 reads: +418 validated

UMI info for barcode CTGATCCAGGAGTTGC-1 contig 2 = AGCTTCAGCT...
umi TAGCAGTTCA = 202 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=476]
17-367 ==> 0-350 on |94|IGHV2-26|L-REGION+V-REGION| [len=357] (mis=24)
384-435 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
435-476 ==> 0-41 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CASAAAPGDWFDPW at 362, score = 7 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 129
start codons at 17, 173, 240, 332
confident = false

TIG 2[bases=548]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-355 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-548 ==> 0-113 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CVAWDDSLYAWVF at 368, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 47, 351, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1683 = CTGATCCAGGGAACGG-1

using 735 reads

====================================================================================

graph has 280 edges initially, 12 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[6, 81, 184, 186, 275]
surviving nonsolo ucounts = 3[81, 184, 275]
ids = [5, 1, 2]

====================================================================================

UMI info for barcode CTGATCCAGGGAACGG-1 contig 1 = AAAAACCACA...
umi AATTTACATC = 185 reads: +436 validated

UMI info for barcode CTGATCCAGGGAACGG-1 contig 2 = GGGGCAGTCC...
umi GCACGCGGTG = 103 reads: +22 -1XX +25 -1XX +13 -1XX +12 -1XX +8 -62 +2 -1XX +5 -2XX +1 -1XX +1 -1XX +6 -1XX +5 -1XX +6 -1XX +1 -1XX +20 -1XX +3 -1XX +3 -1XX +12 -1XX +4 -1XX +29 -2XX +128 invalidated

UMI info for barcode CTGATCCAGGGAACGG-1 contig 3 = GGGGATCAGT...
umi CCGACTGACA = 254 reads: +388 validated
umi CTCAAGTGTC = 75 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=646]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-646 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 50, 248, 253, 270, 314, 347, 540
confident = true

TIG 2[bases=429]
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=15)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQQLNSYPLTF at 352, score = 9 + 9
umis assigned: [6]
of which 0 are surviving nonsolos
reads assigned: 93
start codons at 25, 31, 100, 236
confident = true

TIG 3[bases=497]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-497 ==> 0-82 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 43 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [2, 5]
of which 2 are surviving nonsolos
reads assigned: 324
start codons at 27, 33, 102, 238, 457
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1685 = CTGATCCAGGGCATGT-1

using 252 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 3, 244]
surviving nonsolo ucounts = 1[244]
ids = [0]

====================================================================================

UMI info for barcode CTGATCCAGGGCATGT-1 contig 1 = GAAGAGCTGC...
umi AGTCCCGCTA = 231 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=493]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=18)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
418-493 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQYGSSPWTF at 357, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 33, 82, 105, 237, 241, 340, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1689 = CTGATCCAGTACACCT-1

using 283 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[279]
surviving nonsolo ucounts = 1[279]
ids = [4]

====================================================================================

UMI info for barcode CTGATCCAGTACACCT-1 contig 1 = ACTCAGGACA...
umi TTTTATCGCG = 259 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=519]
0-19 ==> 32-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
19-359 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
372-410 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
410-519 ==> 0-109 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQSYDKSLRGAVF at 343, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 19, 103, 176, 326, 353
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1693 = CTGATCCAGTCTCAAC-1

using 222 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3^2, 214]
surviving nonsolo ucounts = 1[214]
ids = [3]

====================================================================================

UMI info for barcode CTGATCCAGTCTCAAC-1 contig 1 = GCTCTGCTTC...
umi TAAGACCCCC = 206 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=535]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=13)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-535 ==> 0-90 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1695 = CTGATCCAGTGAATTG-1

using 92 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[19, 71]
surviving nonsolo ucounts = 1[71]
ids = [3]

====================================================================================

UMI info for barcode CTGATCCAGTGAATTG-1 contig 1 = CAGTCCCAAC...
umi TCGGAGTCCC = 64 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=432]
0-21 ==> 10-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
21-372 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
372-409 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
409-432 ==> 0-23 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CQQYDNLPLTF at 348, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 64
start codons at 21, 27, 83, 96, 235, 358
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1696 = CTGATCCAGTGGACGT-1

using 73 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[70]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1707 = CTGATCCCACAGACTT-1

using 95 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[8, 82]
surviving nonsolo ucounts = 1[82]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1708 = CTGATCCCACAGGCCT-1

using 17 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1709 = CTGATCCCACAGTCGC-1

using 755 reads

====================================================================================

graph has 860 edges initially, 10 edges after simplification

total ucounts = 298
nonsolo ucounts = 103[2^54, 3^18, 4^12, 5^6, 6^2, 7^4, 8, 9, 10^2, 12, 13, 218]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1713 = CTGATCCCACGTCAGC-1

using 263 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[5, 253]
surviving nonsolo ucounts = 1[253]
ids = [4]

====================================================================================

UMI info for barcode CTGATCCCACGTCAGC-1 contig 1 = GCTCTGCTTC...
umi CCCGCCTCAT = 245 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=579]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=10)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
442-579 ==> 0-137 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQSYDINLIGVIF at 375, score = 7 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 51, 114, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1714 = CTGATCCCACGTGAGA-1

using 387 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 381]
surviving nonsolo ucounts = 1[381]
ids = [4]

====================================================================================

UMI info for barcode CTGATCCCACGTGAGA-1 contig 1 = AGAGCTCTGG...
umi TATGACGCCT = 385 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=568]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
393-432 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 73 reads
cdr3 = CQHYSTWPPPYTF at 365, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 380
start codons at 44, 113, 249, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1715 = CTGATCCCACTATCTT-1

using 253 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[253]
surviving nonsolo ucounts = 1[253]
ids = [0]

====================================================================================

UMI info for barcode CTGATCCCACTATCTT-1 contig 1 = GAGTCAGTCT...
umi TCGGCCAAGC = 240 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=507]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=7)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
413-507 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQSYSTPYTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1716 = CTGATCCCACTCTGTC-1

using 897 reads

====================================================================================

graph has 304 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[391, 500]
surviving nonsolo ucounts = 2[391, 500]
ids = [0, 6]

====================================================================================

UMI info for barcode CTGATCCCACTCTGTC-1 contig 1 = GGAGTCAGTC...
umi ACGCGCACGA = 395 reads: +388 validated
umi TCGTGATATA = 506 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 149 reads
cdr3 = CHQYESVPYTF at 353, score = 9 + 7
umis assigned: [0, 6]
of which 2 are surviving nonsolos
reads assigned: 879
start codons at 26, 32, 88, 101, 240, 336, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1720 = CTGATCCCAGGACGTA-1

using 46 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[41]
surviving nonsolo ucounts = 1[41]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1722 = CTGATCCCAGGTCTCG-1

using 268 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[263]
surviving nonsolo ucounts = 1[263]
ids = [5]

====================================================================================

UMI info for barcode CTGATCCCAGGTCTCG-1 contig 1 = GGAGTCAGTC...
umi TTAATTTCCA = 269 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQSYTTLLTF at 353, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1725 = CTGATCCCATCATCCC-1

using 304 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[298]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1726 = CTGATCCCATCCTAGA-1

using 19 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1736 = CTGATCCGTAGCTAAA-1

using 31 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 26]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1741 = CTGATCCGTCATATCG-1

using 18 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1743 = CTGATCCGTCGCGAAA-1

using 22 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1747 = CTGATCCGTGAAATCA-1

using 741 reads

====================================================================================

graph has 282 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^3, 121, 241, 367]
surviving nonsolo ucounts = 3[121, 241, 367]
ids = [11, 4, 9]

====================================================================================

UMI info for barcode CTGATCCGTGAAATCA-1 contig 1 = ATCAGTCCCA...
umi GCACATATCT = 245 reads: +388 validated
umi TCTTGCCCTT = 366 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 96 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [4, 9]
of which 2 are surviving nonsolos
reads assigned: 600
start codons at 23, 29, 98, 234, 453
confident = true

REJECT CONTIGS

TIG 1[bases=515]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
0-50 ==> 11314-11364 on rc of segment before IGHV3-19 exon 1 [len=11364] (mis=1)
36-68 ==> 10108-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
50-200 ==> 0-150 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=5)
201-404 ==> 150-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=17) [SHIFT!]
453-487 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
487-515 ==> 0-28 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 393, score = 7 + 7
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 120
start codons at 50, 249, 254, 271, 315, 348
confident = false
frameshifted full length stopped transcript of length 515
VJ delta = 5
not full
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1749 = CTGATCCGTGACGCCT-1

using 440 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 433]
surviving nonsolo ucounts = 1[433]
ids = [2]

====================================================================================

UMI info for barcode CTGATCCGTGACGCCT-1 contig 1 = AGTCCCAACC...
umi ATGCTCGGGT = 437 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=541]
0-20 ==> 11-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
20-371 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
367-405 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
405-541 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 83 reads
cdr3 = CQQYDNLPTF at 347, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 429
start codons at 20, 26, 82, 95, 234, 357, 447
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1754 = CTGATCCGTGGCGAAT-1

using 415 reads

====================================================================================

graph has 182 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 5, 165, 238]
surviving nonsolo ucounts = 2[165, 238]
ids = [5, 6]

====================================================================================

UMI info for barcode CTGATCCGTGGCGAAT-1 contig 1 = TGAGCGCAGA...
umi TGCCCACACG = 234 reads: +394 validated

UMI info for barcode CTGATCCGTGGCGAAT-1 contig 2 = GGGATGCTTT...
umi TCAGTTATGC = 158 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=526]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-361 ==> 0-325 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=10)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
430-526 ==> 0-96 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CAVWDDSLDTGRGVF at 357, score = 7 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 36, 190, 241, 370
confident = false

TIG 2[bases=506]
19-396 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=27)
419-467 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
467-506 ==> 0-39 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARRDYYGSERVDFDYW at 385, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 156
start codons at 3, 19, 28, 40, 84, 100, 188, 307, 404
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1755 = CTGATCCGTGGTTTCA-1

using 235 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[233]
surviving nonsolo ucounts = 1[233]
ids = [1]

====================================================================================

UMI info for barcode CTGATCCGTGGTTTCA-1 contig 1 = ACCCAAAAAC...
umi GCCTTGCCAG = 215 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=556]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-556 ==> 0-66 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1757 = CTGATCCGTGTTCTTT-1

using 904 reads

====================================================================================

graph has 232 edges initially, 4 edges after simplification

total ucounts = 17
nonsolo ucounts = 6[2, 3, 4^2, 201, 679]
surviving nonsolo ucounts = 2[201, 679]
ids = [2, 13]

====================================================================================

UMI info for barcode CTGATCCGTGTTCTTT-1 contig 1 = AGCTTCAGCT...
umi CCACCTGGGA = 192 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-505 ==> 0-70 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1767 = CTGATCCGTTCCCTTG-1

using 248 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[248]
surviving nonsolo ucounts = 1[248]
ids = [0]

====================================================================================

UMI info for barcode CTGATCCGTTCCCTTG-1 contig 1 = GCTACAACAG...
umi CAGACACAGA = 243 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=522]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
389-428 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
428-522 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQYYGSPRTF at 367, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 25, 28, 83, 97, 350, 380, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1769 = CTGATCCGTTCTGTTT-1

using 212 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 7, 203]
surviving nonsolo ucounts = 1[203]
ids = [2]

====================================================================================

UMI info for barcode CTGATCCGTTCTGTTT-1 contig 1 = ACTTTCTGAG...
umi TAACCACAGT = 206 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=536]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=9)
411-459 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
459-536 ==> 0-77 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 23 reads
cdr3 = CARGAGITTRAYYFDYW at 377, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 14, 35, 79
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1770 = CTGATCCGTTTACTCT-1

using 259 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[256]
surviving nonsolo ucounts = 1[256]
ids = [0]

====================================================================================

UMI info for barcode CTGATCCGTTTACTCT-1 contig 1 = AGTCCTGGTG...
umi GACCTCCTTT = 249 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=540]
0-45 ==> 41-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
45-398 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=5)
398-436 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
436-540 ==> 0-104 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQSYDSSTLYVF at 372, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 45, 108, 199, 250, 382, 400
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1771 = CTGATCCGTTTCGCTC-1

using 206 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[201]
surviving nonsolo ucounts = 1[201]
ids = [3]

====================================================================================

UMI info for barcode CTGATCCGTTTCGCTC-1 contig 1 = GGGGATCAGT...
umi CTCGTTGGCT = 202 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1773 = CTGATCCTCAACACAC-1

using 515 reads

====================================================================================

graph has 234 edges initially, 30 edges after simplification

total ucounts = 17
nonsolo ucounts = 9[2^2, 3, 7, 8, 10, 11, 201, 263]
surviving nonsolo ucounts = 2[201, 263]
ids = [4, 15]

====================================================================================

UMI info for barcode CTGATCCTCAACACAC-1 contig 1 = GAGGAATCAG...
umi CACAAAACCG = 209 reads: +22 -1XX +365 invalidated

UMI info for barcode CTGATCCTCAACACAC-1 contig 2 = GGAGTCAGAC...
umi TTCACAGCCA = 260 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=18)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 28, 34, 103, 239, 458
confident = false

TIG 2[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=20)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYDTYPLTF at 353, score = 8 + 9
umis assigned: [15]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 26, 32, 88, 101, 237, 240, 333, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1774 = CTGATCCTCAACCAAC-1

using 692 reads

====================================================================================

graph has 164 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[225, 460]
surviving nonsolo ucounts = 2[225, 460]
ids = [6, 3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=490]
0-74 ==> 5666-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
23-75 ==> 0-52 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=0)
75-319 ==> 109-353 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=3)
315-354 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
354-490 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYYSFPYTF at 293, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 453
start codons at 23, 29, 104, 177, 396
confident = false
not full
full length transcript of length 490
VJ delta = 74
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1775 = CTGATCCTCAATACCG-1

using 265 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 262]
surviving nonsolo ucounts = 1[262]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=553]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
0-27 ==> 6795-6822 on rc of segment before IGKV3-34 exon 2 [len=6822] (mis=0)
16-79 ==> 5678-5741 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 27, 33, 89, 102, 241, 364, 459
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1777 = CTGATCCTCACAACGT-1

using 10 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1779 = CTGATCCTCACATACG-1

using 12 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1787 = CTGATCCTCAGTTTGG-1

using 47 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 7[2, 3, 4, 6, 7, 10, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1793 = CTGATCCTCCGTAGGC-1

using 572 reads

====================================================================================

graph has 276 edges initially, 36 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2, 3, 5, 8, 232, 315]
surviving nonsolo ucounts = 2[232, 315]
ids = [8, 12]

====================================================================================

UMI info for barcode CTGATCCTCCGTAGGC-1 contig 1 = CAGTCCCACT...
umi TCCCCGCCAA = 230 reads: +22 -1XX +235 -2XX +128 invalidated

UMI info for barcode CTGATCCTCCGTAGGC-1 contig 2 = AGACCCAGTC...
umi TTTCGCGCCG = 310 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=499]
0-21 ==> 6-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
21-372 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=16)
371-409 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
409-499 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CLQYSSSPWTF at 348, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 21, 27, 96, 232, 451
confident = false

TIG 2[bases=498]
0-20 ==> 161-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
20-371 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
408-498 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYNSYPRTF at 347, score = 8 + 8
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 20, 26, 82, 95, 327, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1799 = CTGATCCTCGATAGAA-1

using 176 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 5, 7, 157]
surviving nonsolo ucounts = 1[157]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1801 = CTGATCCTCGCTTGTC-1

using 329 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 324]
surviving nonsolo ucounts = 1[324]
ids = [1]

====================================================================================

UMI info for barcode CTGATCCTCGCTTGTC-1 contig 1 = TGAGTCTCCC...
umi AGCTCCAACA = 322 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=581]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=0)
414-445 ==> 0-31 on |14|IGHD2-2|D-REGION| [len=31] (mis=5)
457-510 ==> 10-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
510-581 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARHGYIVVVPAAISLRSSYYGMDVW at 401, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 59, 233, 257, 392, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1802 = CTGATCCTCGGAAACG-1

using 305 reads

====================================================================================

graph has 128 edges initially, 16 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3^2, 32, 265]
surviving nonsolo ucounts = 2[32, 265]
ids = [4, 5]

====================================================================================

UMI info for barcode CTGATCCTCGGAAACG-1 contig 1 = AGCTTCAGCT...
umi TACCGATAAC = 8 reads: -12X +1 -2X +10 -1XX +12 -2XX +1 -2XX +21 -2XX +9 -1XX +1 -1XX +5 -1XX +9 -1X +1 -1X +1 -2X +1 -96 +2 -1X +1 -1X +2 -1XX +3 -1XX +1 -5XX +2 -1XX +22 -1XX +2 -1XX +7 -1XX +7 -92X +1 -4X +1 -1X +2 -1X +5 -1X +9 -1X +12 invalidated
umi TCGTATGCCC = 263 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=528]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-528 ==> 0-93 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [4, 5]
of which 2 are surviving nonsolos
reads assigned: 267
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1805 = CTGATCCTCGGTGTTA-1

using 321 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 317]
surviving nonsolo ucounts = 1[317]
ids = [0]

====================================================================================

UMI info for barcode CTGATCCTCGGTGTTA-1 contig 1 = AGGAGTCAGA...
umi GAAACCTCCA = 306 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=485]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=17)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
415-485 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQTDSFPRTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 298
start codons at 27, 33, 89, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1817 = CTGATCCTCTGGTTCC-1

using 314 reads

====================================================================================

graph has 80 edges initially, 4 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 48, 264]
surviving nonsolo ucounts = 1[264]
ids = [1]

====================================================================================

UMI info for barcode CTGATCCTCTGGTTCC-1 contig 1 = AGGAGTCAGA...
umi ACTGGCCACG = 251 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=500]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=6)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-500 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYNSYSWTF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1818 = CTGATCCTCTGTCTCG-1

using 414 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[414]
surviving nonsolo ucounts = 1[414]
ids = [0]

====================================================================================

UMI info for barcode CTGATCCTCTGTCTCG-1 contig 1 = GGAACTGCTC...
umi TCCTTCCTAT = 395 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=477]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
413-477 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CLQYYNWPRTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 387
start codons at 31, 86, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1828 = CTGCCTAAGAGCTGGT-1

using 649 reads

====================================================================================

graph has 262 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 7[2^4, 3, 55, 581]
surviving nonsolo ucounts = 2[55, 581]
ids = [3, 4]

====================================================================================

UMI info for barcode CTGCCTAAGAGCTGGT-1 contig 1 = CATGGACATG...
umi CATGTAGGGT = 55 reads: +381 -7 non-validated
umi CCCATCAAGG = 583 reads: -224X +1 -4X +2 -5X +152 invalidated

GOOD CONTIGS

TIG 1[bases=525]
1-354 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
351-389 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
389-525 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 70 reads
cdr3 = CQQSYSTPLTF at 328, score = 9 + 9
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 626
start codons at 1, 7, 63, 76, 212, 431
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1829 = CTGCCTAAGAGTACAT-1

using 244 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 237]
surviving nonsolo ucounts = 1[237]
ids = [1]

====================================================================================

UMI info for barcode CTGCCTAAGAGTACAT-1 contig 1 = GATCAGGACT...
umi ACCGACCCTG = 226 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=508]
0-30 ==> 0-30 on |274|IGKV2D-29|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=0)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
427-508 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CMQSIQLPGTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 30, 63, 99, 187, 250, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1831 = CTGCCTAAGATAGTCA-1

using 102 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 4, 89]
surviving nonsolo ucounts = 1[89]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=380]
0-327 ==> 44-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=64)
cdr3 = CARGPLVRGIL at 316, score = 8 + 4
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 77
start codons at 21, 286
confident = false
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1833 = CTGCCTAAGATCACGG-1

using 369 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 3, 356]
surviving nonsolo ucounts = 1[356]
ids = [3]

====================================================================================

UMI info for barcode CTGCCTAAGATCACGG-1 contig 1 = GAGTCAGACC...
umi AGGACCCGGA = 349 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-31 ==> 22-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
31-376 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=2)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYYSYTWTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 348
start codons at 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1841 = CTGCCTAAGCCGGTAA-1

using 521 reads

====================================================================================

graph has 210 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3^2, 203, 308]
surviving nonsolo ucounts = 2[203, 308]
ids = [7, 2]

====================================================================================

UMI info for barcode CTGCCTAAGCCGGTAA-1 contig 1 = GGCCAAACAG...
umi GCTTATAAAG = 3 reads: +8 -1 +12 -1 +17 -316 +22 -1X +8 -2X invalidated
umi TATGTTATTC = 193 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=595]
41-393 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=20)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
429-595 ==> 0-166 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CSAWDSSLNVWVF at 362, score = 7 + 8
umis assigned: [3, 7]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 41, 180, 370, 387
confident = false

REJECT CONTIGS

TIG 1[bases=568]
1-81 ==> 5533-5613 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=3)
31-396 ==> 0-365 on |734|IGKV2D-40|L-REGION+V-REGION| [len=365] (mis=3)
394-432 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 31, 64, 100, 188, 191, 353, 373, 474
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1849 = CTGCCTAAGCTCCCAG-1

using 869 reads

====================================================================================

graph has 308 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 4, 17, 302, 542]
surviving nonsolo ucounts = 2[302, 542]
ids = [5, 3]

====================================================================================

UMI info for barcode CTGCCTAAGCTCCCAG-1 contig 1 = AGGAGTCAGA...
umi CAAGGTTCAG = 538 reads: -233X +1 -2XX +1 -1XX +150 invalidated
umi TTCGACATGG = 298 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 100 reads
cdr3 = CQQYNSYSWTF at 354, score = 8 + 8
umis assigned: [3, 5]
of which 2 are surviving nonsolos
reads assigned: 825
start codons at 27, 33, 89, 102, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1864 = CTGCCTAAGGTGGGTT-1

using 18 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1868 = CTGCCTAAGTGCCAGA-1

using 227 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^3, 3, 5, 209]
surviving nonsolo ucounts = 1[209]
ids = [7]

====================================================================================

UMI info for barcode CTGCCTAAGTGCCAGA-1 contig 1 = GGGGTCTCAG...
umi GCGCGCATGG = 209 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=553]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=3)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
429-553 ==> 0-124 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CSSYAGSNNPYVF at 362, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 38, 195, 239, 246, 345, 372, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1871 = CTGCCTAAGTTACGGG-1

using 303 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 297]
surviving nonsolo ucounts = 1[297]
ids = [5]

====================================================================================

UMI info for barcode CTGCCTAAGTTACGGG-1 contig 1 = GGAGTCAGAC...
umi GTCAGTTGGA = 273 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=495]
0-32 ==> 21-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
32-377 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
386-414 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
414-495 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQYYSYPRTF at 353, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1880 = CTGCCTACAACAACCT-1

using 13 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1884 = CTGCCTACAAGCGTAG-1

using 974 reads

====================================================================================

graph has 1470 edges initially, 8 edges after simplification

total ucounts = 398
nonsolo ucounts = 186[2^55, 3^45, 4^40, 5^11, 6^6, 7^7, 8^10, 9, 10^5, 11^3, 12, 16^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1891 = CTGCCTACAATGGAGC-1

using 17 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1898 = CTGCCTACACAGTCGC-1

using 202 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 199]
surviving nonsolo ucounts = 1[199]
ids = [1]

====================================================================================

UMI info for barcode CTGCCTACACAGTCGC-1 contig 1 = AGCTCTGGGA...
umi TGGCTCCGCT = 194 reads: +368 -1 +82 non-validated
umi TGTCTCCGCA = 2 reads: -131 +1 -1 +7 -1 +3 -1 +2 -1 +3 -1 +1 -1 +2 -1 +8 -1X +1 -1 +1 -1 +1 -1 +1 -2 +2 -3 +3 -1 +1 -266 invalidated

GOOD CONTIGS

TIG 1[bases=569]
0-80 ==> 0-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=0)
80-387 ==> 0-307 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=22)
468-531 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=7)
531-569 ==> 0-38 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 6 reads
cdr3 = CTRDIPHRIWFGDVLVYYYYMDVW at 428, score = 10 + 6
umis assigned: [1, 2]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 80, 133, 236, 321, 360, 389, 454, 488
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1901 = CTGCCTACACCAGCAC-1

using 14 reads

====================================================================================

graph has 19 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1905 = CTGCCTACACGACTCG-1

using 577 reads

====================================================================================

graph has 170 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[263, 312]
surviving nonsolo ucounts = 2[263, 312]
ids = [0, 1]

====================================================================================

UMI info for barcode CTGCCTACACGACTCG-1 contig 1 = ATATATGGGG...
umi ATATGCTGTC = 260 reads: +391 validated

UMI info for barcode CTGCCTACACGACTCG-1 contig 2 = GGAGGAACTG...
umi CCGCTCAGGA = 315 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=551]
51-389 ==> 0-338 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=16)
404-442 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=5)
442-551 ==> 0-109 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CSSYTNSTTPGVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 4, 51, 187, 259
confident = false

TIG 2[bases=555]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYNNWPTWTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 34, 103, 239, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1911 = CTGCCTACACTGTTAG-1

using 636 reads

====================================================================================

graph has 228 edges initially, 6 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[313, 322]
surviving nonsolo ucounts = 2[313, 322]
ids = [0, 1]

====================================================================================

UMI info for barcode CTGCCTACACTGTTAG-1 contig 1 = ATCAGTCCCA...
umi GCACCTCTTC = 321 reads: +388 validated

UMI info for barcode CTGCCTACACTGTTAG-1 contig 2 = GAAGAGCTGC...
umi AGCGCCGGAC = 317 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 23, 29, 98, 234, 453
confident = false

TIG 2[bases=557]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=11)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYDSSPPWTF at 357, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 33, 241, 367, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1917 = CTGCCTACAGCGTAAG-1

using 269 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 6, 257]
surviving nonsolo ucounts = 1[257]
ids = [0]

====================================================================================

UMI info for barcode CTGCCTACAGCGTAAG-1 contig 1 = AGAGTATGAA...
umi AATGTACCCA = 247 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=579]
0-48 ==> 31-79 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
48-82 ==> 80-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=1)
82-435 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=19)
438-476 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
476-579 ==> 0-103 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CAAWNDRVNGLIWVF at 403, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 5, 82, 386, 411, 416, 428
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1921 = CTGCCTACAGGTCGTC-1

using 33 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 2[2, 22]
surviving nonsolo ucounts = 1[22]
ids = [7]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1929 = CTGCCTACATACGCCG-1

using 307 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 19, 283]
surviving nonsolo ucounts = 1[283]
ids = [3]

====================================================================================

UMI info for barcode CTGCCTACATACGCCG-1 contig 1 = GCTCTGCTTC...
umi CCAAACCTGC = 272 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=537]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=3)
398-436 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
436-537 ==> 0-101 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQSYDSSLSVF at 375, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1935 = CTGCCTACATGAACCT-1

using 14 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1943 = CTGCCTACATTAGGCT-1

using 130 reads

====================================================================================

graph has 126 edges initially, 4 edges after simplification

total ucounts = 24
nonsolo ucounts = 19[2^3, 3^3, 4^2, 5, 6, 7^2, 8, 9^2, 10, 13, 14^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1944 = CTGCCTACATTCACTT-1

using 492 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[492]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1953 = CTGCCTAGTAATCGTC-1

using 922 reads

====================================================================================

graph has 1406 edges initially, 6 edges after simplification

total ucounts = 472
nonsolo ucounts = 187[2^80, 3^52, 4^16, 5^17, 6^9, 7^3, 8^4, 9^2, 10, 11, 12, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1970 = CTGCCTAGTCTAAAGA-1

using 199 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[198]
surviving nonsolo ucounts = 1[198]
ids = [1]

====================================================================================

UMI info for barcode CTGCCTAGTCTAAAGA-1 contig 1 = GGCTCTGAGA...
umi ATTTACCTTT = 198 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=540]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=1)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-540 ==> 0-37 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1974 = CTGCCTAGTCTGCCAG-1

using 114 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[112]
surviving nonsolo ucounts = 1[112]
ids = [0]

====================================================================================

UMI info for barcode CTGCCTAGTCTGCCAG-1 contig 1 = GCTCTGCTTC...
umi AATACTAATG = 113 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=502]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-502 ==> 0-57 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 109
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1976 = CTGCCTAGTGAACCTT-1

using 3956 reads

====================================================================================

graph has 2720 edges initially, 24 edges after simplification

total ucounts = 488
nonsolo ucounts = 243[2^90, 3^61, 4^25, 5^19, 6^9, 7^9, 8^4, 9^4, 10, 11^3, 12^3, 15, 16, 61, 62, 117, 122, 182, 207, 238, 266, 282, 290, 316, 350, 364]
surviving nonsolo ucounts = 13[61, 62, 117, 122, 182, 207, 238, 266, 282, 290, 316, 350, 364]
ids = [89, 450, 160, 73, 61, 428, 166, 347, 168, 70, ...]

====================================================================================

UMI info for barcode CTGCCTAGTGAACCTT-1 contig 1 = TGGGGGACTC...
umi AGACTACTCG = 299 reads: +439 validated
umi AGGCCTGTAG = 233 reads: +439 validated
umi AGTCCATCCT = 121 reads: +439 validated
umi CCGTCCAACG = 100 reads: +413 -1XX +5 -1 +19 invalidated
umi CCTCCTTAGG = 196 reads: +439 validated
umi CCTCTGATAC = 287 reads: +439 validated
umi GCGCAACCCC = 247 reads: +439 validated
umi GCGCTGGGGT = 316 reads: +439 validated
umi TACCTTTTCG = 265 reads: +439 validated
umi TGTAACATGA = 167 reads: +439 validated

UMI info for barcode CTGCCTAGTGAACCTT-1 contig 2 = GGGAGGAATC...
umi ATGACTACGT = 54 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=563]
22-380 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=8)
413-461 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
461-563 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 9 umis using 185 reads
cdr3 = CAHRRFEWLPKGVAGGYFDYW at 367, score = 7 + 7
umis assigned: [63, 70, 73, 160, 166, 168, 279, 280, 347, 428]
of which 10 are surviving nonsolos
reads assigned: 2194
start codons at 22, 66, 245, 248, 328, 337, 479, 540
confident = true

TIG 2[bases=479]
30-381 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-479 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CLQYSSSPWTF at 357, score = 9 + 8
umis assigned: [89]
of which 1 are surviving nonsolos
reads assigned: 53
start codons at 30, 36, 105, 241, 460
confident = true

REJECT CONTIGS

TIG 1[bases=355]
35-192 ==> 0-157 on rc of segment before IGHJ3P exon 1 [len=157] (mis=0)
190-253 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
253-355 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [61, 450]
of which 2 are surviving nonsolos
reads assigned: 240
start codons at 42, 76, 115, 170, 210, 271, 332
confident = false
did not find CDR3
now this is a cell
paired!

TATTTCTGTGCACACAGACGTTTCGAGTGGCTACCCAAGGGTGTGGCTGGCGGCTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCGACTTATTACTGTCTACAGTATTCTAGTTCCCCGTGGACGTTTGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1978 = CTGCCTAGTGAGGGTT-1

using 106 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 102]
surviving nonsolo ucounts = 1[102]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=454]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
8-80 ==> 5674-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
418-454 ==> 0-36 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 99
start codons at 23, 29, 85, 98, 234, 378
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1984 = CTGCCTAGTGTTTGTG-1

using 244 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[239]
surviving nonsolo ucounts = 1[239]
ids = [4]

====================================================================================

UMI info for barcode CTGCCTAGTGTTTGTG-1 contig 1 = ATCACATAAC...
umi GGCACCCTAC = 237 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=559]
0-58 ==> 0-58 on |89|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |90|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=7)
407-434 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=6)
440-488 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
488-559 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CASEAMVRGVIRLYYFDYW at 400, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 58, 256, 355, 415
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1987 = CTGCCTAGTTACGGAG-1

using 241 reads

====================================================================================

graph has 103 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 3, 22, 207]
surviving nonsolo ucounts = 1[207]
ids = [7]

====================================================================================

UMI info for barcode CTGCCTAGTTACGGAG-1 contig 1 = GGGCCTCAGG...
umi CGGTTGGCAC = 204 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=517]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-369 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
376-414 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
414-517 ==> 0-103 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQAWDSTTSWVF at 350, score = 6 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 35, 40, 96, 183, 230, 240, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1989 = CTGCCTAGTTAGAACA-1

using 240 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 4[2^3, 224]
surviving nonsolo ucounts = 1[224]
ids = [5]

====================================================================================

UMI info for barcode CTGCCTAGTTAGAACA-1 contig 1 = GGGAGAGCCC...
umi CCTTGTAGCT = 212 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=490]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=7)
389-426 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
426-490 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQRSNLLSF at 368, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 47, 252, 255, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.1991 = CTGCCTAGTTATGCGT-1

using 1320 reads

====================================================================================

graph has 1048 edges initially, 20 edges after simplification

total ucounts = 275
nonsolo ucounts = 91[2^46, 3^24, 4^7, 5^4, 6^2, 7^3, 15, 17, 105, 268, 486]
surviving nonsolo ucounts = 2[268, 486]
ids = [141, 108]

====================================================================================

UMI info for barcode CTGCCTAGTTATGCGT-1 contig 1 = GGGAGTCTCA...
umi CCTGCACAGT = 444 reads: +388 validated
umi CTTTTTGACC = 251 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
411-503 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 123 reads
cdr3 = CQQSYSTPRTF at 350, score = 9 + 8
umis assigned: [108, 141]
of which 2 are surviving nonsolos
reads assigned: 686
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2001 = CTGCCTAGTTTGGCGC-1

using 187 reads

====================================================================================

graph has 69 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[184]
surviving nonsolo ucounts = 1[184]
ids = [2]

====================================================================================

UMI info for barcode CTGCCTAGTTTGGCGC-1 contig 1 = GGGAGGAGTC...
umi TTAACGGCAG = 166 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=479]
30-383 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-479 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQSYSTPSF at 357, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 30, 36, 92, 105, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2003 = CTGCCTATCAACACAC-1

using 86 reads

====================================================================================

graph has 74 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[38, 41]
surviving nonsolo ucounts = 2[38, 41]
ids = [1, 2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2004 = CTGCCTATCAACGGGA-1

using 49 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 43]
surviving nonsolo ucounts = 1[43]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2015 = CTGCCTATCAGAGACG-1

using 361 reads

====================================================================================

graph has 142 edges initially, 18 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 4, 120, 234]
surviving nonsolo ucounts = 2[120, 234]
ids = [2, 4]

====================================================================================

UMI info for barcode CTGCCTATCAGAGACG-1 contig 1 = GGAGGCAGCG...
umi ATCCATGGGT = 119 reads: +388 validated
umi TTGATACCAT = 58 reads: -12X +1 -2XX +2 -2XX +19 -2XX +1 -2XX +21 -2XX +11 -2XX +4 -1XX +1 -1XX +5 -1XX +1 -1XX +1 -1XX +2 -1XX +1 -116X +1 -1XX +1 -1XX +1 -1XX +11 -1XX +2 -2XX +2 -1XX +1 -1XX +2 -1XX +22 -1XX +1 -1XX +1 -1XX +9 -1XX +5 -2XX +8 -1XX +1 -1XX +1 -41XX +1 -5X +1 -2X +1 -1XX +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated

GOOD CONTIGS

TIG 1[bases=502]
29-390 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
379-417 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
417-502 ==> 0-85 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 19 reads
cdr3 = CSSYTSSSTLVF at 353, score = 8 + 9
umis assigned: [2, 4]
of which 2 are surviving nonsolos
reads assigned: 174
start codons at 29, 186, 230, 237, 240
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2021 = CTGCCTATCATACGGT-1

using 239 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[234]
surviving nonsolo ucounts = 1[234]
ids = [5]

====================================================================================

UMI info for barcode CTGCCTATCATACGGT-1 contig 1 = ATCACATAAC...
umi TGGGAATGTG = 234 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=553]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=20)
423-439 ==> 0-16 on |24|IGHD4-11|D-REGION| [len=16] (mis=2)
434-482 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
482-553 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARDLGVDDYSNYFYYW at 400, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 58, 256, 355, 391
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2022 = CTGCCTATCATGCTCC-1

using 68 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 11[2^3, 4, 5, 6^2, 8, 9, 10, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2030 = CTGCCTATCCCATTTA-1

using 18 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2034 = CTGCCTATCCTCCTAG-1

using 45 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[40]
surviving nonsolo ucounts = 1[40]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2036 = CTGCCTATCCTTTCGG-1

using 562 reads

====================================================================================

graph has 234 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[186, 369]
surviving nonsolo ucounts = 2[186, 369]
ids = [2, 4]

====================================================================================

UMI info for barcode CTGCCTATCCTTTCGG-1 contig 1 = GAATCAGTCC...
umi GAACAGCGGC = 369 reads: +388 validated

UMI info for barcode CTGCCTATCCTTTCGG-1 contig 2 = GTGGGCACAA...
umi CTAGTATGGG = 185 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 364
start codons at 25, 31, 100, 236, 455
confident = false

TIG 2[bases=642]
0-37 ==> 14-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
37-393 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
393-431 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
431-642 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQSYDSSLSGLYVF at 361, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 37, 191, 194, 245, 344, 371, 395, 563
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2040 = CTGCCTATCGCACTCT-1

using 719 reads

====================================================================================

graph has 296 edges initially, 6 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^2, 4^2, 333, 370]
surviving nonsolo ucounts = 2[333, 370]
ids = [2, 4]

====================================================================================

UMI info for barcode CTGCCTATCGCACTCT-1 contig 1 = GGGAATCAGT...
umi CGTCGTTCAA = 332 reads: +388 validated
umi GCACACGCAG = 368 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 115 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [2, 4]
of which 2 are surviving nonsolos
reads assigned: 689
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2044 = CTGCCTATCGGTCTAA-1

using 12 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2048 = CTGCCTATCGTGGTCG-1

using 289 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 5, 278]
surviving nonsolo ucounts = 1[278]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2049 = CTGCCTATCGTTACAG-1

using 110 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[4, 100]
surviving nonsolo ucounts = 1[100]
ids = [5]

====================================================================================

UMI info for barcode CTGCCTATCGTTACAG-1 contig 1 = AAACCACACC...
umi GCTCGTTGAG = 99 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=522]
0-48 ==> 11-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
48-401 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
450-484 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
484-522 ==> 0-38 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 390, score = 7 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 97
start codons at 48, 246, 251, 268, 312, 345
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2059 = CTGCCTATCTGCCAGG-1

using 27 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[26]
surviving nonsolo ucounts = 1[26]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2062 = CTGCCTATCTGGCGTG-1

using 2688 reads

====================================================================================

graph has 3858 edges initially, 42 edges after simplification

total ucounts = 1182
nonsolo ucounts = 555[2^223, 3^116, 4^69, 5^42, 6^45, 7^23, 8^19, 9^8, 10^2, 11^2, 12^2, 14^2, 15, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2071 = CTGCCTATCTTCCTTC-1

using 16 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[4, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2078 = CTGCCTATCTTTAGGG-1

using 32 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 8[2^3, 3, 4^2, 6, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2097 = CTGCGGAAGCTAACAA-1

using 337 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[335]
surviving nonsolo ucounts = 1[335]
ids = [1]

====================================================================================

UMI info for barcode CTGCGGAAGCTAACAA-1 contig 1 = GACTGATCAG...
umi TTTATTTTTT = 298 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=517]
0-34 ==> 2-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
34-394 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
394-431 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
431-517 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CMQALQTPLTF at 370, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 34, 67, 103, 191, 353, 373, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2113 = CTGCGGACAAAGGAAG-1

using 34 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 5, 24]
surviving nonsolo ucounts = 1[24]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2115 = CTGCGGACAAGGTTTC-1

using 180 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2, 5, 7, 158]
surviving nonsolo ucounts = 1[158]
ids = [9]

====================================================================================

UMI info for barcode CTGCGGACAAGGTTTC-1 contig 1 = GGGTCACAAG...
umi TATTTTGTTC = 149 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=472]
0-37 ==> 125-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
37-377 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=5)
393-431 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
431-472 ==> 0-41 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CCSYAGSRTPNWVF at 361, score = 8 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 144
start codons at 37, 176, 238, 245, 371
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2127 = CTGCGGACACGTCTCT-1

using 105 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 14[2, 3, 4^4, 5, 6, 7, 8, 9, 12, 13, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2130 = CTGCGGACAGATTGCT-1

using 1239 reads

====================================================================================

graph has 416 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 5[2^2, 274, 327, 625]
surviving nonsolo ucounts = 2[274, 625]
ids = [4, 1]

====================================================================================

UMI info for barcode CTGCGGACAGATTGCT-1 contig 1 = GAGTCAGTCT...
umi CAATATTCGG = 627 reads: +388 validated
umi CCTATCACCT = 276 reads: +388 validated
umi TGATTCCATT = 34 reads: -359 +6 -1XX +5 -5XX +7 -1XX +4 invalidated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 22-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
25-376 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=28)
385-413 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 145 reads
cdr3 = CQQSNTSPRTF at 352, score = 8 + 8
umis assigned: [1, 4, 11]
of which 2 are surviving nonsolos
reads assigned: 918
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2131 = CTGCGGACAGCCAGAA-1

using 336 reads

====================================================================================

graph has 204 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2^2, 326]
surviving nonsolo ucounts = 1[326]
ids = [4]

====================================================================================

UMI info for barcode CTGCGGACAGCCAGAA-1 contig 1 = GGGGGGGTCT...
umi CCGCATTCCT = 320 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=559]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=5)
41-385 ==> 0-344 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=20)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
429-559 ==> 0-130 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CSSYISSTTLGF at 365, score = 8 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 41, 249, 252
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2136 = CTGCGGACAGTGAGTG-1

using 15853 reads

====================================================================================

graph has 6082 edges initially, 82 edges after simplification

total ucounts = 739
nonsolo ucounts = 358[2^105, 3^55, 4^49, 5^24, 6^20, 7^11, 8^14, 9^6, 10^7, 11^8, 12^6, 13, 14, 15^4, 20, 66, 87, 97, 100, 173, 181, 183, 192, 197, 200, 204, 212, 213, 235, 236, 243, 253, 254, 270, 289, 290, 293, 307, 311, 314, 320, 321, 329, 331, 358, 363, 369, 389, 400, 403^2, 409, 411, 421, 449, 459, 469, 488, 503, 507, 578]
surviving nonsolo ucounts = 45[87, 97, 100, 173, 181, 183, 192, 197, 200, 204, 212, 213, 235, 236, 243, 253, 254, 270, 289, 290, 293, 307, 311, 314, 320, 321, 329, 331, 358, 363, 369, 389, 400, 403^2, 409, 411, 421, 449, 459, 469, 488, 503, 507, 578]
ids = [509, 459, 375, 146, 137, 136, 266, 44, 280, 610, ...]

====================================================================================

UMI info for barcode CTGCGGACAGTGAGTG-1 contig 1 = AGTCCCAGTC...
umi AACCTATACA = 324 reads: +388 validated
umi AATGCGGTAT = 195 reads: +388 validated
umi ACGAAATTTC = 287 reads: +388 validated
umi ACGAGCCGAC = 237 reads: +388 validated
umi ACTATGGCAA = 243 reads: +388 validated
umi AGTTTACATC = 183 reads: +388 validated
umi ATACTAGGGT = 172 reads: +388 validated
umi ATCCGCATAA = 407 reads: +39 -1XX +348 invalidated
umi ATGCTTTAGG = 291 reads: +388 validated
umi CAACATAGCT = 411 reads: +388 validated
umi CACCTACAGG = 321 reads: +388 validated
umi CACTACGGTT = 316 reads: +388 validated
umi CCCTTGGGTC = 193 reads: +388 validated
umi CCGTAACACA = 198 reads: +388 validated
umi CCTTGGCGTC = 322 reads: +388 validated
umi CTCGCAGGGA = 265 reads: +388 validated
umi CTGTCTTTAT = 364 reads: +388 validated
umi GCCGCTTAAT = 358 reads: +388 validated
umi GGCCCGGGTC = 314 reads: +388 validated
umi GTGGTCCTAT = 235 reads: +388 validated
umi TAAGAACGGG = 257 reads: +388 validated
umi TACTTTTCTG = 310 reads: +388 validated
umi TAGCCTGCCA = 371 reads: +388 validated
umi TCAGACGATA = 251 reads: +388 validated
umi TCCGCAGTGG = 420 reads: +388 validated
umi TCTAGAATTA = 206 reads: +388 validated
umi TCTGTCCCCT = 410 reads: +388 validated
umi TGAACAGCAA = 291 reads: +388 validated
umi TGAATTTCAT = 210 reads: +388 validated

UMI info for barcode CTGCGGACAGTGAGTG-1 contig 2 = AGCTCTGGGA...
umi AATCCCTGCC = 214 reads: +427 validated
umi AGTTAGGACC = 188 reads: +427 validated
umi CTTTATAAGG = 99 reads: +427 validated
umi GGCTTATGGT = 96 reads: +427 validated
umi GTTCCTATCT = 3 reads: -379X +1 -1 +2 -4X +1 -1X +2 -1XX +35 invalidated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 38-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
20-371 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=12)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 29 umis using 1344 reads
cdr3 = CQQLYNYPRTF at 347, score = 9 + 8
umis assigned: [20, 44, 69, 70, 89, 137, 146, 160, 170, 196] and 19 others
of which 29 are surviving nonsolos
reads assigned: 8226
start codons at 20, 26, 82, 231, 450
confident = true

TIG 2[bases=689]
0-80 ==> 40-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=0)
80-433 ==> 0-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=21)
471-507 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=0)
507-689 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 4 umis using 59 reads
cdr3 = CAREARLSGTSPRVEDSW at 422, score = 9 + 7
umis assigned: [42, 136, 375, 459, 509]
of which 5 are surviving nonsolos
reads assigned: 589
start codons at 80, 236, 383
confident = true

REJECT CONTIGS

TIG 1[bases=457]
0-63 ==> 0-63 on |297|IGKV5-2|5'UTR| [len=63] (mis=2)
63-312 ==> 0-249 on |298|IGKV5-2|L-REGION+V-REGION| [len=345] (mis=3)
321-457 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [96, 106, 129, 135, 223, 245, 312, 356, 508, 560] and 1 others
of which 11 are surviving nonsolos
reads assigned: 4896
start codons at 63, 153, 211, 214, 219, 363
confident = false
did not find CDR3
now this is a cell
paired!

ACGGCCGTCTATTACTGTGCGCGAGAGGCGAGGTTAAGTGGGACCTCCCCAAGGGTGGAAGACTCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCAACAACTTTATAATTACCCTCGGACGTTCGGCCAAGGGACCAAGGTGGACATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2143 = CTGCGGACATGGTCAT-1

using 1947 reads

====================================================================================

graph has 2349 edges initially, 30 edges after simplification

total ucounts = 666
nonsolo ucounts = 293[2^95, 3^53, 4^42, 5^30, 6^18, 7^14, 8^13, 9^9, 10, 11^4, 12, 13^6, 14, 15^2, 16, 19, 24, 269]
surviving nonsolo ucounts = 1[269]
ids = [174]

====================================================================================

UMI info for barcode CTGCGGACATGGTCAT-1 contig 1 = CTCCCTCACT...
umi CAGGAAGGTA = 273 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=580]
0-54 ==> 5-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=0)
430-478 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
478-580 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CARHGLDSSSWFPFDYW at 396, score = 8 + 7
umis assigned: [174]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 54, 228, 252, 387, 406, 496, 557
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2152 = CTGCGGAGTCAAAGAT-1

using 34 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[34]
surviving nonsolo ucounts = 1[34]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2156 = CTGCGGAGTCGAATCT-1

using 130 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 122]
surviving nonsolo ucounts = 1[122]
ids = [4]

====================================================================================

UMI info for barcode CTGCGGAGTCGAATCT-1 contig 1 = ATCACACAAC...
umi GCTGTGGCAC = 111 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=534]
0-57 ==> 3-60 on |68|IGHV1-24|5'UTR| [len=60] (mis=0)
57-408 ==> 0-351 on |69|IGHV1-24|L-REGION+V-REGION| [len=351] (mis=44)
427-475 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
475-534 ==> 0-59 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CATAAGINKWAFDSW at 399, score = 10 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 109
start codons at 57, 202, 213, 255, 277, 321, 354, 425
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2163 = CTGCGGAGTGGTAACG-1

using 221 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2^3, 4, 210]
surviving nonsolo ucounts = 1[210]
ids = [2]

====================================================================================

UMI info for barcode CTGCGGAGTGGTAACG-1 contig 1 = GGAGGAATCA...
umi ATAGGCTGCG = 213 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
29-380 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CLQYSSSPWTF at 356, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 29, 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2164 = CTGCGGAGTGGTACAG-1

using 6669 reads

====================================================================================

graph has 2876 edges initially, 40 edges after simplification

total ucounts = 400
nonsolo ucounts = 174[2^59, 3^27, 4^24, 5^20, 6^11, 7^2, 8^2, 10, 12, 26, 28, 76, 79, 97, 113, 114, 132, 154, 155, 164, 174, 202, 227, 300, 305^2, 308, 312, 313, 316, 319, 321, 323, 327, 359, 381]
surviving nonsolo ucounts = 27[26, 28, 76, 79, 97, 113, 114, 132, 154, 155, 164, 174, 202, 227, 300, 305^2, 308, 312, 313, 316, 319, 321, 323, 327, 359, 381]
ids = [45, 106, 366, 245, 330, 319, 261, 173, 117, 262, ...]

====================================================================================

UMI info for barcode CTGCGGAGTGGTACAG-1 contig 1 = ATCACATAAC...
umi ACGAAAAGTT = 24 reads: +248 -27 +8 -1 +5 -1 +5 -2 +34 -93 non-validated
umi CACGTTTTTT = 9 reads: -389 +9 -1X +2 -1X +2 -2X +5 -1XX +7 -1XX +4 invalidated
umi GGACCGGTCT = 111 reads: +420 -4 non-validated
umi GGAGCGCCTT = 154 reads: +424 validated
umi TATAAATAAC = 164 reads: +424 validated
umi TATGAGAGGG = 109 reads: +424 validated
umi TGAGCATTTA = 205 reads: +424 validated
umi TGGTTGCTGC = 78 reads: +317 -1 +6 -1X +1 -1 +97 invalidated
umi TTGAACTAGC = 172 reads: +424 validated

UMI info for barcode CTGCGGAGTGGTACAG-1 contig 2 = AGAGCTCTGG...
umi AACAGAGGGG = 302 reads: +385 validated
umi ACTTCCGGTA = 315 reads: +385 validated
umi CACCCGCCAG = 319 reads: +385 validated
umi CCATGTAGGA = 316 reads: +385 validated
umi CCTTTTCACC = 321 reads: +385 validated
umi CGAATAGCCT = 320 reads: +385 validated
umi CGTCGCATCA = 137 reads: +232 -1XX +152 invalidated
umi CTGCACTGGC = 314 reads: +385 validated
umi GAAGCTTCTT = 304 reads: +385 validated
umi GAGTAGAGGT = 361 reads: +385 validated
umi GCCGGCATCC = 306 reads: +385 validated
umi GCCTCCAATG = 80 reads: +348 -2 +17 -1 +17 non-validated
umi GCTACTGTAC = 324 reads: +385 validated
umi GGTGAGACTA = 309 reads: +385 validated
umi TAGAGATCCC = 229 reads: +385 validated
umi TCAGGGTCTT = 97 reads: +385 validated
umi TCTAGCACTA = 384 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=664]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=1)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=28)
432-482 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
482-664 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 5 umis using 69 reads
cdr3 = CARGGENWNIRDAFDIW at 400, score = 9 + 7
umis assigned: [45, 117, 261, 262, 313, 319, 352, 366, 385]
of which 9 are surviving nonsolos
reads assigned: 1013
start codons at 58, 256, 281, 355, 434
confident = true

TIG 2[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=11)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 16 umis using 687 reads
cdr3 = CQQYGSSPFTF at 368, score = 9 + 8
umis assigned: [3, 58, 113, 142, 156, 157, 173, 195, 212, 219] and 7 others
of which 17 are surviving nonsolos
reads assigned: 4658
start codons at 44, 252, 378, 471
confident = true
now this is a cell
paired!

GACACGGCCGTATATTACTGTGCGAGAGGGGGAGAGAACTGGAACATAAGGGATGCTTTTGATATCTGGGGCCAAGGGACATTGGTCGCCGTCTCTTCAG <==> ATCAGCAGACTGGAGCCTGAGGACTTTGCAGTCTATTACTGTCAGCAGTATGGTAGCTCGCCTTTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2167 = CTGCGGAGTTAAAGTG-1

using 331 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[330]
surviving nonsolo ucounts = 1[330]
ids = [1]

====================================================================================

UMI info for barcode CTGCGGAGTTAAAGTG-1 contig 1 = GGGGAGGAAC...
umi TCCATGCCGG = 335 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=551]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-346 ==> 0-310 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=12)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYSSWPTF at 357, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 326
start codons at 36, 237, 241, 244, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2168 = CTGCGGAGTTCTGGTA-1

using 297 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[294]
surviving nonsolo ucounts = 1[294]
ids = [2]

====================================================================================

UMI info for barcode CTGCGGAGTTCTGGTA-1 contig 1 = AGTCTGGGCC...
umi TGAGGCAGAC = 280 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=528]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-385 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=30)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-528 ==> 0-106 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQVWYSNSDHVVF at 355, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 40, 235, 242, 338, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2169 = CTGCGGAGTTGGACCC-1

using 105 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 99]
surviving nonsolo ucounts = 1[99]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2177 = CTGCGGATCACGACTA-1

using 237 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 229]
surviving nonsolo ucounts = 1[229]
ids = [1]

====================================================================================

UMI info for barcode CTGCGGATCACGACTA-1 contig 1 = ATCAGTCCCA...
umi AAGACCAGTT = 213 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=501]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-501 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2184 = CTGCGGATCATTATCC-1

using 332 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[329]
surviving nonsolo ucounts = 1[329]
ids = [2]

====================================================================================

UMI info for barcode CTGCGGATCATTATCC-1 contig 1 = AGGAATCAGA...
umi GAGAACCTAT = 293 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=501]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=17)
380-418 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=4)
418-501 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CQQYRTYPRITF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 27, 33, 89, 102, 238, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2189 = CTGCGGATCCCGACTT-1

using 44 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[8, 36]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2190 = CTGCGGATCCCTAACC-1

using 344 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[8, 332]
surviving nonsolo ucounts = 1[332]
ids = [1]

====================================================================================

UMI info for barcode CTGCGGATCCCTAACC-1 contig 1 = GTCAGACTCA...
umi ATCAGTCCGT = 334 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYNSYPLTF at 350, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 23, 29, 85, 98, 234, 237, 330, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2203 = CTGCGGATCGCGATCG-1

using 7019 reads

====================================================================================

graph has 3741 edges initially, 52 edges after simplification

total ucounts = 669
nonsolo ucounts = 257[2^112, 3^47, 4^22, 5^24, 6^12, 7^4, 8^4, 9^2, 10^3, 11, 16, 20, 35, 48, 70, 124, 131, 146, 161, 178, 206, 235, 242, 250, 284, 293, 301, 315, 316, 320, 329, 330, 333, 338, 363, 459]
surviving nonsolo ucounts = 21[48, 131, 146, 161, 178, 206, 235, 242, 250, 284, 293, 301, 315, 316, 320, 329, 330, 333, 338, 363, 459]
ids = [229, 412, 488, 470, 32, 72, 402, 437, 185, 482, ...]

====================================================================================

UMI info for barcode CTGCGGATCGCGATCG-1 contig 1 = ATCACCCAAA...
umi AAGTCCTGGA = 155 reads: +427 validated
umi GCATGATCAT = 266 reads: +427 validated
umi GCGTATCCGG = 116 reads: +427 validated
umi GTCTCTACTG = 120 reads: +427 validated

UMI info for barcode CTGCGGATCGCGATCG-1 contig 2 = GAAGAGCTGC...
umi ACGGAACATC = 205 reads: +388 validated
umi ATGAGATAGG = 318 reads: +388 validated
umi ATTCTCGTTA = 459 reads: +388 validated
umi ATTGGTCGCA = 247 reads: +388 validated
umi CACTGTATCG = 321 reads: +388 validated
umi CATGGTCCGT = 49 reads: +2 -28 +358 non-validated
umi CCGCTAGCGC = 299 reads: +388 validated
umi CTAAACGGTT = 294 reads: +388 validated
umi GAAAGTATAT = 327 reads: +388 validated
umi GAAGTACTTG = 330 reads: +388 validated
umi GAGACACAAG = 342 reads: +388 validated
umi GAGACTTACG = 332 reads: +388 validated
umi GCCAGTTTTC = 234 reads: +388 validated
umi GCTCCTTCTT = 315 reads: +388 validated
umi GGATGTCATG = 243 reads: +388 validated
umi GTAACTGCTC = 160 reads: +388 validated
umi GTCACCTATT = 287 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=527]
0-57 ==> 2-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
57-410 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=1)
415-446 ==> 0-31 on |14|IGHD2-2|D-REGION| [len=31] (mis=4)
446-484 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
484-527 ==> 0-43 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 4 umis using 70 reads
cdr3 = CARDEDNIVVVPAAMGYW at 399, score = 8 + 7
umis assigned: [32, 398, 412, 488]
of which 4 are surviving nonsolos
reads assigned: 642
start codons at 57, 208, 255, 260, 277, 292, 321, 354, 409, 441, 502
confident = true

TIG 2[bases=557]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 17 umis using 711 reads
cdr3 = CQQYGSSPPYTF at 357, score = 9 + 8
umis assigned: [72, 167, 182, 185, 209, 229, 268, 296, 341, 347] and 7 others
of which 17 are surviving nonsolos
reads assigned: 4689
start codons at 33, 241, 367, 463
confident = true
now this is a cell
paired!

ACGGCCGTGTATTACTGTGCGAGAGATGAAGACAATATTGTAGTAGTACCAGCTGCTATGGGCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCTCCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2213 = CTGCGGATCTCGATGA-1

using 215 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[6, 203]
surviving nonsolo ucounts = 1[203]
ids = [7]

====================================================================================

UMI info for barcode CTGCGGATCTCGATGA-1 contig 1 = AGAGTTCTGG...
umi TTTATCCCTA = 194 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=466]
0-22 ==> 18-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
22-359 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
366-404 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
404-466 ==> 0-62 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CNSRDSSGNHLVF at 337, score = 8 + 9
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 22, 141, 170, 221, 320
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2219 = CTGCTGTAGAAACCGC-1

using 19 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2229 = CTGCTGTAGAGCTTCT-1

using 1521 reads

====================================================================================

graph has 2040 edges initially, 28 edges after simplification

total ucounts = 738
nonsolo ucounts = 325[2^145, 3^70, 4^45, 5^31, 6^12, 7^9, 8^5, 9^4, 11^2, 15, 25]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2238 = CTGCTGTAGATTACCC-1

using 175 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[171]
surviving nonsolo ucounts = 1[171]
ids = [1]

====================================================================================

UMI info for barcode CTGCTGTAGATTACCC-1 contig 1 = GAGCATCACC...
umi CACTTGCTCT = 164 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=531]
0-62 ==> 2-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
62-415 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=5)
438-486 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
486-531 ==> 0-45 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARSLVSYSSSWIFDYW at 404, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 62, 260, 265, 297, 326, 359
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2240 = CTGCTGTAGCATGGCA-1

using 262 reads

====================================================================================

graph has 134 edges initially, 12 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^2, 4, 6, 80, 165]
surviving nonsolo ucounts = 3[6, 80, 165]
ids = [6, 3, 4]

====================================================================================

UMI info for barcode CTGCTGTAGCATGGCA-1 contig 1 = AGGCAGGCAG...
umi CGAGCATCTT = 70 reads: +400 validated

UMI info for barcode CTGCTGTAGCATGGCA-1 contig 2 = GCTTCAGCTG...
umi GAAGCCGGTC = 167 reads: +391 validated
umi GTTTAGTATG = 3 reads: -92 +1 -1X +1 -1X +2 -1X +2 -1XX +3 -3XX +20 -1XX +1 -1XX +1 -1XX +2 -4XX +2 -1XX +1 -1XX +2 -1XX +1 -4X +1 -2X +1 -64X +1 -1X +13 -1 +5 -2X +2 -1X +2 -1 +10 -1X +5 -1 +2 -1X +1 -1X +1 -1X +2 -116 invalidated

GOOD CONTIGS

TIG 1[bases=455]
0-20 ==> 155-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
20-383 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=15)
382-420 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
420-455 ==> 0-35 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CQQYYTTPVTF at 359, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 69
start codons at 20, 162
confident = false

TIG 2[bases=648]
0-46 ==> 5-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
46-386 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
399-437 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
437-648 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQSYDKSLRGAVF at 370, score = 7 + 8
umis assigned: [4, 6]
of which 2 are surviving nonsolos
reads assigned: 166
start codons at 46, 130, 203, 353, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2252 = CTGCTGTAGCTGAACG-1

using 453 reads

====================================================================================

graph has 136 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^2, 3, 4, 158, 280]
surviving nonsolo ucounts = 2[158, 280]
ids = [4, 9]

====================================================================================

UMI info for barcode CTGCTGTAGCTGAACG-1 contig 1 = AGTCAGTCCC...
umi TGTTTGGTCG = 256 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=480]
0-24 ==> 34-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
24-375 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=1)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
412-480 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQLNSYPLTF at 351, score = 9 + 9
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 24, 30, 86, 235, 454
confident = false

REJECT CONTIGS

TIG 1[bases=537]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=1)
0-42 ==> 6347-6389 on rc of segment before IGHV4-4 exon 2 [len=6389] (mis=1)
35-60 ==> 10115-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=2)
42-261 ==> 0-219 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=21)
262-396 ==> 219-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=13) [SHIFT!]
427-470 ==> 20-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
470-537 ==> 0-67 on |40|IGHG1|C-REGION| [len=884] (mis=0)
cdr3 = CARVLKPAAYLYYAMDVW at 385, score = 9 + 6
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 147
start codons at 42, 193, 240, 245, 263, 340, 427
confident = false
frameshifted full length stopped transcript of length 537
VJ delta = 22
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2257 = CTGCTGTAGGAGTTTA-1

using 274 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 266]
surviving nonsolo ucounts = 1[266]
ids = [3]

====================================================================================

UMI info for barcode CTGCTGTAGGAGTTTA-1 contig 1 = AGTCCCAGTC...
umi TCCTGCGAGT = 249 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
0-20 ==> 38-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
20-371 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=1)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
408-490 ==> 0-82 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQLNSYPITF at 347, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 20, 26, 82, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2266 = CTGCTGTAGGGATACC-1

using 244 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 6, 229]
surviving nonsolo ucounts = 1[229]
ids = [3]

====================================================================================

UMI info for barcode CTGCTGTAGGGATACC-1 contig 1 = GGGGAGGAGT...
umi CACTCACCAT = 228 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQSYTTLLTF at 358, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 31, 37, 93, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2267 = CTGCTGTAGGGATGGG-1

using 139 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 131]
surviving nonsolo ucounts = 1[131]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2273 = CTGCTGTAGTACGCGA-1

using 474 reads

====================================================================================

graph has 186 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 4, 175, 289]
surviving nonsolo ucounts = 2[175, 289]
ids = [0, 2]

====================================================================================

UMI info for barcode CTGCTGTAGTACGCGA-1 contig 1 = AGCTTCAGCT...
umi ACCTTTCTCT = 166 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=474]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=16)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-474 ==> 0-39 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2279 = CTGCTGTAGTCCAGGA-1

using 372 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^2, 3, 4, 5, 352]
surviving nonsolo ucounts = 1[352]
ids = [4]

====================================================================================

UMI info for barcode CTGCTGTAGTCCAGGA-1 contig 1 = AGGAGTCAGT...
umi GAAGTATTAC = 357 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
27-364 ==> 0-337 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=27)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CQQMFSIPFTF at 354, score = 6 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 347
start codons at 27, 33, 89, 102, 238, 241, 331, 363, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2280 = CTGCTGTAGTCGTACT-1

using 61 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[61]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2285 = CTGCTGTAGTTTGCGT-1

using 472 reads

====================================================================================

graph has 254 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 168, 294]
surviving nonsolo ucounts = 2[168, 294]
ids = [3, 6]

====================================================================================

UMI info for barcode CTGCTGTAGTTTGCGT-1 contig 1 = ACTGATCAGG...
umi GTGTCAGGCC = 285 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=510]
0-33 ==> 3-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
33-393 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=2)
388-427 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
427-510 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CMQALQTPTF at 369, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 33, 66, 102, 190, 352, 372, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2306 = CTGCTGTCACATGGGA-1

using 83 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 22
nonsolo ucounts = 12[2^2, 5^3, 6, 7^3, 8, 9, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 51.2308 = CTGCTGTCACCAGCAC-1

using 418 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 412]
surviving nonsolo ucounts = 1[412]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=346]
0-99 ==> 254-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=3)
116-164 ==> 15-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
164-346 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
cdr3 = CARVHTVVEDGMDVW at 88, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 403
start codons at 10, 43, 121
confident = false
VJ delta = 23
not full
not full
NOT paired!
sorting bam, mem = 0.12
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk051-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk051-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

105.114 seconds used processing barcodes, peak mem = 0.27
