[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.25 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk040-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk040-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk040.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.0 = CGCGTTTTCTTTAGGG-1

using 891 reads

====================================================================================

graph has 920 edges initially, 8 edges after simplification

total ucounts = 252
nonsolo ucounts = 103[2^53, 3^26, 4^9, 5^5, 6^3, 7, 8, 9, 11, 14, 155, 275]
surviving nonsolo ucounts = 2[155, 275]
ids = [194, 130]

====================================================================================

REJECT CONTIGS

TIG 1[bases=346]
0-19 ==> 1876-1895 on segment before IGHVIII-67-4 exon 1 [len=2213] (mis=0)
0-19 ==> 1877-1896 on segment before IGHVIII-67-4 exon 1 [len=2213] (mis=0)
0-19 ==> 1878-1897 on segment before IGHVIII-67-4 exon 1 [len=2213] (mis=0)
16-263 ==> 106-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=25)
272-322 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=6)
322-346 ==> 0-24 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CAKDVVGGAFDVW at 252, score = 7 + 7
umis assigned: [194]
of which 1 are surviving nonsolos
reads assigned: 106
start codons at 66, 145, 213, 262, 283, 303
confident = false
VJ delta = 10
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.3 = CGCTATCAGACAAAGG-1

using 239 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 234]
surviving nonsolo ucounts = 1[234]
ids = [4]

====================================================================================

UMI info for barcode CGCTATCAGACAAAGG-1 contig 1 = GTCAGTCCCA...
umi GGCCACCATG = 233 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=547]
29-277 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CLHYDNRRRTF at 350, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 29, 85, 98, 237, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.7 = CGCTATCAGAGGGCTT-1

using 1056 reads

====================================================================================

graph has 300 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[443, 608]
surviving nonsolo ucounts = 2[443, 608]
ids = [3, 6]

====================================================================================

UMI info for barcode CGCTATCAGAGGGCTT-1 contig 1 = GAAGAGCTGC...
umi TTGGTAAATA = 573 reads: +388 validated

UMI info for barcode CGCTATCAGAGGGCTT-1 contig 2 = GTGGGTCCAG...
umi CCTGCGTGTG = 440 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=489]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=9)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
421-489 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 85 reads
cdr3 = CQHHGSSPPRTF at 357, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 570
start codons at 33, 241, 367, 463
confident = false

TIG 2[bases=578]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=1)
379-417 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
417-578 ==> 0-161 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 88 reads
cdr3 = CQSADSSGTCVVF at 350, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 426
start codons at 35, 96, 165, 183
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.9 = CGCTATCAGCACCGCT-1

using 178 reads

====================================================================================

graph has 276 edges initially, 2 edges after simplification

total ucounts = 110
nonsolo ucounts = 28[2^19, 3^3, 4, 5, 6, 7, 11, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.17 = CGCTATCAGGAATGGA-1

using 305 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2^2, 295]
surviving nonsolo ucounts = 1[295]
ids = [2]

====================================================================================

UMI info for barcode CGCTATCAGGAATGGA-1 contig 1 = GGAGTCAGAC...
umi CTGTTGGTTA = 268 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=500]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
414-500 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYNGQSRAF at 353, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 26, 32, 101, 237, 240, 333, 366, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.19 = CGCTATCAGGATGGAA-1

using 119 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 114]
surviving nonsolo ucounts = 1[114]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=474]
0-22 ==> 5978-6000 on segment before IGLV4-60 exon 1 [len=6000] (mis=0)
22-381 ==> 0-359 on |374|IGLV4-69|L-REGION+V-REGION| [len=359] (mis=2)
385-423 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
423-474 ==> 0-51 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CQTWGTGIE at 355, score = 8 + 4
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 104
start codons at 22, 183, 223, 239, 338, 384
confident = false
not full
frameshifted full length transcript of length 474
VJ delta = 3
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.24 = CGCTATCAGGTACTCT-1

using 262 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 255]
surviving nonsolo ucounts = 1[255]
ids = [0]

====================================================================================

UMI info for barcode CGCTATCAGGTACTCT-1 contig 1 = GCTGTGCTGT...
umi CATACTATCG = 250 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=505]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
387-425 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
425-505 ==> 0-80 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQSADSSGTYWVF at 358, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 43, 104, 173, 191
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.28 = CGCTATCAGTCACGCC-1

using 120 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[9, 108]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode CGCTATCAGTCACGCC-1 contig 1 = GGACCTCCTG...
umi ATCTATTTCA = 106 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=504]
19-367 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=11)
396-446 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
446-504 ==> 0-58 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARDLLWFGETRAFDIW at 364, score = 9 + 8
umis assigned: [2]
of which 0 are surviving nonsolos
reads assigned: 104
start codons at 19, 63, 381, 427
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.29 = CGCTATCAGTCATCCA-1

using 332 reads

====================================================================================

graph has 139 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[332]
surviving nonsolo ucounts = 1[332]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=496]
3-78 ==> 5665-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
27-79 ==> 0-52 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=0)
79-323 ==> 109-353 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=3)
321-360 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
360-496 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 27, 33, 108, 181, 402
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.30 = CGCTATCAGTCGATAA-1

using 250 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[244]
surviving nonsolo ucounts = 1[244]
ids = [6]

====================================================================================

UMI info for barcode CGCTATCAGTCGATAA-1 contig 1 = GCTGGGGTCT...
umi TCTGCATCAT = 232 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=583]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=2)
394-432 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
432-583 ==> 0-151 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CSSYAGSNNLWVF at 365, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 41, 198, 242, 249, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.39 = CGCTATCCAAACTGCT-1

using 1729 reads

====================================================================================

graph has 2600 edges initially, 16 edges after simplification

total ucounts = 876
nonsolo ucounts = 375[2^171, 3^89, 4^49, 5^24, 6^15, 7^15, 8^6, 9^3, 10^2, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.46 = CGCTATCCAAGCCCAC-1

using 296 reads

====================================================================================

graph has 200 edges initially, 6 edges after simplification

total ucounts = 19
nonsolo ucounts = 16[2^2, 3^2, 4^2, 5^4, 6, 7, 9, 14, 20, 199]
surviving nonsolo ucounts = 1[199]
ids = [16]

====================================================================================

UMI info for barcode CGCTATCCAAGCCCAC-1 contig 1 = GGAGTCAGTC...
umi TTACAATGCT = 179 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=510]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-510 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [16]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 26, 32, 88, 101, 237, 336, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.53 = CGCTATCCACACATGT-1

using 185 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[183]
surviving nonsolo ucounts = 1[183]
ids = [1]

====================================================================================

UMI info for barcode CGCTATCCACACATGT-1 contig 1 = AAGAGGCAGC...
umi CCAAGAGTCT = 181 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
0-30 ==> 132-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
30-370 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=10)
380-418 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
418-490 ==> 0-72 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 23 reads
cdr3 = CCSYAGSSTYVF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 177
start codons at 30, 169, 231, 364, 382, 394
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.55 = CGCTATCCACCGCTAG-1

using 638 reads

====================================================================================

graph has 254 edges initially, 24 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 299, 334]
surviving nonsolo ucounts = 2[299, 334]
ids = [2, 1]

====================================================================================

UMI info for barcode CGCTATCCACCGCTAG-1 contig 1 = GGGGAGTCAG...
umi AACGCTTTCG = 336 reads: +385 validated

UMI info for barcode CGCTATCCACCGCTAG-1 contig 2 = TGGGGAGGAA...
umi ATACGTTGTC = 302 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQSYSTPSF at 355, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 28, 34, 90, 103, 239, 455
confident = false

TIG 2[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.59 = CGCTATCCACGAGGTA-1

using 13 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.70 = CGCTATCCATAAAGGT-1

using 258 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 252]
surviving nonsolo ucounts = 1[252]
ids = [2]

====================================================================================

UMI info for barcode CGCTATCCATAAAGGT-1 contig 1 = AGCTTCAGCT...
umi CCATCAACCT = 246 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=560]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-560 ==> 0-125 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.80 = CGCTATCGTAAGAGAG-1

using 47 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[47]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.83 = CGCTATCGTAATCGTC-1

using 180 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[177]
surviving nonsolo ucounts = 1[177]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=556]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
0-34 ==> 5966-6000 on segment before IGKV3OR2-268 exon 1 [len=6000] (mis=0)
0-34 ==> 5966-6000 on rc of segment after IGKV3-15 exon 1 [len=6000] (mis=0)
7-48 ==> 5709-5750 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 34, 103, 239, 462
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.84 = CGCTATCGTACTTAGC-1

using 256 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 12[2^2, 3^3, 4, 7, 8, 12, 13, 15, 181]
surviving nonsolo ucounts = 1[181]
ids = [3]

====================================================================================

UMI info for barcode CGCTATCGTACTTAGC-1 contig 1 = AGCTCTGAGA...
umi CAATACCTCG = 184 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=556]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-556 ==> 0-53 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 180
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.85 = CGCTATCGTATAAACG-1

using 260 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 3, 250]
surviving nonsolo ucounts = 1[250]
ids = [1]

====================================================================================

UMI info for barcode CGCTATCGTATAAACG-1 contig 1 = AAAAACCACA...
umi CATCAAATAT = 241 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=522]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-522 ==> 0-36 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.87 = CGCTATCGTATGCTTG-1

using 243 reads

====================================================================================

graph has 95 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 6, 228]
surviving nonsolo ucounts = 1[228]
ids = [3]

====================================================================================

UMI info for barcode CGCTATCGTATGCTTG-1 contig 1 = AGCTTCAGCT...
umi CCCGGTGCCT = 226 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=536]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=1)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=30)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
435-536 ==> 0-101 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CAAWDDILNGVVF at 368, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 47, 261, 351, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.94 = CGCTATCGTCGCTTCT-1

using 151 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[150]
surviving nonsolo ucounts = 1[150]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.96 = CGCTATCGTCTGATCA-1

using 116 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 28
nonsolo ucounts = 19[2^5, 3^4, 5^2, 6^3, 9^2, 10, 13, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.103 = CGCTATCGTGGCTCCA-1

using 334 reads

====================================================================================

graph has 106 edges initially, 4 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[160, 174]
surviving nonsolo ucounts = 2[160, 174]
ids = [1, 0]

====================================================================================

UMI info for barcode CGCTATCGTGGCTCCA-1 contig 1 = AGCTTCAGCT...
umi AGCACTCCTG = 164 reads: +388 validated

UMI info for barcode CGCTATCGTGGCTCCA-1 contig 2 = ATACTTTCTG...
umi ATGCTTTTCA = 154 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=459]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-459 ==> 0-24 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 162
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=579]
0-37 ==> 27-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
37-390 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=9)
413-461 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
461-579 ==> 0-118 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 13 reads
cdr3 = CARGAGITTRAYYFDYW at 379, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 154
start codons at 16, 37, 81
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.106 = CGCTATCGTTAGGGTG-1

using 227 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 222]
surviving nonsolo ucounts = 1[222]
ids = [2]

====================================================================================

UMI info for barcode CGCTATCGTTAGGGTG-1 contig 1 = GGGGGGTCTC...
umi TCACTCTCTT = 216 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=454]
40-394 ==> 0-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
393-431 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
431-454 ==> 0-23 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CSSYTSSSTLAVF at 364, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 40, 197, 241, 248, 251
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.113 = CGCTATCTCAACTCTT-1

using 526 reads

====================================================================================

graph has 195 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 3, 513]
surviving nonsolo ucounts = 1[513]
ids = [6]

====================================================================================

UMI info for barcode CGCTATCTCAACTCTT-1 contig 1 = GGGCTGGTCG...
umi GTACCGTGCT = 516 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=571]
0-47 ==> 0-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
47-398 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
397-435 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 76 reads
cdr3 = CQQSYRRPITF at 374, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 508
start codons at 47, 53, 109, 122, 258, 357, 477
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.118 = CGCTATCTCAGAGACG-1

using 242 reads

====================================================================================

graph has 206 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[240]
surviving nonsolo ucounts = 1[240]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.122 = CGCTATCTCATTTGGG-1

using 14 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.126 = CGCTATCTCCACTGGG-1

using 227 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 224]
surviving nonsolo ucounts = 1[224]
ids = [1]

====================================================================================

UMI info for barcode CGCTATCTCCACTGGG-1 contig 1 = GCTTTCTGAG...
umi CGCAGGCTTT = 224 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=572]
14-389 ==> 0-375 on |188|IGHV4-39|L-REGION+V-REGION| [len=375] (mis=33)
414-462 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
462-572 ==> 0-110 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 42 reads
cdr3 = CARSVHFYETVGYFDYW at 380, score = 9 + 6
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 14, 23, 35, 79, 402
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.128 = CGCTATCTCCCAACGG-1

using 8397 reads

====================================================================================

graph has 4105 edges initially, 34 edges after simplification

total ucounts = 628
nonsolo ucounts = 271[2^110, 3^52, 4^31, 5^19, 6^10, 7^6, 8^3, 9^4, 11^3, 12, 14, 15, 23, 104, 109, 113, 117, 124, 160, 167, 187, 190, 197, 199, 205, 206, 219, 225, 247, 249, 281, 283, 298, 311, 316, 328, 337, 344, 360, 378, 429, 503]
surviving nonsolo ucounts = 29[104, 109, 113, 117, 124, 160, 167, 187, 190, 197, 199, 205, 206, 219, 225, 247, 249, 281, 283, 298, 311, 316, 328, 337, 344, 360, 378, 429, 503]
ids = [324, 12, 173, 406, 285, 331, 11, 34, 223, 487, ...]

====================================================================================

UMI info for barcode CGCTATCTCCCAACGG-1 contig 1 = AGGAGTCAGA...
umi ATAAACAATA = 339 reads: +382 validated
umi ATCATAACCC = 324 reads: +382 validated
umi ATGTACTGAC = 235 reads: +7 -1XX +100 -1XX +273 invalidated
umi CAAGAAGTGA = 113 reads: +382 validated
umi CACGGCGCCC = 208 reads: +382 validated
umi CAGTCTACTA = 361 reads: +382 validated
umi CCATCAGTCA = 189 reads: +382 validated
umi CGATCTTTTT = 341 reads: +382 validated
umi CGGCTGGCAT = 281 reads: +382 validated
umi CTTCACTGGT = 104 reads: +382 validated
umi GAGATTAGTG = 319 reads: +382 validated
umi GGGGCGCGGT = 314 reads: +382 validated
umi GTACACTCAC = 118 reads: +382 validated
umi TAAACGTGCA = 281 reads: +382 validated
umi TCAGCAGTCA = 249 reads: +382 validated
umi TGGAACAGCA = 248 reads: +382 validated
umi TTTTCTTCAA = 220 reads: +382 validated

UMI info for barcode CGCTATCTCCCAACGG-1 contig 2 = GAGCTCTGGG...
umi AAGCTGTTTT = 167 reads: +391 -1X +22 -1 +3 -1 +9 -1 +5 -1 +2 -1 +1 invalidated
umi AAGGCGATTC = 112 reads: +381 -1 +57 non-validated
umi ACCACGATGA = 187 reads: +439 validated
umi ACGTCACGCA = 303 reads: +439 validated
umi CATGTCTTTT = 202 reads: +439 validated
umi CGCTATATCG = 40 reads: -329X +110 invalidated
umi CGTGTATTGG = 123 reads: +439 validated
umi CTTTCGCTCT = 161 reads: +439 validated
umi TATTTATGTT = 198 reads: +433 -6 non-validated
umi TCAAACCTTT = 196 reads: +439 validated
umi TTATTCGTTT = 378 reads: -138X +301 invalidated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=0)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 17 umis using 663 reads
cdr3 = CQQYYSYPPTF at 354, score = 9 + 8
umis assigned: [107, 125, 146, 173, 187, 195, 223, 259, 276, 324] and 7 others
of which 17 are surviving nonsolos
reads assigned: 4165
start codons at 33, 89, 102, 238, 457
confident = true

TIG 2[bases=590]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=0)
468-519 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=0)
519-590 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 172 reads
cdr3 = CARDATIIGSSYHDPYNWFDPW at 422, score = 9 + 7
umis assigned: [11, 12, 34, 51, 205, 270, 285, 331, 485, 487] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2019
start codons at 80, 231, 236, 289, 294, 297, 315, 383, 459
confident = true

REJECT CONTIGS

TIG 1[bases=459]
3-306 ==> 807-1110 on rc of segment before IGHD3-16 exon 1 [len=1110] (mis=2)
325-388 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
388-459 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [280]
of which 1 are surviving nonsolos
reads assigned: 499
start codons at 157, 216, 345
confident = false
did not find CDR3
now this is a cell
paired!

TACTGTGCGAGAGACGCCACTATTATAGGGAGTAGCTACCATGATCCGTACAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCTGCCTGCAGTCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTTACCCTCCCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.136 = CGCTATCTCGGCCGAT-1

using 180 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[180]
surviving nonsolo ucounts = 1[180]
ids = [0]

====================================================================================

UMI info for barcode CGCTATCTCGGCCGAT-1 contig 1 = GGGGTCTCCC...
umi ATTATATTCC = 167 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=509]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=2)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=7)
435-483 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
483-509 ==> 0-26 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARHQGNDYGEKPFDYW at 401, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 59, 257, 392, 420
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.146 = CGCTATCTCTATCCTA-1

using 7608 reads

====================================================================================

graph has 5515 edges initially, 58 edges after simplification

total ucounts = 1264
nonsolo ucounts = 583[2^249, 3^130, 4^73, 5^44, 6^29, 7^11, 8^8, 9^6, 10^2, 11^4, 12, 13, 15, 16^2, 17, 20, 21, 22, 24, 152, 156, 157, 160^2, 239, 275, 278^2, 281, 287, 294, 307, 358, 436, 532, 568]
surviving nonsolo ucounts = 17[17, 152, 156, 160^2, 239, 275, 278^2, 281, 287, 294, 307, 358, 436, 532, 568]
ids = [466, 505, 453, 196, 484, 80, 1224, 21, 1162, 590, ...]

====================================================================================

UMI info for barcode CGCTATCTCTATCCTA-1 contig 1 = TGGGGAGGAA...
umi AAATTATCGT = 273 reads: +388 validated
umi ACACAGCGGG = 237 reads: +388 validated
umi ATACACTTAA = 541 reads: -222X +166 invalidated
umi CCGTCCCTTA = 152 reads: +388 validated
umi CGGGCTGCTC = 279 reads: +388 validated
umi CGTAGACAGT = 565 reads: -258X +130 invalidated
umi CGTTGTATCG = 282 reads: +388 validated
umi TACTCTACGA = 294 reads: +388 validated
umi TGACGTACTA = 365 reads: +388 validated
umi TGGCAGCCCG = 286 reads: +388 validated
umi TTGCCACACG = 274 reads: +388 validated

UMI info for barcode CGCTATCTCTATCCTA-1 contig 2 = CTCCTCTGAA...
umi AGTACGGTTG = 124 reads: +406 -1 +4 -4 non-validated
umi CCCCACCGGC = 146 reads: +411 -4 non-validated
umi CCCTGTTAAC = 128 reads: +415 validated
umi GCTAGTTGGG = 248 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=1)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 11 umis using 608 reads
cdr3 = CLQHNSYPYTF at 359, score = 9 + 8
umis assigned: [21, 80, 210, 505, 590, 598, 626, 1011, 1132, 1162] and 1 others
of which 11 are surviving nonsolos
reads assigned: 3492
start codons at 32, 38, 107, 189, 243, 462
confident = true

TIG 2[bases=510]
0-38 ==> 23-61 on |84|IGHV1-69|5'UTR| [len=61] (mis=0)
38-391 ==> 0-353 on |85|IGHV1-69|L-REGION+V-REGION| [len=353] (mis=2)
402-453 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=3)
453-510 ==> 0-57 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 2 umis using 45 reads
cdr3 = CARSGFVVDWFDPW at 380, score = 9 + 7
umis assigned: [196, 453, 484, 866]
of which 4 are surviving nonsolos
reads assigned: 638
start codons at 38, 189, 236, 335, 471
confident = true
now this is a cell
paired!

AGATCTGAGGACACGGCCGTGTATTACTGTGCGAGATCTGGGTTCGTGGTAGACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCTACAGCATAATAGTTACCCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.152 = CGCTATCTCTCCCTGA-1

using 233 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2^2, 222]
surviving nonsolo ucounts = 1[222]
ids = [1]

====================================================================================

UMI info for barcode CGCTATCTCTCCCTGA-1 contig 1 = TGGGGAGTGA...
umi CCTTATTTTA = 215 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=589]
25-383 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
408-458 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
458-589 ==> 0-131 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 30 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 370, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 25, 69, 248, 251, 254, 340, 410
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.154 = CGCTATCTCTCTGTCG-1

using 524 reads

====================================================================================

graph has 190 edges initially, 6 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 229, 289]
surviving nonsolo ucounts = 2[229, 289]
ids = [4, 2]

====================================================================================

UMI info for barcode CGCTATCTCTCTGTCG-1 contig 1 = AAGTCTCTCT...
umi GATTGCGCTC = 231 reads: +391 validated

UMI info for barcode CGCTATCTCTCTGTCG-1 contig 2 = GATCAGGACT...
umi CGAGCTGGGA = 290 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=552]
0-25 ==> 6-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=1)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQKYNSAPPGTF at 352, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 25, 31, 87, 100, 236, 335, 458
confident = false

TIG 2[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=7)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CMQALQTPPTF at 366, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 286
start codons at 30, 63, 99, 150, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.155 = CGCTATCTCTGACCTC-1

using 20684 reads

====================================================================================

graph has 8104 edges initially, 136 edges after simplification

total ucounts = 1468
nonsolo ucounts = 671[2^255, 3^163, 4^76, 5^50, 6^26, 7^18, 8^10, 9^3, 10^5, 11, 13, 14^3, 28, 38^2, 62, 72, 112, 113^2, 122, 124, 130, 134, 146, 148, 152, 165, 173, 175, 214, 225^3, 228, 229, 233, 234, 239, 243, 250, 252, 255, 262, 266, 280, 282, 287, 293, 294, 304, 308^2, 309, 311, 317, 333, 349, 363, 364, 385, 386, 390, 435, 448, 452, 529, 662, 739, 792, 850, 1433]
surviving nonsolo ucounts = 57[2, 4, 38, 62, 72, 112, 113, 122, 124, 130, 134, 146, 148, 173, 175, 214, 225^3, 228, 229, 233, 234, 239, 243, 250, 252, 255, 262, 266, 280, 282, 287, 293, 294, 304, 308^2, 309, 311, 317, 333, 349, 363, 364, 385, 386, 390, 435, 448, 452, 529, 662, 739, 792, 850, 1433]
ids = [633, 991, 1266, 828, 1164, 3, 1129, 878, 475, 711, ...]

====================================================================================

UMI info for barcode CGCTATCTCTGACCTC-1 contig 1 = GAGGGTCCTG...
umi AAAATGTGGG = 114 reads: +430 validated
umi AGGCTTTTCG = 303 reads: +122 -2XX +1 -2XX +1 -1XX +3 -3XX +295 invalidated
umi AGTATTGATA = 135 reads: +430 validated
umi ATAATTTTTG = 312 reads: +430 validated
umi CACATCTTTA = 248 reads: +430 validated
umi CAGCGCTTGC = 124 reads: +430 validated
umi CTCAACTCTA = 223 reads: +430 validated
umi CTGAAACCGT = 232 reads: +430 validated
umi CTGCGGGTTC = 129 reads: +430 validated
umi GCTCTACTCT = 119 reads: +430 validated
umi GGAGTAAGGT = 242 reads: +430 validated
umi GTAATGGTTT = 226 reads: +430 validated
umi GTTCCTCATC = 288 reads: +430 validated
umi TAACTCATTG = 284 reads: +430 validated
umi TACCTACTTC = 1 reads: -430 non-validated
umi TCACGCCGTA = 113 reads: +430 validated
umi TCCTACCACT = 72 reads: +427 -1 +2 non-validated
umi TGCCTCTATG = 38 reads: +318 -11 +9 -1 +2 -2 +2 -1 +60 -2 +22 non-validated
umi TTTTATCGAT = 225 reads: +430 validated

UMI info for barcode CGCTATCTCTGACCTC-1 contig 2 = GGGAGAGCCC...
umi AAACCATCGG = 308 reads: +388 validated
umi AACTGAGACC = 145 reads: +388 validated
umi ACTAGCTCCT = 256 reads: +388 validated
umi AGACATCGAA = 236 reads: +388 validated
umi AGCCTTACAA = 242 reads: +388 validated
umi ATATCCATAA = 259 reads: +188 -1XX +199 invalidated
umi ATTCCTGTTT = 314 reads: +388 validated
umi CACTAAGGGA = 309 reads: +388 validated
umi CGACTCTGTA = 397 reads: -345 +1 -2XX +1 -2XX +1 -2XX +2 -1XX +7 -2XX +8 -1XX +5 -1XX +7 invalidated
umi CGTTGAATCG = 120 reads: -11X +1 -3XX +2 -6XX +1 -1XX +1 -5XX +1 -2XX +2 -1XX +1 -5XX +1 -2XX +342 invalidated
umi GATGCCCGAG = 296 reads: +388 validated
umi GCACGGGCAT = 62 reads: +388 validated
umi GTGCAATTCA = 215 reads: +388 validated
umi TCATTGAGAC = 340 reads: -348X +1 -2XX +1 -2XX +2 -1XX +7 -2XX +8 -1XX +5 -1XX +7 invalidated
umi TCTATTAAGC = 263 reads: +388 validated
umi TCTTGTCACA = 169 reads: -92X +2 -7XX +1 -4XX +3 -4XX +1 -1XX +273 invalidated
umi TGAGGATCTT = 223 reads: +388 validated
umi TGCATTGGCA = 715 reads: -348 +1 -2X +1 -2X +2 -1XX +7 -2XX +8 -1XX +5 -1XX +7 invalidated
umi TGGCGTGCAT = 294 reads: +388 validated
umi TGTCCACGAG = 312 reads: +388 validated
umi TTGACACGTC = 269 reads: +388 validated
umi TTGGTATTAT = 227 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=649]
59-407 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=13)
438-489 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=1)
489-649 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 17 umis using 436 reads
cdr3 = CARAPWASTTSQNWFDPW at 404, score = 9 + 7
umis assigned: [3, 269, 277, 305, 440, 475, 659, 702, 711, 878] and 9 others
of which 18 are surviving nonsolos
reads assigned: 3371
start codons at 15, 59, 103, 326, 543
confident = true

TIG 2[bases=571]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
397-435 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 19 umis using 763 reads
cdr3 = CQQRSNWPPLFTF at 368, score = 9 + 8
umis assigned: [8, 58, 196, 229, 251, 317, 389, 465, 581, 629] and 12 others
of which 22 are surviving nonsolos
reads assigned: 5872
start codons at 47, 252, 477
confident = true

REJECT CONTIGS

TIG 1[bases=351]
0-35 ==> 4708-4743 on rc of segment before IGHVII-28-1 exon 1 [len=4743] (mis=0)
0-35 ==> 4692-4727 on rc of segment before IGHVII-30-21 exon 1 [len=4727] (mis=0)
0-35 ==> 3481-3516 on rc of segment before IGHV3-60 exon 2 [len=3516] (mis=0)
0-35 ==> 3550-3585 on rc of segment before IGHV3-62 exon 2 [len=3585] (mis=0)
35-183 ==> 0-148 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=1)
237-280 ==> 18-61 on |58|IGHJ6|J-REGION| [len=61] (mis=0)
280-351 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [435]
of which 1 are surviving nonsolos
reads assigned: 627
start codons at 35, 79, 204, 237
confident = false
frameshifted full length transcript of length 351
did not find CDR3

TIG 2[bases=568]
3-50 ==> 5900-5947 on segment before IGLV3-30 exon 1 [len=6000] (mis=3)
64-102 ==> 5962-6000 on segment before IGLV3-30 exon 1 [len=6000] (mis=6)
75-107 ==> 5623-5655 on segment before IGLV3-29 exon 1 [len=6000] (mis=1)
102-342 ==> 0-240 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=5)
357-568 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [13, 188, 326, 378, 405, 449, 548, 642, 728, 756] and 4 others
of which 14 are surviving nonsolos
reads assigned: 7014
start codons at 102, 107, 250, 352
confident = false
did not find CDR3
now this is a cell
paired!

ACGGCCGTGTATTTCTGTGCGCGAGCCCCCTGGGCTAGCACTACCAGCCAAAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCCTGGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCCTCCTTTATTCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.169 = CGCTGGAAGACCGGAT-1

using 182 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 175]
surviving nonsolo ucounts = 1[175]
ids = [3]

====================================================================================

UMI info for barcode CGCTGGAAGACCGGAT-1 contig 1 = GTGGGCTCAG...
umi CCCACCATGC = 166 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=551]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=16)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
420-551 ==> 0-131 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CYSTDNSGRHSGMF at 350, score = 6 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 165
start codons at 35, 96, 183, 230, 234, 333, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.173 = CGCTGGAAGACTTTCG-1

using 34230 reads

====================================================================================

graph has 10198 edges initially, 100 edges after simplification

total ucounts = 1154
nonsolo ucounts = 528[2^184, 3^99, 4^59, 5^28, 6^11, 7^9, 8^4, 9^5, 11^2, 13^2, 14, 15^2, 17, 18, 19, 22, 23, 33, 38, 49, 66, 79^2, 89, 103, 116, 125, 131, 136, 145, 148, 155, 167, 172, 174, 179, 180, 185, 187, 189^3, 198^2, 199, 200, 208^2, 211^2, 217, 219, 221^2, 223, 226^2, 228, 229, 230^2, 238, 244, 248, 250^2, 252, 253, 255^2, 256, 259, 260, 263, 265, 266^2, 269, 273, 277, 278, 283, 284^2, 287, 289, 290, 291, 300, 302, 303, 308^2, 309^2, 312, 313, 315, 317^3, 318, 321, 322, 323, 325, 327, 329^2, 330, 331, 335, 337, 341, 342, 343, 352, 356, 366, 373, 390, 402, 413, 432, 436, 501, 528, 529, 548, 552, 573, 592, 593, 656]
surviving nonsolo ucounts = 107[33, 66, 103, 125, 136, 145, 148, 155, 167, 172, 174, 180, 185, 187, 189^3, 198^2, 199, 200, 208^2, 211^2, 217, 219, 221^2, 223, 226^2, 228, 229, 230^2, 238, 244, 248, 250^2, 252, 253, 255^2, 256, 259, 260, 263, 265, 266^2, 269, 273, 277, 278, 283, 284^2, 287, 289, 290, 291, 300, 302, 303, 308^2, 309^2, 312, 313, 315, 317^3, 318, 321, 322, 323, 325, 327, 329, 330, 331, 335, 337, 341, 342, 343, 352, 356, 366, 373, 390, 402, 413, 432, 436, 528, 529, 548, 552, 573, 592, 593, 656]
ids = [1117, 360, 201, 855, 239, 766, 1095, 385, 619, 758, ...]

====================================================================================

UMI info for barcode CGCTGGAAGACTTTCG-1 contig 1 = GAAGAGCTGC...
umi AAAAACACGT = 347 reads: +385 validated
umi AAAACAATAC = 336 reads: +385 validated
umi AAAAGGCGCA = 270 reads: +385 validated
umi AAACATAGGA = 308 reads: +385 validated
umi AAATGTCACC = 198 reads: +385 validated
umi AAGAATTTGT = 485 reads: -347X +2 -2XX +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi AAGGCGTCCT = 345 reads: +385 validated
umi AATACTTCTT = 279 reads: +385 validated
umi AATCGGGCCA = 212 reads: +385 validated
umi ACAGTGACCT = 234 reads: +385 validated
umi ACATTCACCT = 221 reads: +385 validated
umi ACCCGAACTA = 323 reads: +385 validated
umi ACCCTATGTT = 254 reads: +385 validated
umi ACGAATCTAA = 328 reads: +385 validated
umi ACGCGATACA = 201 reads: +385 validated
umi ACGTGGTGGG = 285 reads: +385 validated
umi ACTAATCGGT = 187 reads: +385 validated
umi ACTTACAGCG = 372 reads: +385 validated
umi AGCTCAGCTC = 317 reads: +385 validated
umi AGCTTGCAAG = 205 reads: +385 validated
umi AGCTTTTACT = 210 reads: +385 validated
umi AGGCCTAGCA = 255 reads: +385 validated
umi AGGCGCGCGG = 230 reads: +385 validated
umi AGGGCTCATT = 275 reads: -347X +2 -2XX +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi AGGGGTGGTT = 285 reads: +385 validated
umi AGGTAAAAGC = 315 reads: +385 validated
umi ATAGGGTAAC = 221 reads: +385 validated
umi ATGTGTTGCA = 2 reads: -359 +3 -1X +9 -1X +4 -1X +7 invalidated
umi CACAGGCTCA = 204 reads: +385 validated
umi CACGACCGGA = 316 reads: +385 validated
umi CACTAAGCGC = 333 reads: +385 validated
umi CATCGGGTAT = 263 reads: +353 -1XX +31 invalidated
umi CATGCGCATG = 227 reads: +385 validated
umi CATTTATTGG = 283 reads: +385 validated
umi CCACACTGGA = 256 reads: +385 validated
umi CCATGTGCTG = 297 reads: +385 validated
umi CCCAGTCACC = 421 reads: -347X +2 -2X +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi CCCCCGGATT = 235 reads: +385 validated
umi CCTTGGTCAC = 267 reads: +385 validated
umi CGAAACGGGC = 171 reads: -347X +2 -2XX +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi CGATGGTGGG = 24 reads: -331X +1 -10XX +1 -4XX +38 invalidated
umi CGCAGACTCA = 183 reads: +385 validated
umi CGCCCCGCCA = 183 reads: +385 validated
umi CGTATACTGT = 297 reads: +385 validated
umi CTCGCCACCG = 17 reads: +45 -1 +3 -1X +1 -4X +36 -294 invalidated
umi CTCTTAGTCC = 189 reads: +385 validated
umi CTGAATGGGG = 401 reads: +385 validated
umi CTTATTAATG = 316 reads: +385 validated
umi CTTCCGCTCT = 164 reads: +385 validated
umi CTTGGGTGCT = 340 reads: +385 validated
umi CTTTCGTCTG = 388 reads: +385 validated
umi GAAAGTGTTC = 309 reads: +385 validated
umi GAATTCGTGT = 331 reads: +385 validated
umi GACGTGTTCA = 659 reads: +385 validated
umi GATGCAACCC = 355 reads: +385 validated
umi GCCCAGCTAG = 240 reads: +385 validated
umi GCCTTCGCAG = 252 reads: +385 validated
umi GCGGGCTATC = 303 reads: +385 validated
umi GCTTTTTGGC = 209 reads: +385 validated
umi GGATTTCGGA = 260 reads: +385 validated
umi GGCATCCGGA = 280 reads: +385 validated
umi GGCCAGGGGG = 143 reads: +385 validated
umi GGCCTCTAAC = 250 reads: +385 validated
umi GGGACTCCTC = 365 reads: +385 validated
umi GGGAGTCTCA = 305 reads: +385 validated
umi GTCCAGTCGG = 289 reads: +385 validated
umi GTCCGTACAC = 531 reads: +385 validated
umi GTGAGGTTCA = 264 reads: +385 validated
umi GTTAAGGGAT = 230 reads: +385 validated
umi TAATAGCCAC = 231 reads: -258X +127 invalidated
umi TAATTTCTGA = 364 reads: +385 validated
umi TAATTTTCAG = 332 reads: -331X +1 -10XX +1 -4XX +38 invalidated
umi TAGTTATGCT = 164 reads: +385 validated
umi TAGTTGCAGC = 326 reads: +385 validated
umi TATGGTGTGC = 260 reads: +385 validated
umi TCAACGTATA = 293 reads: +385 validated
umi TCCAGGTTCT = 198 reads: -358 +4 -1X +9 -1XX +4 -1XX +7 invalidated
umi TCCTCGCGTA = 311 reads: +385 validated
umi TGATACCGAC = 302 reads: +385 validated
umi TGATTCTTGA = 221 reads: +385 validated
umi TGCCCACGGA = 248 reads: +385 validated
umi TGTCAATCGG = 288 reads: +385 validated
umi TTCCTTGCTC = 554 reads: +385 validated
umi TTGGCTTTGG = 322 reads: +385 validated
umi TTTATTCGGC = 304 reads: +385 validated
umi TTTCCGCCTA = 322 reads: +14 -3X +1 -5XX +1 -6XX +1 -1XX +3 -1XX +349 invalidated
umi TTTGCACGGG = 258 reads: +385 validated
umi TTTTTCGCCA = 202 reads: +385 validated

UMI info for barcode CGCTGGAAGACTTTCG-1 contig 2 = AGCATCACAT...
umi ACTGCCTTAG = 324 reads: +418 validated
umi AGCTTTCCGC = 102 reads: +376 -3 +1 -4X +3 -2X +4 -5X +10 -10 invalidated
umi ATTGAGTATG = 191 reads: +418 validated
umi CACACGCTGG = 56 reads: -1 +404 -13 non-validated
umi CAGCACAAAT = 153 reads: +418 validated
umi CGGCGCACCC = 320 reads: +418 validated
umi CTCCCGTGCC = 347 reads: +149 -3XX +1 -1XX +1 -1XX +1 -7XX +1 -3XX +3 -41XX +2 -18X +1 -7XX +178 invalidated
umi GAATATACGG = 251 reads: +18 -1XX +399 invalidated
umi GCTGTCACCT = 215 reads: +418 validated
umi GGATCGTGCG = 184 reads: +149 -2XX +1 -3XX +1 -2XX +2 -5XX +2 -1XX +1 -1XX +1 -2XX +1 -27 +1 -1X +1 -1XX +2 -1XX +1 -12XX +1 -4XX +192 invalidated
umi GTTTACAACG = 132 reads: +131 -1XX +259 -1X +3 -23 invalidated
umi TATTACGGTG = 636 reads: +149 -5XX +1 -1XX +2 -1XX +1 -4XX +2 -4XX +1 -60XX +2 -5XX +1 -9XX +1 -4XX +165 invalidated
umi TGTCTTATCC = 227 reads: +418 validated
umi TTCTTATCGT = 150 reads: +418 validated
umi TTGGGACTAT = 34 reads: +300 -1 +26 -1 +90 non-validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=8)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 78 umis using 3531 reads
cdr3 = CQHYGSSPYTF at 357, score = 9 + 8
umis assigned: [0, 1, 3, 11, 24, 53, 65, 71, 83, 105] and 78 others
of which 85 are surviving nonsolos
reads assigned: 23960
start codons at 33, 102, 241, 367, 460
confident = true

TIG 2[bases=550]
0-61 ==> 0-61 on |84|IGHV1-69|5'UTR| [len=61] (mis=0)
61-414 ==> 0-353 on |85|IGHV1-69|L-REGION+V-REGION| [len=353] (mis=10)
433-479 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
479-550 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 10 umis using 211 reads
cdr3 = CARSWDQLEPYFPYW at 403, score = 9 + 7
umis assigned: [156, 201, 329, 360, 385, 531, 581, 657, 746, 758] and 5 others
of which 15 are surviving nonsolos
reads assigned: 3201
start codons at 61, 212, 259, 358
confident = true
now this is a cell
paired!

TCTGAGGACACGGCCGTGTATTACTGTGCGAGGAGTTGGGACCAACTGGAACCATACTTCCCCTATTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAACACTATGGTAGCTCACCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.183 = CGCTGGAAGCAGACTG-1

using 234 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[232]
surviving nonsolo ucounts = 1[232]
ids = [1]

====================================================================================

UMI info for barcode CGCTGGAAGCAGACTG-1 contig 1 = GCTCCAAACA...
umi GCCCACCCGT = 206 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=536]
42-394 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=15)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
430-536 ==> 0-106 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CSAWDSSLNVWVF at 363, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 42, 181, 371, 388
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.194 = CGCTGGAAGGACTGGT-1

using 174 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[174]
surviving nonsolo ucounts = 1[174]
ids = [0]

====================================================================================

UMI info for barcode CGCTGGAAGGACTGGT-1 contig 1 = GGGGTCACAA...
umi GCTGGGCACT = 175 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=473]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
432-473 ==> 0-41 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CCSEAGGGVPGLLF at 362, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 171
start codons at 38, 192
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.196 = CGCTGGAAGGCATTGG-1

using 247 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[246]
surviving nonsolo ucounts = 1[246]
ids = [1]

====================================================================================

UMI info for barcode CGCTGGAAGGCATTGG-1 contig 1 = GATCAGGACT...
umi TCCCTGTTCC = 247 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=22)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CMQGLQTPLTF at 366, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 30, 63, 99, 181, 187, 206, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.205 = CGCTGGAAGTGGAGAA-1

using 402 reads

====================================================================================

graph has 190 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 393]
surviving nonsolo ucounts = 1[393]
ids = [5]

====================================================================================

UMI info for barcode CGCTGGAAGTGGAGAA-1 contig 1 = GGGGAGGAAC...
umi TAAAATACCA = 393 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=551]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQRSNRLTF at 357, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 387
start codons at 36, 241, 244, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.207 = CGCTGGAAGTGTCCCG-1

using 175 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 168]
surviving nonsolo ucounts = 1[168]
ids = [4]

====================================================================================

UMI info for barcode CGCTGGAAGTGTCCCG-1 contig 1 = AAAACCACAC...
umi TAGTCATATC = 156 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=495]
0-49 ==> 10-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
49-402 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
451-485 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 391, score = 7 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 154
start codons at 49, 247, 252, 269, 313, 346
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.216 = CGCTGGACAAGCCGTC-1

using 257 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 5, 248]
surviving nonsolo ucounts = 1[248]
ids = [3]

====================================================================================

UMI info for barcode CGCTGGACAAGCCGTC-1 contig 1 = GAGCTGCTCA...
umi TGCCCGGTAC = 245 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYGSSPMYTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 30, 79, 238, 337, 378, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.221 = CGCTGGACAATCTACG-1

using 1839 reads

====================================================================================

graph has 1830 edges initially, 32 edges after simplification

total ucounts = 716
nonsolo ucounts = 256[2^106, 3^65, 4^39, 5^14, 6^7, 7^8, 8^5, 9^5, 10^2, 11^2, 12, 205, 304]
surviving nonsolo ucounts = 2[205, 304]
ids = [287, 326]

====================================================================================

UMI info for barcode CGCTGGACAATCTACG-1 contig 1 = CTCTCTCAGT...
umi CTATAGGTCA = 285 reads: +388 validated

UMI info for barcode CGCTGGACAATCTACG-1 contig 2 = GGCTGGGGTC...
umi CGACTCATTG = 200 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=492]
0-21 ==> 10-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=0)
21-372 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=0)
371-409 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
409-492 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQKYNSAPRTF at 348, score = 9 + 8
umis assigned: [326]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 21, 27, 83, 96, 232, 331, 451
confident = false

TIG 2[bases=584]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-394 ==> 0-352 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=0)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
430-584 ==> 0-154 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CCSYAGSYTWVF at 366, score = 8 + 8
umis assigned: [287]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 42, 181, 199, 243, 250, 253, 349, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.222 = CGCTGGACAATGGACG-1

using 55 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[7, 43]
surviving nonsolo ucounts = 1[43]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.223 = CGCTGGACAATGGAGC-1

using 139 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 5, 124]
surviving nonsolo ucounts = 1[124]
ids = [8]

====================================================================================

UMI info for barcode CGCTGGACAATGGAGC-1 contig 1 = TCTCAGTCAG...
umi TGTATATCCC = 103 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=406]
18-371 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=7)
368-406 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
junction support: 1 umis using 20 reads
cdr3 = CQQSYNPPPTF at 345, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 103
start codons at 18, 24, 80, 93, 229
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.224 = CGCTGGACAATGTAAG-1

using 8675 reads

====================================================================================

graph has 4479 edges initially, 64 edges after simplification

total ucounts = 861
nonsolo ucounts = 370[2^157, 3^73, 4^44, 5^21, 6^16, 7^11, 8^10, 9^3, 10^2, 12, 14, 15, 16, 39, 109, 121, 156, 158, 167^2, 169, 185, 187, 193, 200, 211, 229, 233, 245^2, 251, 267, 273, 280, 288, 289, 325, 361, 373, 397, 398, 497]
surviving nonsolo ucounts = 29[39, 109, 121, 156, 158, 167^2, 169, 185, 187, 193, 200, 211, 229, 233, 245^2, 251, 267, 273, 280, 288, 289, 325, 361, 373, 397, 398, 497]
ids = [637, 435, 313, 846, 272, 61, 771, 33, 462, 822, ...]

====================================================================================

UMI info for barcode CGCTGGACAATGTAAG-1 contig 1 = TGGGGAGGAG...
umi AACATACCAC = 327 reads: +388 validated
umi CAGTATATCC = 294 reads: +388 validated
umi CCCACGTTAT = 337 reads: -358X +2 -2XX +1 -12XX +2 -3XX +1 -1XX +2 -2XX +1 -1XX invalidated
umi GCAGTCAGCT = 107 reads: -386X +1 -1XX invalidated
umi GCGGCGGCAA = 248 reads: +388 validated
umi GCTATCCTAC = 284 reads: +388 validated
umi GTACCATTGA = 250 reads: +388 validated
umi GTCCAGCCCT = 364 reads: -358X +2 -2X +1 -12XX +2 -3XX +1 -1XX +2 -2XX +1 -1XX invalidated
umi GTCGCTTTGG = 266 reads: +388 validated
umi GTGCATCCGG = 245 reads: +388 validated
umi TCCTATTGGG = 280 reads: +388 validated
umi TGTATTACGA = 143 reads: +366 -1 +9 -12 non-validated
umi TTCGATCCAT = 378 reads: -358X +2 -2XX +1 -12XX +2 -3XX +1 -1XX +2 -2XX +1 -1XX invalidated

UMI info for barcode CGCTGGACAATGTAAG-1 contig 2 = GAGAGCATCA...
umi ACATATTAAG = 166 reads: +430 validated
umi ACTTAATCAG = 145 reads: -5 +1 -7X +1 -5XX +2 -1XX +3 -1XX +1 -1XX +1 -4XX +1 -6XX +390 invalidated
umi ACTTGCGCCT = 226 reads: +430 validated
umi CCTGCCAATC = 212 reads: +430 validated
umi CCTTTAAGGC = 160 reads: +430 validated
umi CGAAGTAGCT = 193 reads: +430 validated
umi CGGTTGCGAT = 118 reads: +430 validated
umi GCGAGGCGTC = 183 reads: +430 validated
umi TCAATCATAA = 504 reads: -333X +1 -1XX +95 invalidated
umi TCAGTATACC = 41 reads: +308 -17 +88 -17 non-validated
umi TCGCGTACCG = 235 reads: +430 validated
umi TGGGCGTATA = 272 reads: +430 validated
umi TTCAGGCGTG = 201 reads: +430 validated
umi TTCTAAACCC = 378 reads: +430 validated
umi TTGACTCCGC = 188 reads: +430 validated
umi TTTCGGCTAC = 152 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=30)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=8)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 8 umis using 379 reads
cdr3 = CQQSYGTPYTF at 359, score = 10 + 7
umis assigned: [5, 167, 222, 435, 465, 475, 527, 535, 542, 550] and 3 others
of which 13 are surviving nonsolos
reads assigned: 3474
start codons at 32, 38, 107, 462
confident = true

TIG 2[bases=654]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=1)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=38)
446-494 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
494-654 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 14 umis using 298 reads
cdr3 = CARDRMPLYRSYGSYFDLW at 406, score = 9 + 7
umis assigned: [33, 61, 62, 261, 272, 277, 313, 462, 630, 637] and 6 others
of which 16 are surviving nonsolos
reads assigned: 3316
start codons at 64, 299, 328, 361, 421, 440, 548
confident = true
now this is a cell
paired!

GCCGTCTATTATTGTGCGAGAGATCGGATGCCCCTTTACAGAAGTTATGGTTCTTACTTTGACCTCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATTAACAGTCTGCAACCTGAGGATTCCGCAACTTACTACTGTCAACAGAGTTACGGTACCCCCTACACTTTTGGCCGGGGGACCAACCTGCTGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.225 = CGCTGGACACAACGCC-1

using 931 reads

====================================================================================

graph has 270 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 925]
surviving nonsolo ucounts = 1[925]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=346]
4-100 ==> 257-353 on |319|IGLV1-36|L-REGION+V-REGION| [len=353] (mis=5)
97-135 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
135-346 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CASWDDSLRGRVF at 68, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 916
start codons at 51, 76, 81
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.227 = CGCTGGACACAGCGTC-1

using 218 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[4, 23, 190]
surviving nonsolo ucounts = 1[190]
ids = [0]

====================================================================================

UMI info for barcode CGCTGGACACAGCGTC-1 contig 1 = GTCTCCCTCA...
umi CCTTTTTGGT = 177 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=602]
0-56 ==> 3-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
56-409 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=8)
434-480 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
480-602 ==> 0-122 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARQSPLWAPGSPGDYW at 398, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 173
start codons at 56, 230, 254, 389, 534
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.230 = CGCTGGACACCGAAAG-1

using 315 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 4, 306]
surviving nonsolo ucounts = 1[306]
ids = [4]

====================================================================================

UMI info for barcode CGCTGGACACCGAAAG-1 contig 1 = GAAGAGCTGC...
umi TGGGATGTAT = 303 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQHATSPFTF at 357, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.238 = CGCTGGACAGATGGGT-1

using 784 reads

====================================================================================

graph has 1122 edges initially, 14 edges after simplification

total ucounts = 383
nonsolo ucounts = 138[2^52, 3^29, 4^21, 5^14, 6^4, 7^5, 8^5, 9^2, 10, 11, 12, 13, 15, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.241 = CGCTGGACAGGTGGAT-1

using 133 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 130]
surviving nonsolo ucounts = 1[130]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.248 = CGCTGGACATCGGGTC-1

using 608 reads

====================================================================================

graph has 212 edges initially, 6 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[255, 349]
surviving nonsolo ucounts = 2[255, 349]
ids = [0, 1]

====================================================================================

UMI info for barcode CGCTGGACATCGGGTC-1 contig 1 = AGGAGTCAGA...
umi AATATTCGTA = 258 reads: +388 validated

UMI info for barcode CGCTGGACATCGGGTC-1 contig 2 = GAGCTGCTCA...
umi AGCAAAGTGG = 350 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=11)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQQANSFPLTF at 354, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 27, 33, 89, 102, 241, 259, 457
confident = false

TIG 2[bases=548]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQYGSSLTF at 354, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 345
start codons at 30, 238, 364, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.252 = CGCTGGACATGGAATA-1

using 820 reads

====================================================================================

graph has 358 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3, 28, 248, 538]
surviving nonsolo ucounts = 2[248, 538]
ids = [2, 0]

====================================================================================

UMI info for barcode CGCTGGACATGGAATA-1 contig 1 = AGGAATCAGT...
umi AAGAAGCGTT = 503 reads: +388 validated

UMI info for barcode CGCTGGACATGGAATA-1 contig 2 = AGCTTCAGCT...
umi CAAGGGTCCT = 235 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=499]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=0)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
415-499 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CLQHNSYPPTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 489
start codons at 27, 33, 102, 184, 238, 457
confident = false

TIG 2[bases=562]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-355 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-562 ==> 0-127 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CVAWDDSLYAWVF at 368, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 47, 351, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.258 = CGCTGGAGTAATCACC-1

using 283 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[7, 270]
surviving nonsolo ucounts = 1[270]
ids = [7]

====================================================================================

UMI info for barcode CGCTGGAGTAATCACC-1 contig 1 = GAATCAGTCC...
umi TTTGTACGCT = 247 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=483]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-483 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.261 = CGCTGGAGTACCGAGA-1

using 16513 reads

====================================================================================

graph has 5879 edges initially, 88 edges after simplification

total ucounts = 715
nonsolo ucounts = 296[2^124, 3^54, 4^22, 5^11, 6^7, 7^5, 8^7, 9^4, 11, 13, 45, 51, 71, 78, 86, 92, 94, 118, 120, 123, 127, 130, 131, 137, 138, 141, 160, 164, 172, 176, 180, 182, 186, 200, 201, 207^2, 209, 211, 212, 214, 216, 219, 222, 223, 225, 229, 231, 246, 248, 253^2, 256, 266, 271, 276^3, 278, 280, 315, 387, 400, 504, 564, 596, 706, 745, 868, 956]
surviving nonsolo ucounts = 57[51, 71, 86, 92, 94, 118, 120, 123, 127, 131, 137, 138, 141, 160, 164, 172, 176, 180, 182, 186, 200, 201, 207^2, 209, 211, 212, 214, 216, 219, 222, 223, 225, 229, 231, 246, 248, 253^2, 256, 266, 271, 276^3, 278, 280, 315, 387, 400, 504, 564, 596, 706, 745, 868, 956]
ids = [35, 232, 618, 390, 387, 217, 268, 84, 322, 77, ...]

====================================================================================

UMI info for barcode CGCTGGAGTACCGAGA-1 contig 1 = GGAGTCTCCC...
umi ACGATCTTCC = 43 reads: -436 non-validated
umi ATACCATCTT = 133 reads: +412 -1 +8 -1 +7 -7 non-validated
umi ATCTTATGCA = 273 reads: +436 validated
umi CACCAACCGT = 192 reads: +436 validated
umi CGGGATACTG = 120 reads: +413 -23 non-validated
umi GCGAAAACTG = 88 reads: +379 -1 +1 -11 +15 -1 +28 non-validated
umi GCGCCGTGGT = 93 reads: +409 -27 non-validated
umi TCGCTGGCCT = 183 reads: +436 validated
umi TGAACAACCT = 86 reads: +325 -1 +4 -1 +2 -1 +72 -30 non-validated
umi TGAGTATGTC = 160 reads: +434 -1X +1 invalidated
umi TTATATCGTA = 159 reads: +436 validated
umi TTCAAGGTCA = 210 reads: +436 validated
umi TTGATCGCGT = 183 reads: +405 -1 +3 -27 non-validated

UMI info for barcode CGCTGGAGTACCGAGA-1 contig 2 = CTGGGCCTCA...
umi ACCTGGTGCA = 284 reads: +382 validated
umi AGCCTGGGCG = 796 reads: -345X +1 -1XX +3 -1XX +31 invalidated
umi AGTGCGCTGC = 315 reads: +382 validated
umi ATAATTAAAG = 136 reads: +382 validated
umi ATACTCCTCC = 269 reads: +382 validated
umi ATTGCATTTA = 277 reads: +382 validated
umi CACCGCCTAA = 229 reads: +382 validated
umi CAGAGTGGCC = 983 reads: -334 +1 -2XX +1 -2XX +1 -3XX +1 -2XX +3 -1XX +31 invalidated
umi CCCAGCTGTG = 264 reads: +382 validated
umi CCGTAAGGCA = 158 reads: +94 -1XX +280 -6X +1 invalidated
umi CCGTGGGCCT = 259 reads: +382 validated
umi CCTACAATCT = 197 reads: +382 validated
umi CCTCGACTAC = 65 reads: +308 -19 +5 -1 +49 non-validated
umi CTGGCATGGT = 395 reads: -344 +1 -2X +3 -1X +31 invalidated
umi GAAAACCGGT = 130 reads: +382 validated
umi GACTATGCGA = 226 reads: +382 validated
umi GAGCACCCAT = 216 reads: +382 validated
umi GATGTATACT = 176 reads: +382 validated
umi GGCGCGTGGG = 281 reads: +382 validated
umi TAACAATGTG = 602 reads: -345 +1 -2X +2 -1XX +31 invalidated
umi TATCATGGAA = 252 reads: +382 validated
umi TATCTACAAA = 281 reads: +382 validated
umi TCCCAAGACA = 726 reads: -340X +1 -3XX +1 -2XX +3 -1XX +31 invalidated
umi TCTTCGCCCT = 205 reads: +382 validated
umi TGGGGTTGGT = 160 reads: -262 +120 non-validated
umi TTTTGTGTGT = 217 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=566]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=3)
419-443 ==> 7-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=5)
445-495 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
495-566 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 100 reads
cdr3 = CAIRPWDFWSGYQLSEAFDIW at 401, score = 8 + 8
umis assigned: [35, 77, 99, 138, 268, 387, 390, 584, 618, 622] and 3 others
of which 13 are surviving nonsolos
reads assigned: 1893
start codons at 59, 233, 257, 392, 415, 476
confident = true

TIG 2[bases=630]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-383 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=4)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
419-630 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 20 umis using 737 reads
cdr3 = CQAWDSSTENVVF at 352, score = 6 + 8
umis assigned: [33, 62, 75, 76, 78, 114, 140, 147, 199, 214] and 16 others
of which 26 are surviving nonsolos
reads assigned: 7858
start codons at 37, 42, 98, 185, 331, 335, 380
confident = true

REJECT CONTIGS

TIG 1[bases=753]
4-214 ==> 5927-6137 on segment before IGLV2-5 exon 1 [len=6137] (mis=0)
42-67 ==> 0-25 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=0)
67-84 ==> 26-43 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=0) [SHIFT!]
201-494 ==> 43-336 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=24) [SHIFT!]
514-542 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
542-753 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [58, 84, 91, 130, 156, 163, 215, 217, 277, 378] and 7 others
of which 17 are surviving nonsolos
reads assigned: 4514
start codons at 42, 297, 309, 315, 359, 369, 437
confident = false
did not find CDR3
now this is a cell
paired!

TATTACTGTGCGATCCGTCCATGGGATTTTTGGAGTGGTTATCAGTTGTCGGAGGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> GGGACCCAGGCTATGGATGAGGCTGACTATTACTGTCAGGCGTGGGACAGCAGCACTGAAAATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.264 = CGCTGGAGTACTTGAC-1

using 37 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[3^2, 5, 6, 8, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.267 = CGCTGGAGTATGCTTG-1

using 507 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 4, 495]
surviving nonsolo ucounts = 1[495]
ids = [0]

====================================================================================

UMI info for barcode CGCTGGAGTATGCTTG-1 contig 1 = GAATCAGACC...
umi AAACAAAGCC = 499 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=2)
375-413 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 93 reads
cdr3 = CQQYNSYPPTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 488
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.276 = CGCTGGAGTCTCTCTG-1

using 308 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 4[2^2, 4, 291]
surviving nonsolo ucounts = 1[291]
ids = [10]

====================================================================================

UMI info for barcode CGCTGGAGTCTCTCTG-1 contig 1 = GTCAGTCTCA...
umi GGTAGTTACT = 295 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=544]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQSYSTPSF at 350, score = 9 + 7
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 23, 29, 85, 98, 234, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.278 = CGCTGGAGTCTTTCAT-1

using 22 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.279 = CGCTGGAGTGACAAAT-1

using 173 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[169]
surviving nonsolo ucounts = 1[169]
ids = [3]

====================================================================================

UMI info for barcode CGCTGGAGTGACAAAT-1 contig 1 = TGAGCGCAGA...
umi TTCGTCTAAG = 159 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=559]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=8)
389-427 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
427-559 ==> 0-132 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CGTWDYSLSAGEVF at 357, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 159
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.284 = CGCTGGAGTGTTGAGG-1

using 190 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 181]
surviving nonsolo ucounts = 1[181]
ids = [2]

====================================================================================

UMI info for barcode CGCTGGAGTGTTGAGG-1 contig 1 = TGGGGGAGTT...
umi CATTATCCCG = 179 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=560]
160-513 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=22)
510-548 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
junction support: 1 umis using 10 reads
cdr3 = CQQSYSTLFTF at 487, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 16, 51, 72, 111, 160, 166, 222, 235
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.298 = CGCTGGATCATATCGG-1

using 253 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 9, 240]
surviving nonsolo ucounts = 1[240]
ids = [3]

====================================================================================

UMI info for barcode CGCTGGATCATATCGG-1 contig 1 = GAGTCAGACC...
umi TTTAGGCCTT = 229 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=493]
0-25 ==> 22-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
25-376 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=25)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
413-493 ==> 0-80 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQGNSFPYTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 25, 31, 87, 100, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.317 = CGCTGGATCTCAAACG-1

using 489 reads

====================================================================================

graph has 184 edges initially, 12 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[3, 233, 245]
surviving nonsolo ucounts = 2[233, 245]
ids = [2, 0]

====================================================================================

UMI info for barcode CGCTGGATCTCAAACG-1 contig 1 = GAGGAGTCAG...
umi CAAGTACTTT = 232 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQSYSTPYTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 28, 34, 90, 103, 239, 458
confident = false

REJECT CONTIGS

TIG 1[bases=561]
0-75 ==> 5533-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=3)
387-425 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 30, 63, 99, 187, 349, 369, 467
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.323 = CGCTGGATCTGCGTAA-1

using 221 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 218]
surviving nonsolo ucounts = 1[218]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.327 = CGCTGGATCTTAGAGC-1

using 287 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[287]
surviving nonsolo ucounts = 1[287]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.328 = CGCTGGATCTTAGCCC-1

using 45 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2, 4, 5, 15, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.330 = CGCTGGATCTTGCCGT-1

using 50 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[50]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.333 = CGCTTCAAGAACAATC-1

using 548 reads

====================================================================================

graph has 172 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 3, 4, 235, 301]
surviving nonsolo ucounts = 2[235, 301]
ids = [4, 3]

====================================================================================

UMI info for barcode CGCTTCAAGAACAATC-1 contig 1 = AGCTTCAGCT...
umi CTTTTTGCAC = 240 reads: +391 validated

UMI info for barcode CGCTTCAAGAACAATC-1 contig 2 = GGGGAGGAAC...
umi CCGGATTCGC = 299 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=526]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
399-437 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
437-526 ==> 0-89 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 36 reads
cdr3 = CAAWDDSLSGFYVF at 367, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 46, 200, 350, 375, 380, 401
confident = false

TIG 2[bases=557]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYNNWPSCSF at 357, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 36, 105, 241, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.342 = CGCTTCAAGCCAGAAC-1

using 519 reads

====================================================================================

graph has 234 edges initially, 12 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 6, 237, 271]
surviving nonsolo ucounts = 2[237, 271]
ids = [0, 4]

====================================================================================

UMI info for barcode CGCTTCAAGCCAGAAC-1 contig 1 = GGGAGTCTCA...
umi AATTCAAATA = 41 reads: -241 +2 -1XX +1 -1XX +17 -1XX +11 -1XX +20 -1XX +2 -2XX +1 -1XX +15 -2XX +3 -1XX +3 -3XX +1 -8XX +1 -4XX +1 -4XX +31 -1XX +1 invalidated
umi CTTCCGTCTA = 245 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=494]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=4)
367-405 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
405-494 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQSYSTSF at 350, score = 9 + 7
umis assigned: [0, 4]
of which 2 are surviving nonsolos
reads assigned: 276
start codons at 23, 29, 85, 98, 234, 447
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.345 = CGCTTCAAGCTGAACG-1

using 570 reads

====================================================================================

graph has 320 edges initially, 36 edges after simplification

total ucounts = 23
nonsolo ucounts = 14[2^8, 3, 4, 7, 8, 253, 270]
surviving nonsolo ucounts = 2[253, 270]
ids = [5, 13]

====================================================================================

UMI info for barcode CGCTTCAAGCTGAACG-1 contig 1 = GAGTCAGTCC...
umi GTCCCTTCTA = 264 reads: +388 validated

UMI info for barcode CGCTTCAAGCTGAACG-1 contig 2 = AGTCTCAGTC...
umi CACATACAGT = 252 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=16)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYEDLPYTF at 352, score = 9 + 7
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 25, 31, 87, 100, 362, 406, 455
confident = false

TIG 2[bases=547]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=8)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQSYSTPQITF at 347, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 20, 26, 82, 95, 231, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.357 = CGCTTCAAGGGTTTCT-1

using 546 reads

====================================================================================

graph has 182 edges initially, 30 edges after simplification

total ucounts = 14
nonsolo ucounts = 7[2^4, 3, 244, 284]
surviving nonsolo ucounts = 2[244, 284]
ids = [10, 11]

====================================================================================

UMI info for barcode CGCTTCAAGGGTTTCT-1 contig 1 = GAGGAGTCAG...
umi TCGTCTCCGG = 265 reads: +385 validated

UMI info for barcode CGCTTCAAGGGTTTCT-1 contig 2 = GGAGTCAGAC...
umi GTACTTACAG = 226 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
413-503 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQSYSTPSF at 355, score = 9 + 7
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 28, 34, 90, 103, 239, 455
confident = false

TIG 2[bases=504]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
414-504 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYNGQSRAF at 353, score = 8 + 7
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 26, 32, 101, 237, 240, 333, 366, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.360 = CGCTTCAAGTACGCGA-1

using 292 reads

====================================================================================

graph has 129 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 6, 276]
surviving nonsolo ucounts = 1[276]
ids = [6]

====================================================================================

REJECT CONTIGS

TIG 1[bases=517]
4-50 ==> 11318-11364 on rc of segment before IGHV3-19 exon 1 [len=11364] (mis=1)
4-50 ==> 8651-8697 on rc of segment before IGHV3-57 exon 1 [len=8697] (mis=1)
4-50 ==> 5954-6000 on rc of segment after IGHV1OR15-2 exon 1 [len=6000] (mis=1)
36-68 ==> 10108-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
50-214 ==> 0-164 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=18)
214-325 ==> 242-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=16)
374-408 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
408-517 ==> 0-109 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 314, score = 7 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 50, 236, 269, 462
confident = false
full length transcript of length 517
VJ delta = 84
delta too large
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.361 = CGCTTCAAGTAGCGGT-1

using 471 reads

====================================================================================

graph has 456 edges initially, 14 edges after simplification

total ucounts = 126
nonsolo ucounts = 59[2^29, 3^12, 4^7, 5^7, 7, 8, 13, 219]
surviving nonsolo ucounts = 1[219]
ids = [13]

====================================================================================

UMI info for barcode CGCTTCAAGTAGCGGT-1 contig 1 = GCTCTGCTTC...
umi ACCTGAGATG = 216 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=566]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=13)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-566 ==> 0-121 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.362 = CGCTTCAAGTATTGGA-1

using 337 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[3, 7, 319]
surviving nonsolo ucounts = 1[319]
ids = [4]

====================================================================================

UMI info for barcode CGCTTCAAGTATTGGA-1 contig 1 = AGGAGTCAGT...
umi CTTGAGCTGT = 318 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=23)
393-415 ==> 16-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYDALPPVF at 354, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 315
start codons at 27, 33, 89, 102, 364, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.376 = CGCTTCACAAGCCGTC-1

using 559 reads

====================================================================================

graph has 204 edges initially, 28 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[9, 61, 124, 360]
surviving nonsolo ucounts = 3[61, 124, 360]
ids = [7, 8, 0]

====================================================================================

UMI info for barcode CGCTTCACAAGCCGTC-1 contig 1 = AGTCAGTCCC...
umi TAGTTCGTTG = 61 reads: +84 -1XX +303 invalidated

UMI info for barcode CGCTTCACAAGCCGTC-1 contig 2 = AGTCAGTCCC...
umi ACGATACTCG = 360 reads: +388 validated

UMI info for barcode CGCTTCACAAGCCGTC-1 contig 3 = CTCAGGGCTT...
umi TTAAGCTCCG = 122 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=548]
24-377 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
374-412 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQQSSSNLLTF at 351, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 59
start codons at 24, 30, 86, 99, 235, 397, 454
confident = false

TIG 2[bases=548]
0-24 ==> 7-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
24-375 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=22)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQFDSVPLTF at 351, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 357
start codons at 24, 30, 86, 99, 235, 238, 454
confident = false

TIG 3[bases=456]
0-31 ==> 28-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
31-384 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=8)
396-446 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
junction support: 1 umis using 15 reads
cdr3 = CAKKGERPRAFDIW at 373, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 121
start codons at 31, 205, 229, 364, 427
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.377 = CGCTTCACAAGCTGAG-1

using 25 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[25]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.379 = CGCTTCACAATCGGTT-1

using 216 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 8[2^5, 3, 5, 191]
surviving nonsolo ucounts = 1[191]
ids = [4]

====================================================================================

UMI info for barcode CGCTTCACAATCGGTT-1 contig 1 = GAGGAATCAG...
umi ATTCGTTCGT = 173 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=504]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-504 ==> 0-88 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 172
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.383 = CGCTTCACACACTGCG-1

using 300 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 3, 289]
surviving nonsolo ucounts = 1[289]
ids = [1]

====================================================================================

UMI info for barcode CGCTTCACACACTGCG-1 contig 1 = AGGAATCAGT...
umi AGGCGATTTT = 260 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=500]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-500 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.389 = CGCTTCACACGAGAGT-1

using 980 reads

====================================================================================

graph has 890 edges initially, 4 edges after simplification

total ucounts = 309
nonsolo ucounts = 114[2^63, 3^22, 4^10, 5^6, 6, 7^4, 8^2, 9, 10, 14, 16, 207, 217]
surviving nonsolo ucounts = 2[207, 217]
ids = [226, 95]

====================================================================================

UMI info for barcode CGCTTCACACGAGAGT-1 contig 1 = AGCTCTGAGA...
umi CAAGGGATGA = 214 reads: +424 validated
umi GTGTTCCGCT = 207 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=685]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-685 ==> 0-182 on |43|IGHG2|C-REGION| [len=977] (mis=1)
junction support: 2 umis using 41 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [95, 226]
of which 2 are surviving nonsolos
reads assigned: 416
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.394 = CGCTTCACAGATAATG-1

using 623 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^2, 5, 7, 273, 329]
surviving nonsolo ucounts = 2[273, 329]
ids = [0, 3]

====================================================================================

UMI info for barcode CGCTTCACAGATAATG-1 contig 1 = GGGAATCAGT...
umi AACCCTATAC = 267 reads: +388 validated
umi CACTCATGTA = 325 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 108 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [0, 3]
of which 2 are surviving nonsolos
reads assigned: 589
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.397 = CGCTTCACAGCTGCTG-1

using 357 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 352]
surviving nonsolo ucounts = 1[352]
ids = [3]

====================================================================================

UMI info for barcode CGCTTCACAGCTGCTG-1 contig 1 = TGGGGGATCA...
umi TGGGCCCTCC = 325 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=530]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
397-435 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
435-530 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CMQALQTPVGTF at 371, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 35, 68, 104, 192, 354, 374, 477
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.398 = CGCTTCACAGCTGTGC-1

using 471 reads

====================================================================================

graph has 214 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 3, 8, 220, 233]
surviving nonsolo ucounts = 2[220, 233]
ids = [9, 1]

====================================================================================

UMI info for barcode CGCTTCACAGCTGTGC-1 contig 1 = GGAGAAAGGG...
umi TGCCTAACCC = 217 reads: +385 validated

UMI info for barcode CGCTTCACAGCTGTGC-1 contig 2 = GGGGTCTCAG...
umi ACCGGTGAGC = 222 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=569]
158-506 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
505-543 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
543-569 ==> 0-26 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQQYGSSPRTF at 482, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 63, 103, 158, 366, 492
confident = false

TIG 2[bases=587]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-353 ==> 0-315 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=12)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
426-587 ==> 0-161 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CTSYAGGSNVVF at 362, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 38, 246, 345, 372, 387
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.401 = CGCTTCACAGGGTACA-1

using 182 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 24, 153]
surviving nonsolo ucounts = 2[24, 153]
ids = [0, 1]

====================================================================================

UMI info for barcode CGCTTCACAGGGTACA-1 contig 1 = GCTGTAGGCT...
umi ACGAGCGTTA = 22 reads: +159 -1 +157 -4 +55 non-validated
umi ACGAGCGTTG = 142 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=526]
0-38 ==> 0-38 on |364|IGLV3-27|5'UTR| [len=38] (mis=0)
38-358 ==> 0-320 on |365|IGLV3-27|L-REGION+V-REGION| [len=339] (mis=20)
376-414 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
414-526 ==> 0-112 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CYCATDRSLLF at 353, score = 7 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 164
start codons at 28, 38, 99, 168, 186, 336
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.403 = CGCTTCACAGTATGCT-1

using 336 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 327]
surviving nonsolo ucounts = 1[327]
ids = [4]

====================================================================================

UMI info for barcode CGCTTCACAGTATGCT-1 contig 1 = AACAACCACA...
umi GTCAGGCTTT = 321 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=579]
0-51 ==> 7-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
51-404 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=8)
405-423 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=2)
424-487 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
487-579 ==> 0-92 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 36 reads
cdr3 = CARVGYSSSASYYYYYAMDVW at 393, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 51, 202, 249, 348, 444
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.410 = CGCTTCACATCGATGT-1

using 369 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 360]
surviving nonsolo ucounts = 1[360]
ids = [6]

====================================================================================

UMI info for barcode CGCTTCACATCGATGT-1 contig 1 = GGGGAGGAAC...
umi TCCAGCATCA = 357 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=35)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CEQYNFWPRTF at 357, score = 8 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 354
start codons at 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.414 = CGCTTCACATGTTGAC-1

using 285 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[281]
surviving nonsolo ucounts = 1[281]
ids = [4]

====================================================================================

UMI info for barcode CGCTTCACATGTTGAC-1 contig 1 = AGGAATCAGT...
umi TCTCCTCTTG = 283 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.416 = CGCTTCACATTCCTCG-1

using 328 reads

====================================================================================

graph has 120 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[54, 268]
surviving nonsolo ucounts = 2[54, 268]
ids = [5, 2]

====================================================================================

UMI info for barcode CGCTTCACATTCCTCG-1 contig 1 = GGAATCAGTC...
umi CTTTCCCTAT = 264 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.426 = CGCTTCAGTAGGCTGA-1

using 252 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 6, 241]
surviving nonsolo ucounts = 1[241]
ids = [2]

====================================================================================

UMI info for barcode CGCTTCAGTAGGCTGA-1 contig 1 = AGTCTCAGTC...
umi TGGTCGGTAC = 218 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=478]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=6)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
408-478 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQSYSTPFTF at 347, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.429 = CGCTTCAGTCAAACTC-1

using 15 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.431 = CGCTTCAGTCCAAGTT-1

using 213 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[209]
surviving nonsolo ucounts = 1[209]
ids = [3]

====================================================================================

UMI info for barcode CGCTTCAGTCCAAGTT-1 contig 1 = GAGTCAGTCC...
umi TGATGCGTAT = 210 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=546]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
373-410 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQYDNLLTF at 352, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 25, 31, 87, 100, 239, 362, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.436 = CGCTTCAGTCTTTCAT-1

using 369 reads

====================================================================================

graph has 94 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[4, 180, 182]
surviving nonsolo ucounts = 2[180, 182]
ids = [2, 4]

====================================================================================

UMI info for barcode CGCTTCAGTCTTTCAT-1 contig 1 = GGCTGGGGTC...
umi ACTCAACTTA = 175 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=516]
42-393 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=4)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
430-516 ==> 0-86 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CSSYTSSSTYVF at 366, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 173
start codons at 42, 199, 243, 250, 253, 394
confident = false

REJECT CONTIGS

TIG 1[bases=478]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
0-82 ==> 10058-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=10)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=12)
434-478 ==> 0-44 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
cdr3 = CARDRGSGFSNWFDPW at 406, score = 9 + 6
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 64, 220, 262, 267, 299, 328, 361
confident = false
VJ delta = 11
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.462 = CGCTTCATCACTTATC-1

using 163 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2^2, 151]
surviving nonsolo ucounts = 1[151]
ids = [2]

====================================================================================

UMI info for barcode CGCTTCATCACTTATC-1 contig 1 = ACAGCCACAT...
umi ACATCGAGAG = 151 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=508]
0-49 ==> 11-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=0)
49-402 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=22)
421-467 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=8)
467-508 ==> 0-41 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CLTENSDFWSGFPYW at 391, score = 10 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 147
start codons at 49, 210, 247, 313, 346
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.468 = CGCTTCATCAGTTCGA-1

using 74 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 68]
surviving nonsolo ucounts = 1[68]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.476 = CGCTTCATCCTAGAAC-1

using 615 reads

====================================================================================

graph has 262 edges initially, 36 edges after simplification

total ucounts = 17
nonsolo ucounts = 9[2^3, 3, 5, 6, 8, 256, 323]
surviving nonsolo ucounts = 2[256, 323]
ids = [1, 12]

====================================================================================

UMI info for barcode CGCTTCATCCTAGAAC-1 contig 1 = AGGAATCAGA...
umi GTCTAGGCTA = 320 reads: +388 validated

UMI info for barcode CGCTTCATCCTAGAAC-1 contig 2 = GGGAATCAGT...
umi ACCCAGCCAT = 256 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
383-415 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYNSYPPTF at 354, score = 9 + 8
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 319
start codons at 27, 33, 89, 102, 238, 457
confident = false

TIG 2[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.479 = CGCTTCATCGAGCCCA-1

using 102 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 96]
surviving nonsolo ucounts = 1[96]
ids = [0]

====================================================================================

UMI info for barcode CGCTTCATCGAGCCCA-1 contig 1 = GAGGAACTGC...
umi ACCTACTCCA = 84 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=435]
33-325 ==> 0-292 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=13)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
junction support: 1 umis using 10 reads
cdr3 = CQQHSAWPLTF at 357, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 84
start codons at 33, 241
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.517 = CGGACACAGATTACCC-1

using 174 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[171]
surviving nonsolo ucounts = 1[171]
ids = [3]

====================================================================================

UMI info for barcode CGGACACAGATTACCC-1 contig 1 = GAGTGCTTTC...
umi TCATTATCCC = 170 reads: +460 validated

GOOD CONTIGS

TIG 1[bases=542]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=4)
427-478 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
478-542 ==> 0-64 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARGHFYFASGSRIPGGVWFDPW at 378, score = 9 + 6
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 18, 39, 83, 169
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.522 = CGGACACAGCCACTAT-1

using 292 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 287]
surviving nonsolo ucounts = 1[287]
ids = [2]

====================================================================================

UMI info for barcode CGGACACAGCCACTAT-1 contig 1 = GATGCTTTCT...
umi ATTTTGGACT = 289 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=524]
17-394 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=3)
407-453 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
453-524 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CARGGWLALLDYW at 383, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 1, 17, 26, 38, 82
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.526 = CGGACACAGCTGAACG-1

using 262 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[257]
surviving nonsolo ucounts = 1[257]
ids = [5]

====================================================================================

UMI info for barcode CGGACACAGCTGAACG-1 contig 1 = AGGAGTCAGT...
umi TAGATGATGT = 1 reads: -388 non-validated
umi TAGATGCTGG = 260 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQSYSTPLTF at 354, score = 9 + 9
umis assigned: [4, 5]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.527 = CGGACACAGCTGGAAC-1

using 214 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 58, 152]
surviving nonsolo ucounts = 2[58, 152]
ids = [1, 3]

====================================================================================

UMI info for barcode CGGACACAGCTGGAAC-1 contig 1 = TGAGCGCAGA...
umi CTCCTCACTT = 57 reads: +337 -2 +49 non-validated
umi TATACTGTCC = 136 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-547 ==> 0-123 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 39 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 193
start codons at 36, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.531 = CGGACACAGGATGGTC-1

using 1209 reads

====================================================================================

graph has 1372 edges initially, 16 edges after simplification

total ucounts = 442
nonsolo ucounts = 170[2^73, 3^38, 4^18, 5^19, 6^8, 7^3, 8^3, 9^3, 11, 13^2, 14, 339]
surviving nonsolo ucounts = 1[339]
ids = [111]

====================================================================================

UMI info for barcode CGGACACAGGATGGTC-1 contig 1 = GGAGGAACTG...
umi ATTATTCCGG = 342 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQYNNWPRTF at 355, score = 9 + 8
umis assigned: [111]
of which 1 are surviving nonsolos
reads assigned: 336
start codons at 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.534 = CGGACACAGGCTCATT-1

using 313 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 305]
surviving nonsolo ucounts = 1[305]
ids = [6]

====================================================================================

UMI info for barcode CGGACACAGGCTCATT-1 contig 1 = ACTTTCTGAG...
umi TTTCATCCTT = 309 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=570]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=2)
388-419 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=4)
417-468 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=0)
468-570 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CASGTGYCSGGSCSNNWFDPW at 374, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 35, 79, 486, 547
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.542 = CGGACACAGTAGTGCG-1

using 160 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[8, 149]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.546 = CGGACACAGTCCATAC-1

using 96 reads

====================================================================================

graph has 110 edges initially, 4 edges after simplification

total ucounts = 18
nonsolo ucounts = 12[2^2, 3, 4, 6^2, 7, 9, 10, 11, 12, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.565 = CGGACACCACCGATAT-1

using 918 reads

====================================================================================

graph has 912 edges initially, 8 edges after simplification

total ucounts = 279
nonsolo ucounts = 115[2^36, 3^31, 4^15, 5^8, 6^6, 7^4, 8^4, 9^3, 10, 11^3, 12, 14, 17, 280]
surviving nonsolo ucounts = 1[280]
ids = [274]

====================================================================================

UMI info for barcode CGGACACCACCGATAT-1 contig 1 = ATGAGCAAAA...
umi TTTATTAGGT = 269 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=487]
0-31 ==> 33-64 on |299|IGKV6-21|5'UTR| [len=64] (mis=0)
31-373 ==> 0-342 on |300|IGKV6-21|L-REGION+V-REGION| [len=342] (mis=10)
372-410 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
410-487 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CHQSSTFPWTF at 349, score = 10 + 8
umis assigned: [274]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 0, 31, 236, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.566 = CGGACACCACCTATCC-1

using 391 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[391]
surviving nonsolo ucounts = 1[391]
ids = [0]

====================================================================================

UMI info for barcode CGGACACCACCTATCC-1 contig 1 = GAGGAATCAG...
umi GAGACGTTTC = 346 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-495 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 340
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.569 = CGGACACCAGACGCAA-1

using 214 reads

====================================================================================

graph has 124 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[5, 7, 70, 128]
surviving nonsolo ucounts = 2[70, 128]
ids = [7, 1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=453]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-36 ==> 5964-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
9-61 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
383-410 ==> 0-27 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
cdr3 = CQQRSNWPPITF at 357, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 124
start codons at 36, 241, 244
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.570 = CGGACACCAGACTCGC-1

using 325 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[3, 7, 315]
surviving nonsolo ucounts = 1[315]
ids = [0]

====================================================================================

UMI info for barcode CGGACACCAGACTCGC-1 contig 1 = GAGTCAGACT...
umi AAGCCGTCAC = 287 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=508]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
413-508 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYNSYALSF at 352, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 25, 31, 87, 100, 236, 239, 332, 371, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.575 = CGGACACCAGGCGATA-1

using 339 reads

====================================================================================

graph has 119 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[337]
surviving nonsolo ucounts = 1[337]
ids = [1]

====================================================================================

UMI info for barcode CGGACACCAGGCGATA-1 contig 1 = CTGGGCCTCA...
umi TTGACCCCGC = 316 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=551]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-371 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
413-551 ==> 0-138 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQAWDSTEVVF at 352, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 37, 42, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.577 = CGGACACCAGTTCCCT-1

using 1209 reads

====================================================================================

graph has 1184 edges initially, 20 edges after simplification

total ucounts = 401
nonsolo ucounts = 168[2^56, 3^28, 4^29, 5^14, 6^12, 7^7, 8^5, 9^4, 10^3, 11, 12, 13, 14^2, 15^2, 16, 18, 239]
surviving nonsolo ucounts = 1[239]
ids = [231]

====================================================================================

UMI info for barcode CGGACACCAGTTCCCT-1 contig 1 = AGCTCTGAGA...
umi GAGATCGAGA = 234 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=560]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-560 ==> 0-57 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [231]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.579 = CGGACACCATCTATGG-1

using 15 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.584 = CGGACACGTCAAAGAT-1

using 476 reads

====================================================================================

graph has 142 edges initially, 4 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[170, 306]
surviving nonsolo ucounts = 2[170, 306]
ids = [0, 1]

====================================================================================

UMI info for barcode CGGACACGTCAAAGAT-1 contig 1 = ATCACACAAC...
umi ATTTACCGCC = 173 reads: +409 validated

UMI info for barcode CGGACACGTCAAAGAT-1 contig 2 = GGGAATCAGT...
umi CATATCTTTG = 303 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=533]
0-57 ==> 3-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=0)
57-410 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=7)
418-466 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
466-533 ==> 0-67 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CVTDLATTVDYW at 399, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 169
start codons at 57, 213, 255, 277, 292, 321, 354
confident = false

TIG 2[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=6)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQHKSYPFTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.586 = CGGACACGTCCGTTAA-1

using 305 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[301]
surviving nonsolo ucounts = 1[301]
ids = [2]

====================================================================================

UMI info for barcode CGGACACGTCCGTTAA-1 contig 1 = GAAGAGCTGC...
umi GGTAACGCAG = 304 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=9)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYGSSPGTF at 357, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.588 = CGGACACGTCGATTGT-1

using 179 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 173]
surviving nonsolo ucounts = 1[173]
ids = [2]

====================================================================================

UMI info for barcode CGGACACGTCGATTGT-1 contig 1 = CGAGCCCAGC...
umi TTAGAAACAA = 172 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=525]
0-67 ==> 0-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
67-420 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=25)
445-491 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=8)
491-525 ==> 0-34 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARTTYHDYVWGPFDDW at 409, score = 9 + 6
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 165
start codons at 67, 218, 223, 265, 284, 370, 428, 434, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.601 = CGGACACGTTCGTCTC-1

using 574 reads

====================================================================================

graph has 254 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[4, 261, 304]
surviving nonsolo ucounts = 2[261, 304]
ids = [0, 4]

====================================================================================

UMI info for barcode CGGACACGTTCGTCTC-1 contig 1 = GAAAACAGAG...
umi AACCTCGACC = 250 reads: +388 validated

UMI info for barcode CGGACACGTTCGTCTC-1 contig 2 = GGGGGTGCTT...
umi TGAAGTCTGT = 307 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=574]
39-391 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=19)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
427-574 ==> 0-147 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CSAWDSSLNVWVF at 360, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 39, 178, 368, 385
confident = false

TIG 2[bases=570]
20-391 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=4)
405-468 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=5)
468-570 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CAMVQGVIIPHYYYGMDVW at 380, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 20, 41, 85, 171, 386, 425, 486, 547
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.605 = CGGACACTCAACACAC-1

using 22 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.607 = CGGACACTCACCGTAA-1

using 643 reads

====================================================================================

graph has 186 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[642]
surviving nonsolo ucounts = 1[642]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.608 = CGGACACTCACTCTTA-1

using 353 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[3^2, 5, 334]
surviving nonsolo ucounts = 1[334]
ids = [3]

====================================================================================

UMI info for barcode CGGACACTCACTCTTA-1 contig 1 = GATCAGGACT...
umi CGTGTGAATA = 313 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=513]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
393-430 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
430-513 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CMQALQTPQLTF at 366, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.613 = CGGACACTCATCACCC-1

using 303 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[6, 297]
surviving nonsolo ucounts = 1[297]
ids = [0]

====================================================================================

UMI info for barcode CGGACACTCATCACCC-1 contig 1 = GCTCTGGGAG...
umi GCATCTTACG = 296 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=522]
0-78 ==> 2-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=2)
78-429 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=15)
457-508 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=1)
junction support: 1 umis using 33 reads
cdr3 = CARGAGYDFLSGHHWFDPW at 420, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 78, 234, 285, 292, 295, 313, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.614 = CGGACACTCATCGATG-1

using 606 reads

====================================================================================

graph has 248 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 11, 586]
surviving nonsolo ucounts = 2[11, 586]
ids = [6, 9]

====================================================================================

UMI info for barcode CGGACACTCATCGATG-1 contig 1 = GATCAGGACT...
umi TCTAACAAGA = 11 reads: -70 +139 -1XX +101 -9 +35 -1X +2 -4X +1 -2X +1 -1X +2 -6X +1 -21 invalidated
umi TGTGGATATT = 590 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 96 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [6, 9]
of which 2 are surviving nonsolos
reads assigned: 588
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.620 = CGGACACTCCATGAGT-1

using 1183 reads

====================================================================================

graph has 440 edges initially, 36 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[588, 591]
surviving nonsolo ucounts = 2[588, 591]
ids = [2, 4]

====================================================================================

UMI info for barcode CGGACACTCCATGAGT-1 contig 1 = GAATCAGTCC...
umi TGGCGCATCA = 586 reads: +388 validated

UMI info for barcode CGGACACTCCATGAGT-1 contig 2 = GTCAGTCTCA...
umi TTATTGCTCT = 598 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 100 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 577
start codons at 25, 31, 100, 236, 455
confident = false

TIG 2[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=10)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 91 reads
cdr3 = CQQSYTTLLTF at 350, score = 8 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 586
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.624 = CGGACACTCCGCGCAA-1

using 1880 reads

====================================================================================

graph has 536 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3, 5, 634, 1235]
surviving nonsolo ucounts = 2[634, 1235]
ids = [5, 3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.626 = CGGACACTCCTAGAAC-1

using 527 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[524]
surviving nonsolo ucounts = 1[524]
ids = [3]

====================================================================================

UMI info for barcode CGGACACTCCTAGAAC-1 contig 1 = GGGAGTCTCA...
umi TCTCTACTTA = 524 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 80 reads
cdr3 = CQQSYTTLLTF at 350, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 515
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.630 = CGGACACTCGCCGTGA-1

using 19 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 14]
surviving nonsolo ucounts = 1[14]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.631 = CGGACACTCGCGATCG-1

using 441 reads

====================================================================================

graph has 282 edges initially, 6 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[6, 67, 180, 186]
surviving nonsolo ucounts = 3[67, 180, 186]
ids = [2, 1, 3]

====================================================================================

UMI info for barcode CGGACACTCGCGATCG-1 contig 1 = GCAGGAGTCA...
umi AGTGGGTTTT = 157 reads: +385 validated
umi GTTGAAATAT = 1 reads: -279X +3 -1X +6 -1 +16 -1 +1 -1X +3 -1X +7 -1X +8 -1X +2 -1X +1 -51 invalidated

UMI info for barcode CGGACACTCGCGATCG-1 contig 2 = GGGCACAAGA...
umi GCGACGCAAC = 189 reads: +391 validated

UMI info for barcode CGGACACTCGCGATCG-1 contig 3 = TCAGTTAGGA...
umi CTAGGGCATA = 55 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=467]
0-29 ==> 152-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
29-380 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=25)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
414-467 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CHQYNSYSTF at 356, score = 8 + 7
umis assigned: [1, 5]
of which 1 are surviving nonsolos
reads assigned: 156
start codons at 29, 35, 91, 104, 240, 243, 336, 456
confident = false

TIG 2[bases=637]
0-35 ==> 16-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
35-375 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
426-637 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQSYDKSLRGAVF at 359, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 35, 119, 192, 342, 369
confident = false

TIG 3[bases=405]
0-23 ==> 24-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
23-368 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=4)
367-405 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
junction support: 1 umis using 6 reads
cdr3 = CQQRSSWPLTF at 344, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 54
start codons at 23, 228, 231
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.636 = CGGACACTCGGCGCAT-1

using 695 reads

====================================================================================

graph has 980 edges initially, 16 edges after simplification

total ucounts = 316
nonsolo ucounts = 122[2^47, 3^27, 4^14, 5^8, 6^7, 7^5, 8^3, 9^5, 11^2, 12^2, 17, 21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.640 = CGGACACTCGTGGGAA-1

using 353 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[348]
surviving nonsolo ucounts = 1[348]
ids = [0]

====================================================================================

UMI info for barcode CGGACACTCGTGGGAA-1 contig 1 = GATCAGGACT...
umi ATACTCATCA = 351 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 341
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.643 = CGGACACTCTCATTCA-1

using 189 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 186]
surviving nonsolo ucounts = 1[186]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=541]
0-81 ==> 11262-11343 on segment before IGLV3-6 exon 1 [len=11502] (mis=4)
35-175 ==> 0-140 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=4)
175-381 ==> 141-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=13) [SHIFT!]
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
419-541 ==> 0-122 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CYSTDNSGRHSGMF at 349, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 171
start codons at 35, 96, 182, 229, 233, 332, 385
confident = false
not full
frameshifted full length stopped transcript of length 541
VJ delta = 23
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.647 = CGGACACTCTGCAAGT-1

using 347 reads

====================================================================================

graph has 478 edges initially, 8 edges after simplification

total ucounts = 189
nonsolo ucounts = 69[2^31, 3^14, 4^10, 5^8, 6^4, 8, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.654 = CGGACGTAGATCACGG-1

using 539 reads

====================================================================================

graph has 286 edges initially, 30 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[19, 162, 353]
surviving nonsolo ucounts = 2[162, 353]
ids = [6, 3]

====================================================================================

UMI info for barcode CGGACGTAGATCACGG-1 contig 1 = ATCACATAAC...
umi GAATGTGACC = 216 reads: +18 -1XX +2 -1XX +3 -3XX +2 -1XX +4 -1XX +1 -1XX +4 -1XX +6 -2XX +2 -1XX +48 -1XX +4 -1XX +8 -1XX +11 -1XX +6 -2XX +8 -1XX +6 -3XX +3 -3XX +43 -3XX +4 -1XX +5 -4XX +5 -3XX +3 -1XX +30 -1XX +2 -1XX +3 -2XX +4 -3XX +13 -1XX +140 invalidated
umi GCACTCGCAT = 144 reads: +341 -1XX +1 -9X +1 -8XX +1 -5XX +3 -4XX +59 invalidated

GOOD CONTIGS

TIG 1[bases=542]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=1)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=1)
428-491 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
491-542 ==> 0-51 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARGPCCPTTSYYYYGMDVW at 400, score = 9 + 7
umis assigned: [3, 6]
of which 2 are surviving nonsolos
reads assigned: 358
start codons at 58, 209, 256, 355, 448, 509
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.656 = CGGACGTAGCCACTAT-1

using 454 reads

====================================================================================

graph has 200 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[448]
surviving nonsolo ucounts = 1[448]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=458]
4-285 ==> 70-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=18)
284-322 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
322-458 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 261, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 438
start codons at 9, 145, 364
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.658 = CGGACGTAGCCCGAAA-1

using 321 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2^2, 3, 6, 11, 295]
surviving nonsolo ucounts = 1[295]
ids = [2]

====================================================================================

UMI info for barcode CGGACGTAGCCCGAAA-1 contig 1 = ACCCAAAAAC...
umi ACCTGGATGG = 277 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=547]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=23)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-547 ==> 0-57 on |1|IGHA1|C-REGION| [len=1058] (mis=1)
junction support: 1 umis using 37 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.660 = CGGACGTAGCTAACAA-1

using 463 reads

====================================================================================

graph has 182 edges initially, 4 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 219, 242]
surviving nonsolo ucounts = 2[219, 242]
ids = [1, 2]

====================================================================================

UMI info for barcode CGGACGTAGCTAACAA-1 contig 1 = AAGCAGCACT...
umi TCACTTGCGA = 214 reads: +382 validated

UMI info for barcode CGGACGTAGCTAACAA-1 contig 2 = GAGGAATCAG...
umi TGATAACCCT = 223 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-25 ==> 226-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
25-345 ==> 0-320 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=34)
369-407 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
407-544 ==> 0-137 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CHIFDKDSDRVVF at 340, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 25, 76, 109, 227, 230, 323
confident = false
>vscore_40.660_84.9%
ATGGCCTGGACCTTTCTCCTCCTCGGCCTCCTCTCTCACTGCACAGACTCTATGACGTCCTTTGTGCTGACTCAGCCACCCTCAATGTCAGTGGCCCCAGGACAGACGGCCAGACTTCCCTGTGAGGGAGACAACATTGGCGGTAAAAGTGTGCACTGGTATCAGCACAAGGCAGGCCAGGCCCCTGTGTTGGTCATTTATTATGATGCCGCCCGACTCTCAGGAATCCCTGAGCGATTCTCTGCTTCCAATTCTGGGAACGCGGCCACCCTGACCATCAGCGGGGTCGAAGCCGGGGATGAAGCCGACTATTATTGTCACATTTTCGATAAGGACTCTGATCGTGTGGTT

TIG 2[bases=456]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-456 ==> 0-40 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 28, 34, 103, 239
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.661 = CGGACGTAGCTAACTC-1

using 226 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[2^2, 3, 219]
surviving nonsolo ucounts = 1[219]
ids = [2]

====================================================================================

UMI info for barcode CGGACGTAGCTAACTC-1 contig 1 = GCTCTGCTTC...
umi GATCTGTCTT = 213 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=516]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-516 ==> 0-71 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.667 = CGGACGTAGGGAAACA-1

using 303 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[3, 7^2, 8, 275]
surviving nonsolo ucounts = 1[275]
ids = [3]

====================================================================================

UMI info for barcode CGGACGTAGGGAAACA-1 contig 1 = GAGCTACAAC...
umi CGTATGTCGC = 264 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=513]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=9)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
430-513 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQHYYSIPPTF at 369, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.670 = CGGACGTAGGTACTCT-1

using 121 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 4, 113]
surviving nonsolo ucounts = 1[113]
ids = [1]

====================================================================================

UMI info for barcode CGGACGTAGGTACTCT-1 contig 1 = GGGAGGAACT...
umi CTCTATTAAT = 112 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-35 ==> 62-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
35-380 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=11)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQQFDNWPPLTF at 356, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 111
start codons at 35, 104, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.688 = CGGACGTCACAGGCCT-1

using 68 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[5, 61]
surviving nonsolo ucounts = 1[61]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.694 = CGGACGTCACGCGAAA-1

using 249 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[247]
surviving nonsolo ucounts = 1[247]
ids = [1]

====================================================================================

UMI info for barcode CGGACGTCACGCGAAA-1 contig 1 = AGCTTCAGCT...
umi TAAACCCCGC = 236 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=574]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=4)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
435-574 ==> 0-139 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CAAWDDSLNGPVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.700 = CGGACGTCAGCGTAAG-1

using 198 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[197]
surviving nonsolo ucounts = 1[197]
ids = [0]

====================================================================================

UMI info for barcode CGGACGTCAGCGTAAG-1 contig 1 = AGCTTCAGCT...
umi AGAACATCCA = 193 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=521]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-521 ==> 0-86 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 189
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.702 = CGGACGTCAGCTGTTA-1

using 452 reads

====================================================================================

graph has 154 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[209, 241]
surviving nonsolo ucounts = 2[209, 241]
ids = [3, 1]

====================================================================================

UMI info for barcode CGGACGTCAGCTGTTA-1 contig 1 = CTCTGCTTCA...
umi TCTAGATCTC = 205 reads: +394 validated

UMI info for barcode CGGACGTCAGCTGTTA-1 contig 2 = AGGAGTCAGA...
umi CATACAATCG = 225 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-50 ==> 1-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
50-406 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=1)
406-444 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
444-548 ==> 0-104 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQSYDSSLSGSYVF at 374, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 50, 204, 207, 258, 357, 384, 408
confident = false

TIG 2[bases=502]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=25)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-502 ==> 0-87 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQGNSFPYTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 27, 33, 89, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.704 = CGGACGTCATACTCTT-1

using 890 reads

====================================================================================

graph has 1264 edges initially, 10 edges after simplification

total ucounts = 458
nonsolo ucounts = 175[2^75, 3^44, 4^26, 5^7, 6^11, 7^4, 8^3, 9^2, 10, 13, 27]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.719 = CGGACGTGTAACGCGA-1

using 284 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[5, 279]
surviving nonsolo ucounts = 1[279]
ids = [0]

====================================================================================

UMI info for barcode CGGACGTGTAACGCGA-1 contig 1 = AGGAGTCAGA...
umi GTTTCAGTTA = 258 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=479]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-479 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYDSFSWTF at 354, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 27, 33, 89, 102, 238, 241, 334, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.734 = CGGACGTGTCTCCACT-1

using 704 reads

====================================================================================

graph has 978 edges initially, 8 edges after simplification

total ucounts = 391
nonsolo ucounts = 129[2^58, 3^37, 4^16, 5^4, 6^4, 7^3, 8^2, 9^2, 14, 17, 21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.739 = CGGACGTGTGCATCTA-1

using 61 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 12[2^3, 3^3, 4, 5^2, 6, 9^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.742 = CGGACGTGTGTCTGAT-1

using 195 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[195]
surviving nonsolo ucounts = 1[195]
ids = [0]

====================================================================================

UMI info for barcode CGGACGTGTGTCTGAT-1 contig 1 = AGCTGTGGGC...
umi ACTTTCATGC = 182 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=503]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=10)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
419-503 ==> 0-84 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 24 reads
cdr3 = CNSRDSSDNVVF at 355, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 40, 159, 188, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.747 = CGGACGTGTTCGGCAC-1

using 507 reads

====================================================================================

graph has 176 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 183, 320]
surviving nonsolo ucounts = 2[183, 320]
ids = [2, 3]

====================================================================================

UMI info for barcode CGGACGTGTTCGGCAC-1 contig 1 = GAGTCTCCCT...
umi TCGGGAGCGG = 318 reads: +430 validated

UMI info for barcode CGGACGTGTTCGGCAC-1 contig 2 = GGAATCAGTC...
umi GAATGCAGAG = 186 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=559]
0-58 ==> 1-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
58-411 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=14)
440-488 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
488-559 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARYGLRGLTVPRSPIDYW at 400, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 315
start codons at 58, 232, 256, 391, 410
confident = false

TIG 2[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 182
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.751 = CGGACGTTCAAACAAG-1

using 221 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[217]
surviving nonsolo ucounts = 1[217]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.755 = CGGACGTTCAGAGACG-1

using 310 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[306]
surviving nonsolo ucounts = 1[306]
ids = [4]

====================================================================================

UMI info for barcode CGGACGTTCAGAGACG-1 contig 1 = GAGTCAGTCC...
umi TCATTTGTCA = 310 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=24)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYDDLPITF at 352, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 305
start codons at 25, 31, 87, 100, 362, 365, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.756 = CGGACGTTCAGTGTTG-1

using 160 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 153]
surviving nonsolo ucounts = 1[153]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.762 = CGGACGTTCCAACCAA-1

using 221 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 217]
surviving nonsolo ucounts = 1[217]
ids = [3]

====================================================================================

UMI info for barcode CGGACGTTCCAACCAA-1 contig 1 = GGAGTCTCCC...
umi TTCGGGGCTA = 194 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=500]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=0)
437-471 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
471-500 ==> 0-29 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARQEDGSGSYLW at 401, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 59, 233, 257, 392, 417, 436, 489
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.768 = CGGACGTTCCGCATCT-1

using 299 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 5, 284]
surviving nonsolo ucounts = 1[284]
ids = [3]

====================================================================================

UMI info for barcode CGGACGTTCCGCATCT-1 contig 1 = GGAGTCAGTC...
umi CTTGGTCTCA = 257 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=505]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
417-505 ==> 0-88 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQYDNPPMYTF at 353, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 26, 32, 88, 101, 240, 363, 377, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.769 = CGGACGTTCCTCAATT-1

using 280 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 275]
surviving nonsolo ucounts = 1[275]
ids = [2]

====================================================================================

UMI info for barcode CGGACGTTCCTCAATT-1 contig 1 = GCTCTGCTTC...
umi CCCGGCCTTG = 273 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=653]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-384 ==> 0-333 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=11)
404-442 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
442-653 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQSNANNLDGFVF at 375, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 51, 175, 205, 208, 358, 385, 400, 574
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.770 = CGGACGTTCCTCCTAG-1

using 21 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.779 = CGGACGTTCGGCTACG-1

using 233 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 223]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.783 = CGGACGTTCTACGAGT-1

using 235 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[235]
surviving nonsolo ucounts = 1[235]
ids = [0]

====================================================================================

UMI info for barcode CGGACGTTCTACGAGT-1 contig 1 = GGCTGGGGTC...
umi GCTCTCCGTA = 225 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=532]
42-395 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
430-532 ==> 0-102 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CSSYTSSSTLVF at 366, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 42, 199, 243, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.797 = CGGACTGAGATATGGT-1

using 29 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[29]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.803 = CGGACTGAGCGATAGC-1

using 629 reads

====================================================================================

graph has 300 edges initially, 36 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[2^2, 7, 9, 298, 310]
surviving nonsolo ucounts = 2[298, 310]
ids = [1, 3]

====================================================================================

UMI info for barcode CGGACTGAGCGATAGC-1 contig 1 = GAATCAGTCC...
umi CGAGAATTCG = 312 reads: +22 -1XX +235 -2XX +128 invalidated

UMI info for barcode CGGACTGAGCGATAGC-1 contig 2 = GGAGTCAGAC...
umi TAATAAGACT = 313 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=16)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 25, 31, 100, 236, 455
confident = false

TIG 2[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYDSFSWTF at 353, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 26, 32, 88, 101, 237, 240, 333, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.804 = CGGACTGAGCGATTCT-1

using 177 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 8, 163]
surviving nonsolo ucounts = 1[163]
ids = [0]

====================================================================================

UMI info for barcode CGGACTGAGCGATTCT-1 contig 1 = GACCTCCTGT...
umi ACGAGTGTTG = 159 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=521]
18-374 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=4)
406-457 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=1)
457-521 ==> 0-64 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARAVRPGNTLLPGTNWFDPW at 363, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 156
start codons at 18, 62
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.805 = CGGACTGAGCTAGTGG-1

using 371 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 3, 4, 6, 15, 336]
surviving nonsolo ucounts = 1[336]
ids = [6]

====================================================================================

UMI info for barcode CGGACTGAGCTAGTGG-1 contig 1 = GAGTCAGACC...
umi GCAGATCGTC = 336 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |260|IGKV1D-8|5'UTR| [len=181] (mis=0)
25-378 ==> 0-353 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=2)
375-413 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYYSFPLTF at 352, score = 9 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 332
start codons at 25, 31, 87, 100, 163, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.806 = CGGACTGAGCTCCCAG-1

using 356 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 348]
surviving nonsolo ucounts = 1[348]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=515]
0-269 ==> 84-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
266-304 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
304-515 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CASWDDSLRGRVF at 237, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 342
start codons at 70, 220, 245, 250
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.813 = CGGACTGAGTGAAGAG-1

using 285 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[10, 272]
surviving nonsolo ucounts = 1[272]
ids = [4]

====================================================================================

UMI info for barcode CGGACTGAGTGAAGAG-1 contig 1 = GGGGAGGAAC...
umi TTCGCGTATG = 251 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=453]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-365 ==> 0-329 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=16)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
415-453 ==> 0-38 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQRKSWRTF at 357, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 36, 241, 244
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.816 = CGGACTGCAAAGAATC-1

using 237 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[233]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.819 = CGGACTGCAATCCGAT-1

using 510 reads

====================================================================================

graph has 250 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[236, 272]
surviving nonsolo ucounts = 2[236, 272]
ids = [3, 0]

====================================================================================

UMI info for barcode CGGACTGCAATCCGAT-1 contig 1 = AGCTGTGGGC...
umi ACGTTCGAGG = 265 reads: +379 validated

UMI info for barcode CGGACTGCAATCCGAT-1 contig 2 = GAGTCTCCCT...
umi GGTACCACTG = 234 reads: +453 -1 non-validated

GOOD CONTIGS

TIG 1[bases=564]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=7)
381-419 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=7)
419-564 ==> 0-145 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CNSRDSSGNHVF at 355, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 40, 159, 188, 235, 239, 338, 383, 551
confident = false

TIG 2[bases=522]
0-58 ==> 1-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
58-411 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=1)
417-444 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=2)
449-512 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=1)
junction support: 1 umis using 16 reads
cdr3 = CARHGGYYYGSGSYSKVYYYYYYMDVW at 400, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 58, 232, 256, 391, 410, 425, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.820 = CGGACTGCAATGAAAC-1

using 19 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.823 = CGGACTGCACACGCTG-1

using 85 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 17[2^5, 3^4, 5^2, 6, 7^2, 9, 10, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.826 = CGGACTGCACATGACT-1

using 804 reads

====================================================================================

graph has 260 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 39, 760]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.832 = CGGACTGCACGAGGTA-1

using 252 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[248]
surviving nonsolo ucounts = 1[248]
ids = [1]

====================================================================================

UMI info for barcode CGGACTGCACGAGGTA-1 contig 1 = GGGGAGGAGT...
umi ACTCTTCATC = 230 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=508]
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
381-419 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
419-508 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQSYSTPFTF at 358, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 31, 37, 93, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.844 = CGGACTGCAGTCGTGC-1

using 167 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[6, 159]
surviving nonsolo ucounts = 1[159]
ids = [3]

====================================================================================

UMI info for barcode CGGACTGCAGTCGTGC-1 contig 1 = GAGAGAGGAG...
umi TATTCCTTAA = 157 reads: +445 validated

GOOD CONTIGS

TIG 1[bases=543]
0-73 ==> 6-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=15)
468-518 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
518-543 ==> 0-25 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CAKVVAYFYDSRAKKTPCDAFDVW at 415, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 155
start codons at 73, 224, 229, 290, 376, 440, 470, 479, 499
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.847 = CGGACTGCATACGCCG-1

using 244 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[2, 6, 18, 218]
surviving nonsolo ucounts = 1[218]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=557]
10-80 ==> 5667-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=1)
383-421 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 32, 38, 107, 189, 243, 463
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.849 = CGGACTGCATCTATGG-1

using 407 reads

====================================================================================

graph has 154 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 144, 258]
surviving nonsolo ucounts = 2[144, 258]
ids = [0, 3]

====================================================================================

UMI info for barcode CGGACTGCATCTATGG-1 contig 1 = GAGAGATCAC...
umi ATGCGTGTAG = 125 reads: +436 validated

UMI info for barcode CGGACTGCATCTATGG-1 contig 2 = AGTCCCACTC...
umi TCTCTTGGCA = 234 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=524]
21-374 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
423-457 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
457-524 ==> 0-67 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 363, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 124
start codons at 21, 219, 224, 241, 285, 318, 511
confident = false

TIG 2[bases=499]
0-20 ==> 7-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
408-499 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 347, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 20, 26, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.850 = CGGACTGCATGAACCT-1

using 170 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[6, 161]
surviving nonsolo ucounts = 1[161]
ids = [1]

====================================================================================

UMI info for barcode CGGACTGCATGAACCT-1 contig 1 = AGCTTCAGCT...
umi TCGCCATTTT = 157 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=523]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-523 ==> 0-88 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 154
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.851 = CGGACTGCATGCCACG-1

using 146 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 31
nonsolo ucounts = 18[2^3, 3^3, 5, 6^2, 7^2, 8, 10, 12^2, 13, 14, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.852 = CGGACTGCATGCTGGC-1

using 299 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 6, 289]
surviving nonsolo ucounts = 2[6, 289]
ids = [2, 3]

====================================================================================

UMI info for barcode CGGACTGCATGCTGGC-1 contig 1 = AGTCAGTCCC...
umi TTAAGCCCTT = 5 reads: -87 +56 -34 +56 -78 +56 -21 non-validated
umi TTAAGCCTAT = 261 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=508]
0-24 ==> 7-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
24-375 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
412-508 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYDNLLWTF at 351, score = 9 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 264
start codons at 24, 30, 86, 99, 238, 361, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.853 = CGGACTGCATTAACCG-1

using 260 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 257]
surviving nonsolo ucounts = 1[257]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.855 = CGGACTGGTAAATACG-1

using 17365 reads

====================================================================================

graph has 6287 edges initially, 48 edges after simplification

total ucounts = 774
nonsolo ucounts = 348[2^124, 3^65, 4^37, 5^18, 6^9, 7^10, 8^7, 9^3, 10^3, 11^3, 15, 38, 41, 56, 83, 96, 114, 121, 127, 132, 140, 149, 164, 166^2, 171, 177, 193, 195, 205, 208, 210, 212, 214, 219, 220, 221, 222, 223, 224, 228, 229, 230^2, 231, 232, 233, 234, 236^2, 240, 245, 248, 253, 261, 274, 275, 278, 279, 283, 284, 286, 288, 290, 292, 303^2, 313, 317, 319^2, 326, 334, 338, 343, 345, 356, 357, 598]
surviving nonsolo ucounts = 65[56, 83, 96, 121, 127, 132, 140, 149, 164, 166^2, 171, 177, 193, 195, 205, 208, 210, 212, 214, 219, 220, 221, 222, 223, 224, 228, 229, 230^2, 231, 232, 233, 234, 236^2, 240, 245, 248, 253, 261, 274, 275, 278, 279, 283, 284, 286, 288, 290, 292, 303^2, 313, 317, 319^2, 326, 334, 338, 343, 345, 356, 357, 598]
ids = [560, 166, 282, 705, 513, 273, 181, 111, 6, 280, ...]

====================================================================================

UMI info for barcode CGGACTGGTAAATACG-1 contig 1 = TGGGGAGGAA...
umi AAGGTTTGGG = 207 reads: +388 validated
umi ACAGTGTTCG = 318 reads: +388 validated
umi ACATTGTTTC = 312 reads: +388 validated
umi ACCCTTGCGA = 257 reads: +388 validated
umi ACCGTTGTGA = 141 reads: +388 validated
umi ACTGCGCTCC = 284 reads: +388 validated
umi AGCACCGCTA = 344 reads: +388 validated
umi AGCCGCACGC = 284 reads: +388 validated
umi AGGCTGGTCC = 240 reads: +388 validated
umi AGGGGACCCC = 293 reads: +388 validated
umi AGTGCGGTAC = 231 reads: +388 validated
umi ATATATCCCT = 342 reads: +388 validated
umi ATCGAATCTT = 291 reads: +388 validated
umi ATTACTATCT = 140 reads: +388 validated
umi CACCTCTAGG = 360 reads: +388 validated
umi CATAGACATC = 319 reads: +388 validated
umi CCCCACGCAG = 291 reads: +388 validated
umi CCTTCTACTA = 317 reads: +388 validated
umi CTAACTGCTT = 172 reads: +388 validated
umi CTACTAACTG = 236 reads: +388 validated
umi CTTCATGGGT = 231 reads: +388 validated
umi CTTTTATAAG = 268 reads: +388 validated
umi CTTTTTCCCT = 341 reads: +388 validated
umi GAAACTCTTC = 284 reads: +388 validated
umi GGTTGTCCCT = 257 reads: +388 validated
umi GTCTGTACCT = 221 reads: +388 validated
umi GTGCTGAGCT = 281 reads: +388 validated
umi GTGGCATGTG = 596 reads: +388 validated
umi TCATGCTCCT = 334 reads: +388 validated
umi TCATTATCAG = 301 reads: +388 validated
umi TCCAACTACA = 327 reads: +388 validated
umi TCCTCGTCGG = 239 reads: +388 validated
umi TCGCCTTAGC = 226 reads: +388 validated
umi TCGGTCGTAC = 305 reads: +388 validated
umi TCTCTCTTCT = 245 reads: +388 validated
umi TGAAGTGGCG = 208 reads: +388 validated
umi TGCCACTCTT = 285 reads: +388 validated
umi TGCCTGCGTA = 277 reads: +388 validated
umi TGTTAGCTTT = 177 reads: +316 -1 +71 non-validated
umi TTAGCCAGGT = 238 reads: +388 validated
umi TTCATGTACT = 364 reads: +388 validated

UMI info for barcode CGGACTGGTAAATACG-1 contig 2 = AGCTCTCAGA...
umi AAATTCTCAC = 162 reads: +432 -16 non-validated
umi AACTATACCT = 241 reads: +448 validated
umi ACAGAGTGAC = 195 reads: +448 validated
umi AGCAGTTTTG = 220 reads: +416 -4 +28 non-validated
umi AGCTAACTCC = 141 reads: +448 validated
umi AGTGTATAGG = 236 reads: +426 -1 +5 -1 +2 -1 +7 -5 non-validated
umi AGTTGCATCT = 217 reads: +434 -1 +2 -1 +1 -1 +2 -1 +5 non-validated
umi ATCTGGCATC = 84 reads: +432 -16 non-validated
umi CCTACAAATC = 134 reads: +443 -5 non-validated
umi CCTGGTGCCC = 161 reads: +414 -1X +12 -21 invalidated
umi CCTTAATCCG = 93 reads: +448 validated
umi GATTGATATC = 225 reads: +448 validated
umi GCCACACCTC = 217 reads: +448 validated
umi GTACCCTAGA = 216 reads: +421 -1 +26 non-validated
umi GTCTGCTGCC = 115 reads: +448 validated
umi TACCTCGGTT = 164 reads: +448 validated
umi TATGATATAA = 216 reads: +448 validated
umi TGGACACAGC = 237 reads: +448 validated
umi TGGTTATATA = 236 reads: +448 validated
umi TTAAACGCCG = 123 reads: +396 -52 non-validated
umi TTCTCAGTCC = 242 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=1)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 41 umis using 1771 reads
cdr3 = CLQHNSYPWTF at 359, score = 9 + 8
umis assigned: [26, 55, 57, 66, 68, 88, 103, 108, 118, 119] and 31 others
of which 41 are surviving nonsolos
reads assigned: 11191
start codons at 32, 38, 107, 189, 243, 462
confident = true

TIG 2[bases=598]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=1)
449-466 ==> 0-17 on |9|IGHD1-20|D-REGION| [len=17] (mis=3)
479-527 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
527-598 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 14 umis using 147 reads
cdr3 = CARGPIRKGKSNWNDRSNGPGFDYW at 421, score = 9 + 7
umis assigned: [6, 13, 49, 105, 111, 129, 131, 166, 273, 280] and 11 others
of which 21 are surviving nonsolos
reads assigned: 3816
start codons at 79, 230, 235, 382, 473
confident = true

REJECT CONTIGS

TIG 1[bases=542]
18-376 ==> 0-358 on |99|IGHV2-70|L-REGION+V-REGION| [len=358] (mis=0)
401-440 ==> 7-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
440-542 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [7, 138, 560]
of which 3 are surviving nonsolos
reads assigned: 356
start codons at 18, 174, 241, 244, 324, 333, 386, 458, 519
confident = false
frameshifted full length stopped transcript of length 542
did not find CDR3
now this is a cell
paired!

AGAGGCCCGATCCGTAAAGGCAAGAGTAACTGGAACGACCGATCAAATGGTCCAGGTTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCTACAGCATAATAGTTACCCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.860 = CGGACTGGTCAAAGAT-1

using 96 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 29
nonsolo ucounts = 13[2^2, 3^2, 4, 5, 7^3, 8, 9, 10, 13]
surviving nonsolo ucounts = 1[13]
ids = [18]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.861 = CGGACTGGTCAAAGCG-1

using 509 reads

====================================================================================

graph has 186 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 501]
surviving nonsolo ucounts = 1[501]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.865 = CGGACTGGTCCAGTTA-1

using 44922 reads

====================================================================================

graph has 11984 edges initially, 142 edges after simplification

total ucounts = 848
nonsolo ucounts = 423[2^103, 3^73, 4^33, 5^24, 6^16, 7^2, 8^4, 9^5, 11^2, 12, 18, 19, 20, 22, 24, 33, 37, 44^2, 50, 80, 94^2, 117, 138, 142, 144, 145, 147, 151, 154, 163, 169, 175, 177, 179, 181, 185, 186, 187^2, 190, 193, 194, 196, 197, 199^4, 200, 201, 203, 204, 209^2, 211^2, 217, 219, 221, 222, 223, 224^3, 225^2, 227^3, 228, 229, 230, 232, 235, 238^2, 239^3, 240, 241, 242, 243, 244^2, 245, 246, 248, 249^4, 250^2, 254^2, 259^2, 261^3, 263^2, 265, 266^2, 268, 269^2, 270, 272^2, 273, 274, 278, 279, 285^2, 286, 288, 289, 291, 297, 303, 309, 311, 312, 316, 317, 322, 323, 324, 325, 328, 329^2, 333, 334, 336, 341, 342, 345, 349^2, 351^2, 357, 361, 362, 365, 372, 377^2, 380, 408, 486, 490, 512, 534, 594, 606, 670, 715, 778, 780, 790, 928, 1040]
surviving nonsolo ucounts = 147[44^2, 50, 80, 138, 142, 147, 151, 154, 163, 169, 175, 177, 179, 181, 185, 186, 187^2, 190, 193, 194, 196, 197, 199^4, 200, 201, 203, 204, 209^2, 211^2, 217, 219, 221, 222, 223, 224^3, 225^2, 227^3, 228, 229, 230, 232, 235, 238, 239^3, 240, 241, 242, 243, 244^2, 245, 246, 248, 249^4, 250^2, 254^2, 259^2, 261^3, 263^2, 265, 266^2, 268, 269^2, 270, 272^2, 273, 274, 278, 279, 285^2, 286, 288, 289, 291, 297, 303, 309, 311, 312, 316, 317, 322, 323, 324, 325, 328, 329^2, 333, 334, 336, 341, 342, 345, 349^2, 351^2, 357, 361, 362, 365, 372, 377^2, 380, 408, 486, 490, 512, 534, 594, 606, 670, 715, 778, 780, 790, 928, 1040]
ids = [216, 286, 752, 435, 680, 503, 127, 354, 563, 824, ...]

====================================================================================

UMI info for barcode CGGACTGGTCCAGTTA-1 contig 1 = GGATTTCCTT...
umi AACGCAGTGT = 290 reads: +418 validated
umi AAGACATCGC = 213 reads: +418 validated
umi AGCAATCCCC = 254 reads: +418 validated
umi ATGGGTTGGC = 41 reads: +365 -15 +28 -1 +9 non-validated
umi CCGAATTTGG = 46 reads: +341 -1 +25 -19 +32 non-validated
umi GGATTTTGTA = 181 reads: +418 validated
umi TAATGGTAAT = 162 reads: +418 validated
umi TCGAAATAGG = 139 reads: +418 validated
umi TCTCGAGCCT = 285 reads: -2X +416 invalidated
umi TGTGAGCACA = 50 reads: +339 -13 +66 non-validated
umi TTAAGTTACA = 196 reads: -12X +1 -7XX +1 -3XX +2 -3XX +3 -2XX +1 -6XX +2 -1XX +1 -1XX +372 invalidated
umi TTTATAGGCG = 271 reads: +418 validated
umi TTTATTATTC = 132 reads: +418 validated

UMI info for barcode CGGACTGGTCCAGTTA-1 contig 2 = GCTGGGGTCT...
umi AAATAGTAGG = 250 reads: +246 -1XX +2 -1XX +3 -1XX +1 -15XX +1 -2XX +115 invalidated
umi AAGACCGATC = 266 reads: +388 validated
umi AAGATTTTTT = 274 reads: +388 validated
umi AAGTCATTCC = 378 reads: +214 -6XX +1 -3XX +1 -1XX +1 -10XX +1 -39XX +3 -2XX +1 -3XX +2 -10XX +90 invalidated
umi AAGTTAGTCC = 215 reads: +388 validated
umi AAGTTGTTGC = 269 reads: +388 validated
umi AATAATTGGT = 227 reads: +388 validated
umi ACCAAAGCTC = 313 reads: +388 validated
umi ACCACACCCT = 223 reads: +388 validated
umi ACGTAATCCG = 182 reads: +388 validated
umi AGACTATGGC = 224 reads: +388 validated
umi AGATCTCATT = 481 reads: +388 validated
umi AGGTTTGCCC = 226 reads: +388 validated
umi AGTAACGGCA = 193 reads: +388 validated
umi AGTACACGCA = 236 reads: +388 validated
umi AGTATTTCTC = 538 reads: -368 +20 non-validated
umi AGTGGTCACT = 269 reads: +388 validated
umi ATAAATCGTG = 266 reads: +388 validated
umi ATAATCGCCT = 250 reads: +388 validated
umi ATGAGCCGTT = 252 reads: +388 validated
umi ATGATTAGTG = 251 reads: +388 validated
umi CAAGCCTACT = 227 reads: +388 validated
umi CATCGTTCGA = 247 reads: +388 validated
umi CGAGTGAGCT = 286 reads: +388 validated
umi CGATAGGGCC = 206 reads: +388 validated
umi CGGTGTACTA = 262 reads: +388 validated
umi CGTAAAGTCT = 223 reads: +388 validated
umi CGTAATGTTG = 265 reads: +388 validated
umi CTACAACCTT = 178 reads: +388 validated
umi CTCTAGTCCG = 244 reads: +388 validated
umi CTGGAAGGTG = 172 reads: +388 validated
umi CTGTTGCGAG = 150 reads: +388 validated
umi CTTCTTTGTG = 245 reads: +246 -1XX +2 -1XX +3 -1XX +1 -4XX +2 -9XX +1 -2XX +115 invalidated
umi GAAGTGTCCT = 174 reads: +388 validated
umi GAATCTTTCC = 288 reads: +388 validated
umi GACGGTCGCT = 244 reads: +388 validated
umi GATATACTAA = 278 reads: +388 validated
umi GATCCTCTTG = 271 reads: +388 validated
umi GCAATTCCAC = 263 reads: +388 validated
umi GCACTCGTTT = 209 reads: +388 validated
umi GCCAAGTCTG = 230 reads: +388 validated
umi GCGAATCAGG = 260 reads: +207 -5XX +176 invalidated
umi GCTCTCGCCT = 182 reads: +388 validated
umi GGAACAATTC = 237 reads: +388 validated
umi GGAATTGTTA = 1051 reads: -271X +49 -1XX +1 -6XX +1 -4XX +1 -2X +1 -2XX +1 -2XX +2 -4XX +1 -1XX +1 -1XX +36 invalidated
umi GGTCGTGTTA = 189 reads: +388 validated
umi GTACTTATTA = 261 reads: +388 validated
umi GTGTTGTCGG = 248 reads: +388 validated
umi GTTACTTTTC = 240 reads: +388 validated
umi TAAAATGTCC = 319 reads: +388 validated
umi TAACGGTTGC = 153 reads: +388 validated
umi TAATCTCGTG = 244 reads: +388 validated
umi TACCAAAAGT = 221 reads: +388 validated
umi TAGATAACTT = 197 reads: +388 validated
umi TAGATTCGCC = 228 reads: +388 validated
umi TAGGATTGCG = 198 reads: +388 validated
umi TATCACTCGG = 202 reads: +388 validated
umi TATGTCATTG = 264 reads: +388 validated
umi TATTAATCGG = 279 reads: +83 -1XX +304 invalidated
umi TCGATGCTAG = 199 reads: +388 validated
umi TGAAATATTC = 236 reads: +388 validated
umi TGAGTATGGT = 248 reads: +309 -1XX +78 invalidated
umi TGTAGTATTC = 195 reads: +388 validated
umi TTAGTTCTTC = 187 reads: +388 validated
umi TTATACACGA = 249 reads: +388 validated
umi TTATGTTCTT = 198 reads: +388 validated
umi TTGATTGCGC = 212 reads: +388 validated
umi TTGCAATTCT = 232 reads: +388 validated
umi TTGCGTTCAG = 222 reads: +388 validated
umi TTGCTTGGGA = 231 reads: +388 validated
umi TTTAAGTCTC = 246 reads: +388 validated
umi TTTGATGCGC = 191 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=563]
74-430 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=0)
454-492 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
492-563 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 9 umis using 191 reads
cdr3 = CARDEIQVATIGYW at 419, score = 9 + 7
umis assigned: [25, 32, 113, 216, 286, 474, 583, 680, 687, 752] and 3 others
of which 13 are surviving nonsolos
reads assigned: 2219
start codons at 30, 74, 118
confident = true

TIG 2[bases=640]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-392 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
429-640 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 68 umis using 2506 reads
cdr3 = CSSYTSSSTYVF at 365, score = 8 + 8
umis assigned: [13, 33, 35, 44, 46, 49, 51, 69, 72, 84] and 62 others
of which 72 are surviving nonsolos
reads assigned: 17911
start codons at 41, 198, 242, 249, 393, 561
confident = true

REJECT CONTIGS

TIG 1[bases=568]
22-63 ==> 5709-5750 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
49-396 ==> 0-347 on |288|IGKV3D-11|L-REGION+V-REGION| [len=347] (mis=1)
395-432 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [28, 47, 123, 127, 128, 136, 162, 184, 202, 204] and 38 others
of which 48 are surviving nonsolos
reads assigned: 14380
start codons at 49, 254, 257, 474
confident = false
did not find CDR3

TIG 2[bases=800]
0-269 ==> 11233-11502 on segment before IGLV3-6 exon 1 [len=11502] (mis=0)
64-110 ==> 0-46 on |365|IGLV3-27|L-REGION+V-REGION| [len=339] (mis=1)
266-305 ==> 56-95 on |365|IGLV3-27|L-REGION+V-REGION| [len=339] (mis=2) [SHIFT!]
266-342 ==> 56-132 on |361|IGLV3-22|L-REGION+V-REGION| [len=345] (mis=7) [SHIFT!]
450-522 ==> 246-318 on |365|IGLV3-27|L-REGION+V-REGION| [len=339] (mis=10) [SHIFT!]
469-522 ==> 265-318 on |361|IGLV3-22|L-REGION+V-REGION| [len=345] (mis=5) [SHIFT!]
519-550 ==> 0-31 on segment before IGLV2-5 exon 1 [len=6137] (mis=0)
551-589 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
589-800 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CHRYNRNSDELVVF at 519, score = 7 + 8
umis assigned: [108, 169, 179, 194, 400, 411, 413, 416, 435, 619] and 3 others
of which 13 are surviving nonsolos
reads assigned: 6728
start codons at 64, 176, 271, 321, 352, 358, 407, 465, 544
confident = false
not full
frameshifted full length stopped transcript of length 800
VJ delta = -126
delta too large
not full
now this is a cell
paired!

ACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAGACGAAATACAGGTGGCTACGATCGGCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTTATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.867 = CGGACTGGTCCGTTAA-1

using 214 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 209]
surviving nonsolo ucounts = 1[209]
ids = [0]

====================================================================================

UMI info for barcode CGGACTGGTCCGTTAA-1 contig 1 = GCTGGGGTCT...
umi GGTGATGGAT = 208 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-392 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
429-553 ==> 0-124 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CSSYTSSSTYVF at 365, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 41, 198, 242, 249, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.879 = CGGACTGGTTCGGCAC-1

using 13 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.882 = CGGACTGGTTTGACAC-1

using 282 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[277]
surviving nonsolo ucounts = 1[277]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.894 = CGGACTGTCATAGCAC-1

using 326 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 316]
surviving nonsolo ucounts = 1[316]
ids = [4]

====================================================================================

UMI info for barcode CGGACTGTCATAGCAC-1 contig 1 = GAGGAACTGC...
umi GCCAAATCCT = 317 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQRSNWPPAYTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 33, 238, 241, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.895 = CGGACTGTCCAGAAGG-1

using 271 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[5^2, 255]
surviving nonsolo ucounts = 1[255]
ids = [2]

====================================================================================

UMI info for barcode CGGACTGTCCAGAAGG-1 contig 1 = GTCAGTCTCA...
umi CCGAGACCGC = 258 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 24-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
23-360 ==> 0-337 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=27)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQMFSIPFTF at 350, score = 6 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 23, 29, 85, 98, 234, 237, 327, 359, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.905 = CGGACTGTCTGAGTGT-1

using 68 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 12[2^3, 3^2, 4^3, 6, 8, 11, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.910 = CGGACTGTCTTTACGT-1

using 619 reads

====================================================================================

graph has 298 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[5, 612]
surviving nonsolo ucounts = 1[612]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=491]
0-318 ==> 33-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=1)
318-355 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
355-491 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQLNSYPLTF at 294, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 586
start codons at 29, 178, 397
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.912 = CGGAGCTAGAACAACT-1

using 85 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 80]
surviving nonsolo ucounts = 1[80]
ids = [2]

====================================================================================

UMI info for barcode CGGAGCTAGAACAACT-1 contig 1 = ACAACAGGCA...
umi GATTGATCCC = 74 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=461]
0-25 ==> 150-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
25-388 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=12)
388-425 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
425-461 ==> 0-36 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 18 reads
cdr3 = CQQYYSTPLTF at 364, score = 10 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 74
start codons at 25, 94
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.913 = CGGAGCTAGAAGGGTA-1

using 302 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3^2, 291]
surviving nonsolo ucounts = 1[291]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=586]
6-331 ==> 19-344 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=18)
337-375 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
375-586 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CSSYISSTTLGF at 311, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 195, 198, 507
confident = false
not full
VJ delta = 27
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.918 = CGGAGCTAGATCACGG-1

using 624 reads

====================================================================================

graph has 176 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 265, 353]
surviving nonsolo ucounts = 2[265, 353]
ids = [6, 2]

====================================================================================

UMI info for barcode CGGAGCTAGATCACGG-1 contig 1 = AAGAACCTGC...
umi TCCGCACGGG = 252 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=591]
0-52 ==> 0-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
52-392 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
390-428 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
428-591 ==> 0-163 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQAWDSSTVVF at 367, score = 6 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 52, 57, 113, 200, 346, 350
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.922 = CGGAGCTAGCCACCTG-1

using 21 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[19]
surviving nonsolo ucounts = 1[19]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.925 = CGGAGCTAGCGAAGGG-1

using 129 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 121]
surviving nonsolo ucounts = 1[121]
ids = [4]

====================================================================================

UMI info for barcode CGGAGCTAGCGAAGGG-1 contig 1 = GAACTGCTCA...
umi TATGTTATAG = 107 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=501]
0-30 ==> 67-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
30-375 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
377-409 ==> 6-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
409-501 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CQQYNNWPLF at 351, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 105
start codons at 30, 99, 235, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.935 = CGGAGCTAGTTCGATC-1

using 283 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[283]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=489]
0-73 ==> 3261-3334 on rc of segment before IGKV2-24 exon 2 [len=3774] (mis=4)
0-73 ==> 3258-3331 on segment before IGKV2D-23 exon 1 [len=3772] (mis=4)
23-383 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=39)
386-423 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
423-489 ==> 0-66 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQATQFPPLTF at 359, score = 9 + 9
umis assigned: [0]
of which 0 are surviving nonsolos
reads assigned: 270
start codons at 56, 92, 180, 342, 362, 465
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.939 = CGGAGCTCAAGCTGGA-1

using 148 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 141]
surviving nonsolo ucounts = 1[141]
ids = [0]

====================================================================================

UMI info for barcode CGGAGCTCAAGCTGGA-1 contig 1 = GCGGGGGTAA...
umi CACATAAGGC = 127 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=489]
0-25 ==> 3-28 on |380|IGLV5-45|5'UTR| [len=28] (mis=0)
25-374 ==> 0-349 on |381|IGLV5-45|L-REGION+V-REGION| [len=369] (mis=18)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
428-489 ==> 0-61 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CMTPHNSAWVF at 367, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 25, 167, 299, 311, 350, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.940 = CGGAGCTCAAGGACTG-1

using 1046 reads

====================================================================================

graph has 1556 edges initially, 10 edges after simplification

total ucounts = 554
nonsolo ucounts = 201[2^100, 3^35, 4^27, 5^13, 6^11, 7^4, 8^4, 9^2, 10, 12, 13, 18^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.941 = CGGAGCTCAAGGTTCT-1

using 582 reads

====================================================================================

graph has 214 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 4[2, 180, 188, 203]
surviving nonsolo ucounts = 3[180, 188, 203]
ids = [0, 1, 8]

====================================================================================

UMI info for barcode CGGAGCTCAAGGTTCT-1 contig 1 = AGCTTCAGCT...
umi AAATATTCCG = 166 reads: +388 validated
umi AAATATTCGT = 181 reads: +388 validated
umi GCCAACTCGC = 194 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=574]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=28)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-574 ==> 0-139 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 108 reads
cdr3 = CAAWDDRLVGPVF at 368, score = 9 + 8
umis assigned: [0, 1, 8]
of which 3 are surviving nonsolos
reads assigned: 535
start codons at 47, 351, 381
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.950 = CGGAGCTCACAAGCCC-1

using 4808 reads

====================================================================================

graph has 1830 edges initially, 26 edges after simplification

total ucounts = 173
nonsolo ucounts = 57[2^13, 3^11, 4^7, 5, 6^2, 8^3, 9, 10, 11, 13, 39, 66, 79, 95, 154, 162, 208, 269, 288, 308, 316, 360, 372, 395, 686, 724]
surviving nonsolo ucounts = 12[39, 154, 162, 208, 269, 288, 308, 316, 360, 395, 686, 724]
ids = [13, 139, 112, 0, 133, 54, 124, 152, 93, 55, ...]

====================================================================================

UMI info for barcode CGGAGCTCACAAGCCC-1 contig 1 = AGCACTGGGA...
umi AAACAACAAT = 208 reads: +436 validated
umi ACCATTTTCG = 39 reads: +123 -1 +12 -1 +2 -20 +118 -1 +1 -1 +1 -1 +39 -1 +18 -20 +2 -1 +73 non-validated
umi CCTTTCTATA = 220 reads: +436 validated
umi CTCTCACACT = 158 reads: -291 +5 -1XX +2 -1XX +2 -3XX +6 -1XX +1 -2XX +2 -1XX +8 -1XX +24 -2XX +1 -10XX +1 -3XX +1 -22XX +3 -1X +1 -1XX +2 -2XX +9 -1XX +2 -1XX +3 -2XX +17 invalidated
umi GGAAGTCAGG = 159 reads: +436 validated
umi TATCTAGCCT = 157 reads: +436 validated

UMI info for barcode CGGAGCTCACAAGCCC-1 contig 2 = GGGGAGGAAC...
umi AAGTGGTTAC = 624 reads: -341X +1 -4XX +4 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi CATACGCCGA = 697 reads: +382 validated
umi CCTTTCTCCT = 395 reads: +382 validated
umi GTCCTCACAG = 285 reads: -346X +4 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi TACCTTTGCT = 272 reads: +382 validated
umi TCGAGTTTCT = 318 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=567]
0-60 ==> 161-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=0)
60-410 ==> 0-350 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=2)
433-496 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=5)
496-567 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 4 umis using 63 reads
cdr3 = CARDPDGSSWYDDLYNYGMDVW at 399, score = 9 + 7
umis assigned: [0, 13, 54, 68, 112, 139]
of which 5 are surviving nonsolos
reads assigned: 924
start codons at 60, 216, 360, 453
confident = true

TIG 2[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 4 umis using 247 reads
cdr3 = CQQRSNWPRTF at 357, score = 9 + 8
umis assigned: [8, 41, 55, 124, 133, 152]
of which 6 are surviving nonsolos
reads assigned: 2542
start codons at 36, 241, 244, 460
confident = true
now this is a cell
paired!

TACTGTGCGAGAGATCCGGACGGCAGCAGCTGGTACGACGACTTATACAACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCCTCGGACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.953 = CGGAGCTCACAGGTTT-1

using 292 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[288]
surviving nonsolo ucounts = 1[288]
ids = [0]

====================================================================================

UMI info for barcode CGGAGCTCACAGGTTT-1 contig 1 = GAGTCAGTCC...
umi AAGGCATACC = 253 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=480]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
375-413 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
413-480 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYDNLPLTF at 352, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 25, 31, 87, 100, 239, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.955 = CGGAGCTCACCGCTAG-1

using 194 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[191]
surviving nonsolo ucounts = 1[191]
ids = [0]

====================================================================================

UMI info for barcode CGGAGCTCACCGCTAG-1 contig 1 = AGGAGTCAGA...
umi CCTTATCCTT = 192 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=3)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYNSYPWTF at 354, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 27, 33, 89, 102, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.959 = CGGAGCTCACGGCTAC-1

using 529 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[9, 13, 506]
surviving nonsolo ucounts = 2[13, 506]
ids = [1, 3]

====================================================================================

UMI info for barcode CGGAGCTCACGGCTAC-1 contig 1 = TGGGGAGGAA...
umi CGGTTTTCTT = 13 reads: +40 -27 +56 -25 +168 -38 +30 -1 +3 non-validated
umi TATTCATCCT = 511 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 76 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 514
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.960 = CGGAGCTCACGGTAGA-1

using 1597 reads

====================================================================================

graph has 916 edges initially, 14 edges after simplification

total ucounts = 168
nonsolo ucounts = 65[2^29, 3^13, 4^4, 5^5, 7^3, 9^2, 10, 11, 19, 108, 110, 184, 187, 318, 370]
surviving nonsolo ucounts = 7[19, 108, 110, 184, 187, 318, 370]
ids = [67, 46, 129, 71, 22, 94, 116]

====================================================================================

UMI info for barcode CGGAGCTCACGGTAGA-1 contig 1 = AGGAGTCAGA...
umi ATCACAGTCT = 182 reads: +388 validated
umi CCATTGGCGG = 2 reads: -352X +36 invalidated
umi CTCGGTTGCG = 19 reads: +103 -1 +143 -4 +9 -1 +23 -2 +8 -1X +2 -1 +9 -43 +38 invalidated
umi CTGCTATATG = 185 reads: +388 validated
umi GCGCTGGTCC = 318 reads: +388 validated
umi TATAAATCTT = 35 reads: -320X +1 -1XX +1 -2XX +1 -3XX +1 -1XX +1 -5XX +1 -14XX +36 invalidated

UMI info for barcode CGGAGCTCACGGTAGA-1 contig 2 = TGGGGGTGCT...
umi GTCATTTAGG = 367 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 99 reads
cdr3 = CQQYNSYPRTF at 354, score = 8 + 8
umis assigned: [22, 46, 67, 71, 94, 129]
of which 6 are surviving nonsolos
reads assigned: 730
start codons at 27, 33, 89, 102, 334, 457
confident = true

TIG 2[bases=522]
21-392 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=2)
403-451 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
451-522 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CARTPPVAAFDYW at 381, score = 9 + 7
umis assigned: [116]
of which 1 are surviving nonsolos
reads assigned: 364
start codons at 21, 42, 86, 172
confident = true
now this is a cell
paired!

GTGACCGCCGCGGACACGGCTGTGTATTACTGTGCGAGAACCCCACCAGTGGCTGCTTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATCCTCGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.962 = CGGAGCTCACTCTGTC-1

using 225 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[225]
surviving nonsolo ucounts = 1[225]
ids = [0]

====================================================================================

UMI info for barcode CGGAGCTCACTCTGTC-1 contig 1 = CTGATCAGGA...
umi TCAGCTGCCA = 224 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=565]
32-392 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=9)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CMQGTHWPLTF at 368, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 32, 65, 93, 101, 189, 351, 371, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.973 = CGGAGCTCATCACGTA-1

using 315 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[11, 13, 288]
surviving nonsolo ucounts = 1[288]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=551]
1-30 ==> 5971-6000 on rc of segment after IGKV1-37 exon 1 [len=6000] (mis=0)
1-30 ==> 5971-6000 on segment before IGKV1D-37 exon 1 [len=6000] (mis=0)
6-78 ==> 5665-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
30-383 ==> 0-353 on |251|IGKV1D-37|L-REGION+V-REGION| [len=353] (mis=4)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 30, 36, 92, 340, 373, 457
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.975 = CGGAGCTCATCGACGC-1

using 301 reads

====================================================================================

graph has 152 edges initially, 4 edges after simplification

total ucounts = 14
nonsolo ucounts = 11[2^2, 3, 4^2, 5, 9, 10, 14^2, 231]
surviving nonsolo ucounts = 2[14, 231]
ids = [10, 1]

====================================================================================

UMI info for barcode CGGAGCTCATCGACGC-1 contig 1 = GCAGTCAGTC...
umi ATTCGACGGC = 231 reads: +394 validated
umi TACGAGAGAC = 11 reads: -383 +3 -1X +2 -2X +2 -1X invalidated

GOOD CONTIGS

TIG 1[bases=556]
26-377 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=1)
382-420 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQLNSYPRRITF at 353, score = 8 + 8
umis assigned: [1, 10]
of which 2 are surviving nonsolos
reads assigned: 240
start codons at 26, 32, 88, 237, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.977 = CGGAGCTCATGCGCAC-1

using 478 reads

====================================================================================

graph has 408 edges initially, 4 edges after simplification

total ucounts = 95
nonsolo ucounts = 32[2^16, 3^3, 4, 5^4, 6, 7^2, 8^2, 10, 17, 287]
surviving nonsolo ucounts = 1[287]
ids = [7]

====================================================================================

UMI info for barcode CGGAGCTCATGCGCAC-1 contig 1 = TGGGGAGTCA...
umi AATCTTTCGT = 245 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=474]
29-382 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
414-474 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQSYSTPSF at 356, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 29, 35, 91, 104, 240, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.981 = CGGAGCTGTAGCTAAA-1

using 589 reads

====================================================================================

graph has 182 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 7, 81, 243, 253]
surviving nonsolo ucounts = 3[81, 243, 253]
ids = [0, 5, 1]

====================================================================================

UMI info for barcode CGGAGCTGTAGCTAAA-1 contig 1 = GAGGAACTGC...
umi ACCAACACGC = 224 reads: +388 validated

UMI info for barcode CGGAGCTGTAGCTAAA-1 contig 2 = GGGATCACAC...
umi AATTGATTGG = 79 reads: +418 validated
umi GCAAAACGTA = 238 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=515]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=6)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-515 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYNNWPPMYTF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 33, 102, 238, 381, 463
confident = true

TIG 2[bases=553]
0-60 ==> 0-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=3)
60-413 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=22)
432-478 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=8)
478-553 ==> 0-75 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 2 umis using 34 reads
cdr3 = CLTENSDFWSGFPYW at 402, score = 10 + 7
umis assigned: [0, 5]
of which 2 are surviving nonsolos
reads assigned: 314
start codons at 60, 221, 258, 324, 357
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.989 = CGGAGCTGTCTAGCGC-1

using 716 reads

====================================================================================

graph has 896 edges initially, 4 edges after simplification

total ucounts = 329
nonsolo ucounts = 112[2^56, 3^23, 4^15, 5^9, 6^5, 7^2, 10, 157]
surviving nonsolo ucounts = 1[157]
ids = [48]

====================================================================================

UMI info for barcode CGGAGCTGTCTAGCGC-1 contig 1 = AGCTCAGCTT...
umi ACTACCTGTC = 143 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
0-52 ==> 62-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
52-405 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
402-440 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
440-494 ==> 0-54 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CASWDDSLRGRVF at 373, score = 8 + 8
umis assigned: [48]
of which 1 are surviving nonsolos
reads assigned: 142
start codons at 52, 206, 356, 381, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.992 = CGGAGCTGTGCTAGCC-1

using 227 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 6, 216]
surviving nonsolo ucounts = 1[216]
ids = [0]

====================================================================================

UMI info for barcode CGGAGCTGTGCTAGCC-1 contig 1 = GTCAGTCCCA...
umi ACAAATGCGT = 182 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=501]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=6)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
411-501 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQYGNLSWTF at 350, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 23, 29, 85, 98, 237, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.996 = CGGAGCTGTTCTGTTT-1

using 98 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[9, 89]
surviving nonsolo ucounts = 1[89]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=464]
0-341 ==> 10-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
340-378 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
378-464 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 317, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 81
start codons at 65, 201, 420
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.997 = CGGAGCTTCACAAACC-1

using 465 reads

====================================================================================

graph has 200 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[193, 268]
surviving nonsolo ucounts = 2[193, 268]
ids = [0, 4]

====================================================================================

UMI info for barcode CGGAGCTTCACAAACC-1 contig 1 = AAAAACCACA...
umi AAGTTCGCAA = 181 reads: +436 validated
umi TGACCGCGAG = 255 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=567]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-567 ==> 0-81 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 41 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [0, 4]
of which 2 are surviving nonsolos
reads assigned: 428
start codons at 50, 248, 253, 270, 314, 347, 540
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1003 = CGGAGCTTCCGAAGAG-1

using 159 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[159]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1027 = CGGAGTCAGCCACGCT-1

using 555 reads

====================================================================================

graph has 810 edges initially, 4 edges after simplification

total ucounts = 302
nonsolo ucounts = 107[2^50, 3^22, 4^14, 5^8, 6^5, 7, 8^4, 9^2, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1032 = CGGAGTCAGCTGCCCA-1

using 263 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[28, 234]
surviving nonsolo ucounts = 1[234]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=518]
0-52 ==> 7-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
0-52 ==> 11312-11364 on rc of segment before IGHV3-19 exon 1 [len=11364] (mis=1)
38-70 ==> 10108-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
52-286 ==> 0-234 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=10)
286-403 ==> 236-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=11) [SHIFT!]
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-518 ==> 0-32 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 52, 250, 255, 272, 314, 347
confident = false
frameshifted full length stopped transcript of length 518
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1036 = CGGAGTCAGGCATTGG-1

using 701 reads

====================================================================================

graph has 286 edges initially, 8 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 7, 291, 398]
surviving nonsolo ucounts = 2[291, 398]
ids = [1, 3]

====================================================================================

UMI info for barcode CGGAGTCAGGCATTGG-1 contig 1 = AGCTTCAGCT...
umi CTTTCAGAAA = 403 reads: +388 validated

UMI info for barcode CGGAGTCAGGCATTGG-1 contig 2 = GGAGAAGAGC...
umi ACCCACACAA = 3 reads: -224 +4 -1X +1 -1X +2 -2X +4 -1X +20 -1X +2 -1X +2 -1X +5 -1X +2 -1X +2 -1X +1 -41 +2 -1X +1 -7X +1 -1XX +1 -1XX +1 -1XX +1 -5XX +1 -1XX +1 -1XX +2 -1XX +1 -1XX +2 -1XX +27 -5 invalidated
umi ACTTTGATAG = 250 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-355 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CVAWDDSLYAWVF at 368, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 393
start codons at 47, 351, 381, 393
confident = false

TIG 2[bases=485]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
424-485 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYGSSPPYTF at 360, score = 9 + 8
umis assigned: [0, 1]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 36, 244, 370, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1042 = CGGAGTCAGTGCCAGA-1

using 164 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[159]
surviving nonsolo ucounts = 1[159]
ids = [0]

====================================================================================

UMI info for barcode CGGAGTCAGTGCCAGA-1 contig 1 = GGGGTCACAA...
umi AACCTGATTA = 149 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=543]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=23)
395-423 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
423-543 ==> 0-120 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 25 reads
cdr3 = CFSYGSSGRTF at 362, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 146
start codons at 38, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1046 = CGGAGTCCAAACCTAC-1

using 321 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^2, 4, 8, 303]
surviving nonsolo ucounts = 2[4, 303]
ids = [3, 6]

====================================================================================

UMI info for barcode CGGAGTCCAAACCTAC-1 contig 1 = GGAATCAGTC...
umi TACTCTGATG = 4 reads: -79 +22 -1 +33 -97 +1 -1 +63 -91 non-validated
umi TTTAGAGTAC = 283 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=489]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-489 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [3, 6]
of which 2 are surviving nonsolos
reads assigned: 282
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1056 = CGGAGTCCACCAGTTA-1

using 302 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3^2, 6, 286]
surviving nonsolo ucounts = 1[286]
ids = [6]

====================================================================================

UMI info for barcode CGGAGTCCACCAGTTA-1 contig 1 = TGGGGTGCTC...
umi GAGAACTTCC = 282 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=530]
20-391 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
413-459 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
459-530 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARGAARSGTVTLDYW at 380, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 20, 41, 85, 171, 276
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1061 = CGGAGTCCACGACGAA-1

using 448 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 444]
surviving nonsolo ucounts = 1[444]
ids = [1]

====================================================================================

UMI info for barcode CGGAGTCCACGACGAA-1 contig 1 = AGTGACTCCT...
umi CTACCGACAC = 445 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=524]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=4)
385-406 ==> 0-21 on |20|IGHD3-22|D-REGION| [len=31] (mis=2)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
453-524 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CAHRLRSDYYDSSGHPDYW at 365, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 439
start codons at 20, 64, 243, 246, 326, 335, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1062 = CGGAGTCCACGGCGTT-1

using 466 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[465]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1065 = CGGAGTCCACTGTCGG-1

using 460 reads

====================================================================================

graph has 196 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[202, 255]
surviving nonsolo ucounts = 2[202, 255]
ids = [4, 3]

====================================================================================

UMI info for barcode CGGAGTCCACTGTCGG-1 contig 1 = GAATCAGTCC...
umi TACACTTATG = 189 reads: +388 validated

UMI info for barcode CGGAGTCCACTGTCGG-1 contig 2 = ACCCAAAAAC...
umi CGGACCTTTG = 242 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=512]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-512 ==> 0-99 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 25, 31, 100, 236, 455
confident = false

TIG 2[bases=533]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-533 ==> 0-43 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1066 = CGGAGTCCACTTACGA-1

using 327 reads

====================================================================================

graph has 101 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 324]
surviving nonsolo ucounts = 1[324]
ids = [1]

====================================================================================

UMI info for barcode CGGAGTCCACTTACGA-1 contig 1 = AGGCTGGTCA...
umi CTAATATGTA = 323 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=571]
0-47 ==> 134-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
47-398 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
397-435 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYDSFSWTF at 374, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 319
start codons at 47, 53, 109, 122, 258, 261, 354, 384, 477
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1068 = CGGAGTCCAGACGCAA-1

using 269 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 4, 261]
surviving nonsolo ucounts = 1[261]
ids = [2]

====================================================================================

UMI info for barcode CGGAGTCCAGACGCAA-1 contig 1 = GGAGGAATCA...
umi AGATGGAGAG = 264 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
29-380 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CLQYSSSPWTF at 356, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 29, 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1071 = CGGAGTCCAGCGTAAG-1

using 164 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 3, 156]
surviving nonsolo ucounts = 1[156]
ids = [4]

====================================================================================

UMI info for barcode CGGAGTCCAGCGTAAG-1 contig 1 = CAGTCAGGAC...
umi TGAATACCTC = 145 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=460]
15-366 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
365-403 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
403-460 ==> 0-57 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQQYDSFSWTF at 342, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 140
start codons at 15, 21, 77, 90, 226, 229, 322, 352, 445
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1079 = CGGAGTCCATACGCCG-1

using 315 reads

====================================================================================

graph has 484 edges initially, 2 edges after simplification

total ucounts = 174
nonsolo ucounts = 62[2^31, 3^15, 4^9, 5^2, 6, 8, 9, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1103 = CGGAGTCGTTGGAGGT-1

using 46 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[7, 39]
surviving nonsolo ucounts = 2[7, 39]
ids = [1, 0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1109 = CGGAGTCTCAGAGACG-1

using 309 reads

====================================================================================

graph has 178 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[5, 303]
surviving nonsolo ucounts = 1[303]
ids = [0]

====================================================================================

UMI info for barcode CGGAGTCTCAGAGACG-1 contig 1 = AGAGAGGTGC...
umi CCAATAGATA = 259 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=515]
0-72 ==> 7-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
72-425 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=12)
457-508 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=6)
junction support: 1 umis using 18 reads
cdr3 = CARNTDCSSTRCYDVGWFDRW at 414, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 72, 223, 228, 375, 451, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1112 = CGGAGTCTCATGTCCC-1

using 321 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 314]
surviving nonsolo ucounts = 1[314]
ids = [2]

====================================================================================

UMI info for barcode CGGAGTCTCATGTCCC-1 contig 1 = CGAGCCCAGC...
umi GACTGGTTAA = 272 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=515]
0-67 ==> 0-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
67-420 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=2)
429-482 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=0)
482-515 ==> 0-33 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CASATRSYWYFDLW at 409, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 67, 218, 223, 281, 284, 370, 500
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1113 = CGGAGTCTCATTGCCC-1

using 615 reads

====================================================================================

graph has 922 edges initially, 6 edges after simplification

total ucounts = 321
nonsolo ucounts = 110[2^47, 3^24, 4^17, 5^3, 6^4, 7^8, 9^4, 12, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1120 = CGGAGTCTCCGGGTGT-1

using 327 reads

====================================================================================

graph has 156 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[65, 257]
surviving nonsolo ucounts = 2[65, 257]
ids = [0, 2]

====================================================================================

UMI info for barcode CGGAGTCTCCGGGTGT-1 contig 1 = AGTCTCAGTC...
umi ATTACGGGTG = 239 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=0)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
408-503 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQSYSTPPTF at 347, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1123 = CGGAGTCTCGCCGTGA-1

using 218 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 211]
surviving nonsolo ucounts = 1[211]
ids = [4]

====================================================================================

UMI info for barcode CGGAGTCTCGCCGTGA-1 contig 1 = CGAGCCCAGC...
umi TGCTATCAGC = 206 reads: +454 validated

GOOD CONTIGS

TIG 1[bases=529]
0-67 ==> 0-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
67-420 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=0)
458-521 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
junction support: 1 umis using 4 reads
cdr3 = CARDLGYYGSGSYYVRGFYYYYGMDVW at 409, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 67, 218, 223, 281, 284, 370, 431, 449, 478
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1124 = CGGAGTCTCGCCTGAG-1

using 205 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[201]
surviving nonsolo ucounts = 1[201]
ids = [4]

====================================================================================

UMI info for barcode CGGAGTCTCGCCTGAG-1 contig 1 = GCTCTGCTTC...
umi TTCTTTGGCT = 187 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=525]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-525 ==> 0-80 on |305|IGLC1|C-REGION| [len=317] (mis=2)
junction support: 1 umis using 32 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1125 = CGGAGTCTCGCTTAGA-1

using 688 reads

====================================================================================

graph has 298 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[252, 433]
surviving nonsolo ucounts = 2[252, 433]
ids = [0, 4]

====================================================================================

UMI info for barcode CGGAGTCTCGCTTAGA-1 contig 1 = GGGGTCACAA...
umi AGCCCCACCC = 251 reads: +385 validated
umi TCGGTGTCTT = 432 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=634]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=26)
385-423 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
423-634 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=2)
junction support: 2 umis using 122 reads
cdr3 = CFSYGNTGRVF at 362, score = 8 + 8
umis assigned: [0, 4]
of which 2 are surviving nonsolos
reads assigned: 674
start codons at 38, 249, 372, 555
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1128 = CGGAGTCTCGTCCGTT-1

using 68 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 66]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1129 = CGGAGTCTCTAACGGT-1

using 20 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1135 = CGGAGTCTCTGCTGTC-1

using 287 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 1[279]
surviving nonsolo ucounts = 1[279]
ids = [3]

====================================================================================

UMI info for barcode CGGAGTCTCTGCTGTC-1 contig 1 = GAATCAGTCC...
umi CAACACCTTC = 277 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1141 = CGGAGTCTCTTCCTTC-1

using 287 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 5^2, 270]
surviving nonsolo ucounts = 1[270]
ids = [3]

====================================================================================

UMI info for barcode CGGAGTCTCTTCCTTC-1 contig 1 = GGGGAGTGAC...
umi GCAATACCCT = 261 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=583]
24-382 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
407-457 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
457-583 ==> 0-126 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 36 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 369, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 24, 68, 247, 250, 253, 339, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1144 = CGGCTAGAGAACAATC-1

using 186 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 182]
surviving nonsolo ucounts = 1[182]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=449]
0-49 ==> 10-59 on |62|IGHV1-18|5'UTR| [len=59] (mis=1)
0-49 ==> 11315-11364 on rc of segment before IGHV3-19 exon 1 [len=11364] (mis=1)
35-67 ==> 10108-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
49-301 ==> 0-252 on |63|IGHV1-18|L-REGION+V-REGION| [len=351] (mis=12)
409-443 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 172
start codons at 49, 247, 252, 269, 332
confident = false
full length transcript of length 449
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1150 = CGGCTAGAGCACACAG-1

using 191 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[6, 183]
surviving nonsolo ucounts = 1[183]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1155 = CGGCTAGAGCTCCTCT-1

using 210 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[205]
surviving nonsolo ucounts = 1[205]
ids = [2]

====================================================================================

UMI info for barcode CGGCTAGAGCTCCTCT-1 contig 1 = ATCAGTCCCA...
umi CCGTAACGGC = 181 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=446]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=1)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
411-446 ==> 0-35 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CLQHNSYPPAF at 350, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 23, 29, 98, 180, 234
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1158 = CGGCTAGAGGACAGCT-1

using 59 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 55]
surviving nonsolo ucounts = 1[55]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1159 = CGGCTAGAGGCCCTCA-1

using 332 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 328]
surviving nonsolo ucounts = 1[328]
ids = [2]

====================================================================================

UMI info for barcode CGGCTAGAGGCCCTCA-1 contig 1 = GAGTCAGACT...
umi GGCAACTGTG = 330 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYNGQSRAF at 352, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 25, 31, 100, 236, 239, 332, 365, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1167 = CGGCTAGAGGTGATAT-1

using 47 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[46]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1177 = CGGCTAGAGTGGAGAA-1

using 226 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[225]
surviving nonsolo ucounts = 1[225]
ids = [0]

====================================================================================

UMI info for barcode CGGCTAGAGTGGAGAA-1 contig 1 = TGGGGGGAGT...
umi CGCCTCGCCA = 227 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQSYTTPWTF at 358, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1179 = CGGCTAGAGTGTCTCA-1

using 279 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 4, 271]
surviving nonsolo ucounts = 1[271]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=564]
2-280 ==> 37-315 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=12)
315-353 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
353-564 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CTSYAGGSNVVF at 289, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 173, 272, 299, 314
confident = false
not full
VJ delta = 20
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1195 = CGGCTAGCACATTCGA-1

using 371 reads

====================================================================================

graph has 178 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3^2, 165, 198]
surviving nonsolo ucounts = 2[165, 198]
ids = [1, 5]

====================================================================================

UMI info for barcode CGGCTAGCACATTCGA-1 contig 1 = AAAAACCACA...
umi ACCTGTTGGT = 1 reads: -26 +21 -1 +18 -1X +15 -354 invalidated
umi ATATGGTCCT = 154 reads: +436 validated

UMI info for barcode CGGCTAGCACATTCGA-1 contig 2 = AGAGCTCTGG...
umi TGTCTGATGA = 200 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=566]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-566 ==> 0-80 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [0, 1]
of which 1 are surviving nonsolos
reads assigned: 155
start codons at 50, 248, 253, 270, 314, 347, 540
confident = false

TIG 2[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=13)
390-429 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQYGRSPGTF at 368, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 44, 252, 378, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1198 = CGGCTAGCACCCAGTG-1

using 407 reads

====================================================================================

graph has 170 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[199, 205]
surviving nonsolo ucounts = 2[199, 205]
ids = [3, 1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=458]
7-41 ==> 5966-6000 on rc of segment after IGHV4-4 exon 1 [len=6000] (mis=0)
20-391 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
411-458 ==> 0-47 on |57|IGHJ5|J-REGION| [len=51] (mis=1)
cdr3 = CARGPAYGDYENWFDPW at 380, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 158
start codons at 20, 41, 85, 171
confident = false
VJ delta = 11
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1203 = CGGCTAGCACGTTGGC-1

using 602 reads

====================================================================================

graph has 644 edges initially, 2 edges after simplification

total ucounts = 212
nonsolo ucounts = 63[2^38, 3^11, 4^5, 5^3, 6^2, 7^2, 8, 275]
surviving nonsolo ucounts = 1[275]
ids = [200]

====================================================================================

UMI info for barcode CGGCTAGCACGTTGGC-1 contig 1 = GCAGGAGTCA...
umi TTATCAGTGC = 225 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
0-29 ==> 18-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
29-380 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
417-495 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQSYRRPITF at 356, score = 8 + 8
umis assigned: [200]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 29, 35, 91, 104, 240, 339, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1208 = CGGCTAGCAGATGAGC-1

using 5357 reads

====================================================================================

graph has 2838 edges initially, 30 edges after simplification

total ucounts = 461
nonsolo ucounts = 164[2^70, 3^26, 4^11, 5^16, 6^7, 7^3, 8, 9, 11, 12, 13, 14, 17^2, 68, 71, 92, 115, 123, 133, 155, 168, 178^2, 182, 190, 192, 195, 205, 208, 212, 223, 232, 254, 313, 367, 500]
surviving nonsolo ucounts = 24[17, 68, 71, 92, 115, 123, 133, 155, 168, 178^2, 182, 190, 192, 195, 205, 208, 212, 223, 232, 254, 313, 367, 500]
ids = [197, 64, 13, 15, 444, 45, 255, 133, 373, 235, ...]

====================================================================================

UMI info for barcode CGGCTAGCAGATGAGC-1 contig 1 = GAGCTACAAC...
umi AAAGCAGGGG = 192 reads: +400 validated
umi AAGGACGCGG = 91 reads: +370 -1 +29 non-validated
umi ACTCATATGG = 117 reads: +400 validated
umi ATCTTCCTTT = 211 reads: +400 validated
umi CAAGTCCGGT = 2 reads: -364X +36 invalidated
umi CATCATAGGC = 153 reads: -330X +3 -1XX +1 -2XX +1 -5XX +1 -5XX +1 -14XX +36 invalidated
umi GACGAGTTGA = 180 reads: +400 validated
umi GCCGTACCTG = 131 reads: +400 validated
umi TAATGCCCCT = 310 reads: -314 +86 non-validated
umi TCGGGGTACT = 213 reads: +400 validated
umi TCGGTCGGGA = 101 reads: -331 +2 -1XX +1 -2XX +1 -5XX +1 -5XX +1 -14XX +36 invalidated
umi TCTACCTTCG = 230 reads: +400 validated
umi TGACATATTT = 252 reads: +400 validated
umi TGTCAAGGGT = 180 reads: +400 validated

UMI info for barcode CGGCTAGCAGATGAGC-1 contig 2 = AGCTCTGGGA...
umi AAGCCGGGTA = 73 reads: +421 -6 non-validated
umi AGCCTAGTCC = 69 reads: +427 validated
umi ATGCATGCGG = 193 reads: +427 validated
umi CAAGGTGTAC = 208 reads: +427 validated
umi CCAGTAGGTT = 198 reads: +427 validated
umi CGTAGTCCTC = 14 reads: -408 +19 non-validated
umi TCCGCATCCG = 170 reads: +427 validated
umi TGACTATCCT = 186 reads: +410 -17 non-validated
umi TTGTTTACCG = 116 reads: +388 -39 non-validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
392-430 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 250 reads
cdr3 = CQQYYSTPRTF at 369, score = 9 + 8
umis assigned: [5, 15, 45, 106, 133, 154, 235, 255, 330, 380] and 4 others
of which 14 are surviving nonsolos
reads assigned: 2324
start codons at 30, 99, 352, 472
confident = true

TIG 2[bases=577]
0-79 ==> 0-79 on |154|IGHV3-66|5'UTR| [len=79] (mis=0)
79-429 ==> 0-350 on |155|IGHV3-66|L-REGION+V-REGION| [len=350] (mis=10)
458-506 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
506-577 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 80 reads
cdr3 = CARDKFISGYSGLSPFDYW at 418, score = 9 + 7
umis assigned: [13, 64, 110, 132, 165, 197, 373, 398, 444]
of which 9 are surviving nonsolos
reads assigned: 1200
start codons at 79, 235, 379
confident = true
now this is a cell
paired!

GCTGTGTATTACTGTGCGAGAGATAAGTTCATTTCGGGATATAGTGGCCTTTCCCCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAGTATTATAGTACTCCCCGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1209 = CGGCTAGCAGATGGCA-1

using 191 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[9, 181]
surviving nonsolo ucounts = 1[181]
ids = [0]

====================================================================================

UMI info for barcode CGGCTAGCAGATGGCA-1 contig 1 = AGCTTCAGCT...
umi ACCAGCGGTC = 180 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1211 = CGGCTAGCAGCTCCGA-1

using 275 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[273]
surviving nonsolo ucounts = 1[273]
ids = [2]

====================================================================================

UMI info for barcode CGGCTAGCAGCTCCGA-1 contig 1 = GGAGGAACTG...
umi TTTTGTCCAC = 240 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=467]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
416-467 ==> 0-51 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQRSNWPLTF at 355, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 34, 242, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1225 = CGGCTAGGTAAGAGGA-1

using 227 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 219]
surviving nonsolo ucounts = 1[219]
ids = [3]

====================================================================================

UMI info for barcode CGGCTAGGTAAGAGGA-1 contig 1 = GGGGTCTCAG...
umi AGCCATATTC = 207 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=568]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-353 ==> 0-315 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=12)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
426-568 ==> 0-142 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CTSYAGGSNVVF at 362, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 38, 246, 345, 372, 387
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1232 = CGGCTAGGTAGCACGA-1

using 58 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 9[2, 3, 5^2, 6^2, 8^2, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1239 = CGGCTAGGTATAGGGC-1

using 352 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[346]
surviving nonsolo ucounts = 1[346]
ids = [5]

====================================================================================

UMI info for barcode CGGCTAGGTATAGGGC-1 contig 1 = GGAGTCAGTC...
umi TGCTGGCCTC = 349 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQSYSTPVTF at 353, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 345
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1240 = CGGCTAGGTATATGGA-1

using 290 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[284]
surviving nonsolo ucounts = 1[284]
ids = [6]

====================================================================================

UMI info for barcode CGGCTAGGTATATGGA-1 contig 1 = TGGGGAGGAG...
umi TTTTTGGTCT = 258 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=511]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
420-511 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQSYTTLLTF at 359, score = 9 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 32, 38, 94, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1241 = CGGCTAGGTATTAGCC-1

using 428 reads

====================================================================================

graph has 176 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[422]
surviving nonsolo ucounts = 1[422]
ids = [5]

====================================================================================

UMI info for barcode CGGCTAGGTATTAGCC-1 contig 1 = TGGGCAGTCA...
umi GTACTAGCTG = 417 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
29-382 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=10)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQQSYTTLLTF at 356, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 413
start codons at 29, 35, 91, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1255 = CGGCTAGGTCTAAACC-1

using 12507 reads

====================================================================================

graph has 4846 edges initially, 74 edges after simplification

total ucounts = 672
nonsolo ucounts = 277[2^117, 3^49, 4^31, 5^13, 6^7, 7^7, 8^5, 9^4, 10^2, 11, 13, 18, 55, 77, 80, 116, 169, 177, 188, 194, 206, 214, 224, 239, 260, 271, 272, 273, 310, 317, 318, 322, 323, 324, 327, 335, 338, 341, 345, 350, 351, 357, 368, 373, 374, 391, 396^2, 401, 421, 520]
surviving nonsolo ucounts = 37[80, 116, 169, 177, 188, 194, 206, 214, 224, 239, 260, 271, 272, 273, 310, 317, 318, 322, 323, 324, 327, 335, 338, 341, 345, 350, 351, 357, 368, 373, 374, 391, 396^2, 401, 421, 520]
ids = [456, 413, 637, 262, 213, 232, 408, 38, 309, 52, ...]

====================================================================================

UMI info for barcode CGGCTAGGTCTAAACC-1 contig 1 = GGGGAGGAGT...
umi AACGAAAGCG = 335 reads: +388 validated
umi AATCGGAATG = 216 reads: +388 validated
umi AATTCTTTTG = 237 reads: +388 validated
umi CGATTAGGCC = 190 reads: +388 validated
umi CGGTGAGACA = 193 reads: +388 validated
umi CGTCATTCTG = 323 reads: +388 validated
umi CTCGCTTTTG = 323 reads: +388 validated
umi CTCGTTTCAG = 329 reads: +388 validated
umi CTTCTGTTTA = 176 reads: +388 validated
umi CTTGTGTTCC = 348 reads: +388 validated
umi CTTTTAGTGG = 340 reads: +388 validated
umi GAATGAATCG = 394 reads: +388 validated
umi GATGGGTTAG = 271 reads: +388 validated
umi GGCGTTAGCG = 321 reads: +388 validated
umi GGTGGTGATT = 367 reads: +388 validated
umi GGTTTTAGTC = 265 reads: +388 validated
umi GTCGGTGTTG = 202 reads: +388 validated
umi TGGCCTTCTG = 363 reads: +388 validated
umi TGGCGGGTAT = 523 reads: -216X +1 -8X +1 -4X +1 -2XX +155 invalidated
umi TGGGGCCCTT = 321 reads: +388 validated
umi TGTTGCGGCT = 345 reads: +388 validated
umi TTGTCTTAGC = 374 reads: +388 validated
umi TTTAGTCAAC = 386 reads: +388 validated

UMI info for barcode CGGCTAGGTCTAAACC-1 contig 2 = AGCTCTGGGA...
umi GTGGCTTGAC = 111 reads: +430 validated
umi TACTTTTCGT = 81 reads: +430 validated
umi TTTAGCATTG = 165 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=555]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=18)
381-419 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=5)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 23 umis using 1129 reads
cdr3 = CQQYDVLPPTF at 358, score = 9 + 8
umis assigned: [9, 38, 52, 213, 232, 234, 245, 247, 262, 267] and 13 others
of which 23 are surviving nonsolos
reads assigned: 7019
start codons at 31, 37, 93, 245, 341, 368, 371, 461
confident = true

TIG 2[bases=592]
0-77 ==> 0-77 on |147|IGHV3-64|5'UTR| [len=77] (mis=0)
77-431 ==> 0-354 on |148|IGHV3-64|L-REGION+V-REGION| [len=354] (mis=20)
459-507 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
507-592 ==> 0-85 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 3 umis using 50 reads
cdr3 = CAKSYSEYDYSLWTFDYW at 422, score = 9 + 7
umis assigned: [413, 456, 637]
of which 3 are surviving nonsolos
reads assigned: 351
start codons at 77, 231, 236, 276, 297, 315, 383
confident = true

REJECT CONTIGS

TIG 1[bases=554]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=1)
17-80 ==> 5677-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=31)
380-418 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [170, 193, 260, 309, 400, 401, 442, 502, 541, 584] and 1 others
of which 11 are surviving nonsolos
reads assigned: 3643
start codons at 29, 35, 91, 104, 186, 236, 247, 460
confident = false
did not find CDR3
now this is a cell
paired!

ACGGCCGTGTATTACTGTGCAAAGAGTTATAGTGAGTACGATTACTCCCTCTGGACTTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATGTTGCAACATATTACTGTCAACAGTATGATGTTCTCCCTCCGACTTTCGGCCCTGGGACCAAAGTAGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1258 = CGGCTAGGTCTCATCC-1

using 1204 reads

====================================================================================

graph has 1718 edges initially, 12 edges after simplification

total ucounts = 623
nonsolo ucounts = 242[2^103, 3^65, 4^26, 5^19, 6^11, 7^9, 8, 9^4, 11^2, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1259 = CGGCTAGGTCTCCATC-1

using 260 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 255]
surviving nonsolo ucounts = 1[255]
ids = [2]

====================================================================================

UMI info for barcode CGGCTAGGTCTCCATC-1 contig 1 = AGCTTCAGCT...
umi ATACTCGCGA = 257 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=563]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-563 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1262 = CGGCTAGGTGAGCGAT-1

using 311 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[309]
surviving nonsolo ucounts = 1[309]
ids = [0]

====================================================================================

UMI info for barcode CGGCTAGGTGAGCGAT-1 contig 1 = GCTGGGGTCT...
umi AAGCAGACGC = 297 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=23)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
429-553 ==> 0-124 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CSSYAGNNNLLF at 365, score = 6 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 41, 177, 198, 249, 345, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1264 = CGGCTAGGTGCTGTAT-1

using 583 reads

====================================================================================

graph has 260 edges initially, 24 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[219, 360]
surviving nonsolo ucounts = 2[219, 360]
ids = [3, 2]

====================================================================================

UMI info for barcode CGGCTAGGTGCTGTAT-1 contig 1 = GAGTCAGACT...
umi CGTGAGATCC = 190 reads: +41 -1XX +10 -1XX +8 -1XX +3 -1XX +9 -1XX +13 -3XX +1 -1XX +25 -1XX +20 -1XX +8 -1XX +5 -2XX +1 -4XX +3 -3XX +5 -20 +7 -1XX +8 -1XX +4 -1XX +3 -3XX +2 -1XX +4 -1XX +25 -1XX +10 -1XX +9 -1XX +4 -1XX +8 -26 +8 -1XX +1 -1XX +3 -1XX +6 -2XX +1 -1XX +5 -2XX +3 -1XX +33 -1XX +3 invalidated
umi TAGGTCTGCC = 218 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=9)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYNSYPLTF at 352, score = 8 + 9
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 389
start codons at 25, 31, 87, 100, 236, 239, 332, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1266 = CGGCTAGGTGTAATGA-1

using 204 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[204]
surviving nonsolo ucounts = 1[204]
ids = [0]

====================================================================================

UMI info for barcode CGGCTAGGTGTAATGA-1 contig 1 = AACCACACCC...
umi AAGAAATCTT = 193 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=530]
0-47 ==> 12-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
47-400 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
449-483 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
483-530 ==> 0-47 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 389, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 47, 245, 250, 267, 311, 344
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1267 = CGGCTAGGTGTCCTCT-1

using 557 reads

====================================================================================

graph has 240 edges initially, 12 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2, 3, 4, 6, 266, 273]
surviving nonsolo ucounts = 2[266, 273]
ids = [2, 3]

====================================================================================

UMI info for barcode CGGCTAGGTGTCCTCT-1 contig 1 = GCTGTGCTGT...
umi ATGGGGGTCC = 273 reads: +373 validated

GOOD CONTIGS

TIG 1[bases=627]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=7)
378-416 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
416-627 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQSPDSQGVF at 358, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 43, 104, 173, 191
confident = false

REJECT CONTIGS

TIG 1[bases=634]
0-47 ==> 9-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
47-326 ==> 0-279 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=18)
326-384 ==> 293-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1) [SHIFT!]
385-423 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
423-634 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 47, 201, 337, 362, 367
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1278 = CGGCTAGGTTGCTCCT-1

using 618 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[618]
surviving nonsolo ucounts = 1[618]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=400]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
10-65 ==> 5937-5992 on segment before IGLV2-5 exon 1 [len=6137] (mis=2)
19-85 ==> 5809-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=3)
38-189 ==> 0-151 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=7)
189-400 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 610
start codons at 38, 177
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1287 = CGGCTAGTCATCGCTC-1

using 2593 reads

====================================================================================

graph has 1272 edges initially, 32 edges after simplification

total ucounts = 165
nonsolo ucounts = 52[2^15, 3^10, 4^5, 5^4, 6^2, 7, 8, 9, 12^2, 14, 35, 65, 78, 90, 143, 174, 196, 228, 230, 1067]
surviving nonsolo ucounts = 11[12, 14, 65, 78, 90, 143, 174, 196, 228, 230, 1067]
ids = [104, 54, 154, 63, 0, 62, 139, 126, 40, 3, ...]

====================================================================================

UMI info for barcode CGGCTAGTCATCGCTC-1 contig 1 = GGAGCCCCAG...
umi AAAAGGACAA = 86 reads: +377 -74 non-validated
umi AAAGCTCGTC = 198 reads: +451 validated
umi ATTGGTGTTG = 14 reads: +220 -33 +5 -1 +5 -2 +3 -1 +4 -2 +6 -2 +2 -1 +1 -2 +23 -1 +36 -101 non-validated
umi CAGGCTCACT = 136 reads: +423 -28 non-validated
umi CATCAGTCGT = 74 reads: +436 -15 non-validated
umi GCTTATGTCG = 12 reads: -18 +8 -1 +9 -1 +6 -1 +191 -2 +2 -2 +2 -1 +1 -1 +2 -4 +3 -1 +3 -4 +12 -1 +2 -1 +4 -3 +7 -158 non-validated
umi TACGCATGGG = 185 reads: +451 validated
umi TGGTCATCAT = 60 reads: +347 -1X +4 -3X +2 -1X +1 -6X +1 -35X +50 invalidated

UMI info for barcode CGGCTAGTCATCGCTC-1 contig 2 = GGGCAGGAGT...
umi AGGCAACAAC = 224 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=530]
0-68 ==> 168-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=0)
68-421 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=1)
427-458 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=3)
456-519 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
junction support: 2 umis using 25 reads
cdr3 = CARVGGYYDFWSGYYRYYYYYGMDVW at 410, score = 9 + 7
umis assigned: [0, 3, 54, 62, 63, 104, 126, 154]
of which 8 are surviving nonsolos
reads assigned: 749
start codons at 68, 224, 285, 371, 476
confident = true

TIG 2[bases=555]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=1)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CQQYDNLLWTF at 358, score = 9 + 8
umis assigned: [40]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 31, 37, 93, 106, 245, 368, 461
confident = true
now this is a cell
paired!

GTGGGGGGGTATTACGATTTTTGGAGTGGTTATTATCGATACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCTGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1288 = CGGCTAGTCATCGGAT-1

using 33 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^3, 22]
surviving nonsolo ucounts = 1[22]
ids = [8]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1301 = CGGCTAGTCGTACGGC-1

using 27 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[26]
surviving nonsolo ucounts = 1[26]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=366]
0-312 ==> 28-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=28)
328-366 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
cdr3 = CCSEAGGGVPGLLF at 296, score = 7 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 23
start codons at 126
confident = false
not full
VJ delta = 6
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1305 = CGGCTAGTCGTTACGA-1

using 220 reads

====================================================================================

graph has 98 edges initially, 4 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[14, 205]
surviving nonsolo ucounts = 2[14, 205]
ids = [1, 2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1306 = CGGCTAGTCTAAGCCA-1

using 368 reads

====================================================================================

graph has 176 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[155, 209]
surviving nonsolo ucounts = 2[155, 209]
ids = [3, 5]

====================================================================================

UMI info for barcode CGGCTAGTCTAAGCCA-1 contig 1 = AGCTGGGAGG...
umi GAACCCCCAC = 151 reads: +403 validated

UMI info for barcode CGGCTAGTCTAAGCCA-1 contig 2 = TGGGGAGGAA...
umi GGTCCGCAAC = 195 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=573]
0-30 ==> 16-46 on |389|IGLV8-61|5'UTR| [len=46] (mis=1)
30-398 ==> 0-368 on |390|IGLV8-61|L-REGION+V-REGION| [len=368] (mis=7)
395-433 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
433-573 ==> 0-140 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CVLYLGSFSWVF at 369, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 149
start codons at 30, 45, 54, 57, 82, 349, 352
confident = false

TIG 2[bases=470]
0-37 ==> 10-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
37-382 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-470 ==> 0-51 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQRSNWPLTF at 358, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 37, 245, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1308 = CGGCTAGTCTAGAGTC-1

using 38 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[38]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1317 = CGGCTAGTCTTCAACT-1

using 1767 reads

====================================================================================

graph has 2474 edges initially, 26 edges after simplification

total ucounts = 830
nonsolo ucounts = 318[2^143, 3^75, 4^33, 5^25, 6^19, 7^9, 8^3, 9^3, 10, 11, 12^3, 14, 16, 172]
surviving nonsolo ucounts = 1[172]
ids = [660]

====================================================================================

UMI info for barcode CGGCTAGTCTTCAACT-1 contig 1 = GACTCCTGTG...
umi TCAGATGGTG = 148 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=486]
17-367 ==> 0-350 on |94|IGHV2-26|L-REGION+V-REGION| [len=357] (mis=24)
384-435 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
435-486 ==> 0-51 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CASAAAPGDWFDPW at 362, score = 7 + 7
umis assigned: [660]
of which 1 are surviving nonsolos
reads assigned: 147
start codons at 17, 173, 240, 332
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1324 = CGGGTCAAGAGGGATA-1

using 655 reads

====================================================================================

graph has 248 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 148, 501]
surviving nonsolo ucounts = 2[148, 501]
ids = [3, 2]

====================================================================================

UMI info for barcode CGGGTCAAGAGGGATA-1 contig 1 = AGCTTCAGCT...
umi GATTGAATTT = 138 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=599]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-599 ==> 0-164 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 137
start codons at 47, 201, 351, 376, 381
confident = false

REJECT CONTIGS

TIG 1[bases=461]
0-61 ==> 0-61 on |80|IGHV1-58|5'UTR| [len=61] (mis=2)
61-90 ==> 0-29 on |81|IGHV1-58|L-REGION+V-REGION| [len=353] (mis=0)
90-188 ==> 45-143 on |81|IGHV1-58|L-REGION+V-REGION| [len=353] (mis=10) [SHIFT!]
188-223 ==> 165-200 on |81|IGHV1-58|L-REGION+V-REGION| [len=353] (mis=5) [SHIFT!]
309-337 ==> 313-341 on |81|IGHV1-58|L-REGION+V-REGION| [len=353] (mis=2) [SHIFT!]
344-390 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
390-461 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 492
start codons at 61, 105, 308, 337
confident = false
frameshifted full length stopped transcript of length 461
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1336 = CGGGTCAAGGACGAAA-1

using 26 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 4^2, 11]
surviving nonsolo ucounts = 1[11]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1348 = CGGGTCAAGTGAAGAG-1

using 14072 reads

====================================================================================

graph has 4941 edges initially, 36 edges after simplification

total ucounts = 431
nonsolo ucounts = 202[2^61, 3^27, 4^25, 5^12, 6^6, 7^3, 8^3, 9^2, 10^2, 11^3, 16, 32, 73, 93, 125, 147, 148, 149, 150, 151, 157, 162, 163, 165, 167, 177, 179, 181^2, 192, 197, 201, 202, 207, 208, 212, 214, 219, 226, 233, 234, 237, 241, 242, 249, 250, 259, 261, 264, 265, 270, 271, 273^2, 275, 278, 282, 288, 293, 300, 301, 308, 320, 336, 374, 433, 464, 560]
surviving nonsolo ucounts = 55[93, 125, 147, 148, 149, 150, 151, 157, 162, 163, 165, 167, 177, 179, 181^2, 192, 197, 201, 202, 207, 208, 212, 214, 219, 226, 233, 234, 237, 241, 242, 249, 250, 259, 261, 264, 265, 270, 271, 273^2, 275, 278, 282, 288, 293, 300, 301, 308, 320, 336, 374, 433, 464, 560]
ids = [236, 84, 250, 148, 335, 114, 220, 59, 429, 390, ...]

====================================================================================

UMI info for barcode CGGGTCAAGTGAAGAG-1 contig 1 = ATACTTTCTG...
umi CAGACGTCTA = 103 reads: +433 validated
umi CATCACGACC = 182 reads: +433 validated
umi CCCACCGCCT = 149 reads: +387 -1 +3 -1 +41 non-validated
umi CCCTTTTTTG = 183 reads: +428 -5 non-validated
umi GGTCAATGGA = 146 reads: +433 validated
umi GTAAATCAGT = 177 reads: +433 validated
umi TGTTCGTAAA = 164 reads: +433 validated
umi TTCATCGGTG = 238 reads: +423 -10 non-validated

UMI info for barcode CGGGTCAAGTGAAGAG-1 contig 2 = AGGAGTCAGA...
umi ACCCACCCTT = 237 reads: +388 validated
umi ACTTACTTAC = 260 reads: +388 validated
umi AGGATCAACT = 277 reads: +388 validated
umi AGGCATAGTC = 319 reads: +388 validated
umi AGTCTTTGCA = 435 reads: +388 validated
umi ATATGCACCC = 281 reads: +388 validated
umi ATCTCCTACA = 158 reads: +388 validated
umi CAAATTCGCC = 281 reads: +253 -1XX +134 invalidated
umi CACAGTATCA = 224 reads: +388 validated
umi CATACCACAG = 239 reads: +388 validated
umi CCACCCCTAC = 214 reads: +388 validated
umi CCATTGAATG = 198 reads: +388 validated
umi CGATACCTCT = 149 reads: +388 validated
umi CGCGGCATTA = 242 reads: +388 validated
umi CTAAACGACC = 266 reads: +388 validated
umi CTAATAAGGG = 219 reads: +388 validated
umi CTTAGATACT = 261 reads: +388 validated
umi CTTATTTTTG = 286 reads: +197 -1XX +190 invalidated
umi GAAAGCTTGA = 304 reads: +388 validated
umi GACTTATGTG = 275 reads: +388 validated
umi GAGTGCCGGT = 158 reads: +143 -1XX +244 invalidated
umi GCCTTAAGAC = 251 reads: +388 validated
umi GCGATTAGTT = 92 reads: +388 validated
umi GGATCACTCA = 178 reads: +388 validated
umi GTAATTATTT = 301 reads: +388 validated
umi GTACATCATG = 206 reads: +388 validated
umi GTCGTTTCAG = 208 reads: +388 validated
umi TAACCGTTCG = 475 reads: +388 validated
umi TAACCTTATG = 183 reads: +388 validated
umi TACGTTCCGA = 170 reads: +388 validated
umi TAGTGTCAGT = 561 reads: +388 validated
umi TATGGCCATT = 191 reads: +388 validated
umi TATTGGCGAT = 249 reads: +388 validated
umi TCACGACAGG = 283 reads: +388 validated
umi TCCGTTGCGA = 202 reads: +388 validated
umi TCGCTATATG = 148 reads: +388 validated
umi TCGTCATGCT = 201 reads: +388 validated
umi TCTGTCGTCC = 231 reads: +388 validated
umi TCTTATATAC = 283 reads: +388 validated
umi TGCCGGCAGC = 267 reads: +388 validated
umi TGCGGCCACT = 288 reads: +388 validated
umi TGGTCCGGCA = 163 reads: +388 validated
umi TGTTGGATAA = 372 reads: +388 validated
umi TTATATGACA = 270 reads: +388 validated
umi TTGATACCCT = 306 reads: +388 validated
umi TTTTTCTTGA = 159 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=541]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
37-387 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=1)
407-470 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=5)
470-541 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 55 reads
cdr3 = CARVTRIVGAVTDYYYGMDVW at 376, score = 9 + 7
umis assigned: [84, 88, 114, 128, 250, 253, 390, 404]
of which 8 are surviving nonsolos
reads assigned: 1325
start codons at 37, 81, 427
confident = true

TIG 2[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=7)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 46 umis using 1745 reads
cdr3 = CQQYNSYSITF at 354, score = 8 + 8
umis assigned: [16, 33, 42, 43, 50, 54, 59, 71, 78, 85] and 36 others
of which 46 are surviving nonsolos
reads assigned: 11301
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = true
now this is a cell
paired!

TATTACTGTGCGAGAGTCACACGCATAGTGGGAGCCGTTACTGACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTACTCGATCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1356 = CGGGTCACAAAGGTGC-1

using 82 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[82]
surviving nonsolo ucounts = 1[82]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=428]
0-356 ==> 4-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
362-399 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
399-428 ==> 0-29 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQALQSPRGLTF at 332, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 72
start codons at 29, 65, 153, 315, 335
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1358 = CGGGTCACAACACCTA-1

using 605 reads

====================================================================================

graph has 820 edges initially, 14 edges after simplification

total ucounts = 356
nonsolo ucounts = 121[2^62, 3^33, 4^7, 5^6, 6^8, 7^4, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1362 = CGGGTCACAAGTTGTC-1

using 14890 reads

====================================================================================

graph has 5966 edges initially, 94 edges after simplification

total ucounts = 644
nonsolo ucounts = 311[2^118, 3^44, 4^25, 5^26, 6^10, 7^6, 9^2, 10, 13^3, 15, 16, 17^3, 19, 20, 30, 51, 54, 55, 57, 62, 63, 73, 74, 75, 87, 90, 100, 101, 104, 106, 108, 111, 112, 116, 128, 129, 130, 131, 132, 139, 157, 158, 161, 167^3, 175, 181, 183^2, 188, 194^2, 200, 202, 204^2, 207, 209, 215, 216, 222, 224, 225, 232, 243, 244, 247, 250, 251, 268, 275, 278, 307^2, 314, 324, 342, 349, 381, 569, 708, 759]
surviving nonsolo ucounts = 69[15, 51, 54, 55, 57, 62, 63, 73, 74, 75, 87, 90, 100, 101, 104, 106, 108, 111, 112, 116, 128, 129, 130, 131, 132, 139, 157, 158, 161, 167^3, 175, 181, 183^2, 188, 194^2, 200, 202, 204^2, 207, 209, 215, 216, 222, 224, 225, 232, 243, 244, 247, 250, 251, 268, 275, 278, 307^2, 314, 324, 342, 349, 381, 569, 708, 759]
ids = [514, 396, 266, 460, 423, 628, 546, 115, 387, 599, ...]

====================================================================================

UMI info for barcode CGGGTCACAAGTTGTC-1 contig 1 = TCTGAGGATA...
umi AACCGCGATA = 119 reads: +388 validated
umi AATTGCTGGT = 246 reads: +388 validated
umi ACAATTGCAA = 181 reads: +388 validated
umi AGACTAGTGC = 105 reads: +388 validated
umi AGGAAAAGGG = 215 reads: +388 validated
umi ATCTTGTGTC = 163 reads: +388 validated
umi ATTAACCTTT = 205 reads: +388 validated
umi ATTTCAATTG = 300 reads: -10X +4 -18XX +1 -1XX +3 -6XX +345 invalidated
umi CCTCCTTGCA = 172 reads: +101 -1XX +286 invalidated
umi CCTCTCGTAG = 219 reads: +388 validated
umi GGGACCAGGG = 223 reads: +388 validated
umi GGTAATGGGT = 270 reads: +388 validated
umi GGTATATGGT = 73 reads: +381 -6X +1 invalidated
umi GTACCAATAG = 209 reads: +388 validated
umi GTCCATTTAA = 206 reads: +388 validated
umi TACCTTTAGG = 91 reads: +388 validated
umi TATATCGGTC = 132 reads: +388 validated
umi TCGCGCCGCG = 160 reads: +388 validated
umi TGAATCACTG = 221 reads: +37 -6XX +345 invalidated
umi TGCACTTTCA = 725 reads: -352X +5 -1XX +28 -1XX +1 invalidated
umi TGGAGCTGGC = 39 reads: +25 -1 +4 -2X +1 -1XX +3 -6XX +147 -1 +114 -83 invalidated
umi TTCTCTATGC = 74 reads: +388 validated
umi TTGCCATTCA = 165 reads: +388 validated
umi TTTCGACCGT = 575 reads: -325X +63 invalidated
umi TTTTTTAGAG = 780 reads: -348X +1 -3XX +5 -1XX +28 -1XX +1 invalidated

UMI info for barcode CGGGTCACAAGTTGTC-1 contig 2 = GGAGTCTCCC...
umi AGCCATGCCT = 196 reads: +430 validated
umi AGCCTTAACG = 200 reads: +430 validated
umi ATCCCTCGGA = 128 reads: +430 validated
umi CGCGTCTGGT = 188 reads: +430 validated
umi CGTTTACTAG = 52 reads: +391 -39 non-validated
umi CTCGTACTGT = 133 reads: +430 validated
umi CTGTTTCCCA = 405 reads: +119 -5XX +1 -4XX +2 -2XX +1 -3XX +1 -5XX +1 -108X +1 -6XX +1 -1XX +1 -2XX +166 invalidated
umi CTTCACCTCG = 103 reads: +430 validated
umi CTTTGCGTCT = 227 reads: +430 validated
umi GATATCCTTT = 304 reads: -410X +1 -3X +1 -10X +2 -2X +1 invalidated
umi GCAGTAGGTT = 87 reads: +354 -1 +20 -3 +43 -1XX +2 -1XX +1 -3XX +1 invalidated
umi GCTCCTTCAT = 220 reads: +430 validated
umi GGAGGGCTTT = 200 reads: +430 validated
umi GTAATTCTGT = 141 reads: +430 validated
umi GTGCGCTCCG = 54 reads: +429 -1 non-validated
umi TACTAGTCGA = 58 reads: +430 validated
umi TCCCCTGGGA = 222 reads: +430 validated
umi TCGGTTTGGT = 130 reads: +430 validated
umi TGACTTCAGC = 193 reads: +430 validated
umi TGGTTCAGTA = 110 reads: +430 validated
umi TGTTACGGTA = 252 reads: +430 validated
umi TTCATCCCCT = 182 reads: +430 validated
umi TTTAAACGGG = 171 reads: +430 validated
umi TTTGATACTA = 63 reads: +403 -1 +4 -1 +10 -11 non-validated
umi TTTGTTGCCT = 109 reads: +397 -33 non-validated

GOOD CONTIGS

TIG 1[bases=685]
0-86 ==> 0-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
86-439 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=16)
436-474 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
474-685 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 21 umis using 612 reads
cdr3 = CQSYHSGGWVL at 413, score = 6 + 7
umis assigned: [21, 42, 52, 94, 109, 168, 181, 200, 244, 245] and 15 others
of which 25 are surviving nonsolos
reads assigned: 5745
start codons at 86, 240
confident = true

TIG 2[bases=649]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=22)
441-489 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
489-649 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 19 umis using 358 reads
cdr3 = CARGSRGGYGGAPNFFDSW at 401, score = 9 + 7
umis assigned: [100, 104, 157, 257, 266, 282, 294, 296, 307, 333] and 15 others
of which 25 are surviving nonsolos
reads assigned: 4033
start codons at 59, 233, 257, 543
confident = true

REJECT CONTIGS

TIG 1[bases=539]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
0-42 ==> 6347-6389 on rc of segment before IGHV4-4 exon 2 [len=6389] (mis=0)
35-60 ==> 10115-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
42-395 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=32)
432-480 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
480-539 ==> 0-59 on |40|IGHG1|C-REGION| [len=884] (mis=0)
cdr3 = CARDRWGGIYDGSAFVTPLTS at 384, score = 8 + 4
umis assigned: [86, 87, 514]
of which 3 are surviving nonsolos
reads assigned: 259
start codons at 42, 240, 245, 262, 275, 339, 412, 415
confident = false
frameshifted full length stopped transcript of length 539
VJ delta = 6
not full
not full

TIG 2[bases=716]
0-187 ==> 5813-6000 on rc of segment after IGKV1-8 exon 1 [len=6000] (mis=16)
164-228 ==> 5672-5736 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=4)
187-395 ==> 0-208 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=26)
401-538 ==> 208-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=10)
542-580 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=4)
580-716 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [36, 67, 103, 115, 126, 189, 199, 234, 272, 276] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2831
start codons at 40, 92, 187, 243, 256, 392, 543, 622
confident = false
see insertion of TCTATA at pos 208 on |237|IGKV1-8|L-REGION+V-REGION|
did not find CDR3
now this is a cell
paired!

GCCACTTATTACTGTGCGAGGGGGTCCAGGGGTGGCTACGGTGGGGCTCCTAACTTCTTTGACTCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCTCTGGGCTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATCATAGCGGCGGTTGGGTGCTCGGCGGAGGGACCAAGCTGACCGTCCTGG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1365 = CGGGTCACAATGTAAG-1

using 367 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[366]
surviving nonsolo ucounts = 1[366]
ids = [1]

====================================================================================

UMI info for barcode CGGGTCACAATGTAAG-1 contig 1 = GATCAGGACT...
umi TATGACCCAC = 370 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 361
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1368 = CGGGTCACACAGAGGT-1

using 270 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[269]
surviving nonsolo ucounts = 1[269]
ids = [1]

====================================================================================

UMI info for barcode CGGGTCACACAGAGGT-1 contig 1 = AGCTCAGGAA...
umi GACCGTGGGT = 265 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=635]
0-33 ==> 53-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
33-386 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=17)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQSYDSSPSVVF at 360, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 33, 96, 187, 238, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1371 = CGGGTCACACCCTATC-1

using 3304 reads

====================================================================================

graph has 2132 edges initially, 34 edges after simplification

total ucounts = 526
nonsolo ucounts = 198[2^84, 3^42, 4^22, 5^18, 6^12, 7^4, 8^2, 9, 11, 13, 115, 136, 150, 218, 220, 226, 230, 233, 261, 274, 292]
surviving nonsolo ucounts = 11[115, 136, 150, 218, 220, 226, 230, 233, 261, 274, 292]
ids = [333, 258, 46, 346, 28, 488, 8, 21, 281, 6, ...]

====================================================================================

UMI info for barcode CGGGTCACACCCTATC-1 contig 1 = GGAGAGGAGC...
umi AAACTCCGGC = 234 reads: +442 validated
umi AAGTTCTCTC = 227 reads: +442 validated
umi ACCACCCCTT = 152 reads: +442 validated
umi GACATGGCTC = 265 reads: +442 validated

UMI info for barcode CGGGTCACACCCTATC-1 contig 2 = TATGGTGGCT...
umi AAACGACTAT = 276 reads: +388 validated
umi AATCAATGAC = 218 reads: +388 validated
umi GGGCTTGATC = 296 reads: +388 validated
umi GTAGTCTCGG = 224 reads: +388 validated
umi TTAGTGACTA = 227 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=616]
0-72 ==> 8-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=1)
72-423 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=24)
464-514 ==> 13-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
514-616 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 4 umis using 67 reads
cdr3 = CAKDRRFHGGWRLAFESYAMDVW at 414, score = 9 + 7
umis assigned: [8, 21, 46, 281]
of which 4 are surviving nonsolos
reads assigned: 862
start codons at 72, 286, 289, 307, 443, 471, 532, 593
confident = true

TIG 2[bases=647]
48-347 ==> 0-299 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=5)
398-436 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
436-647 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 5 umis using 169 reads
cdr3 = CSAYTITSTLVF at 372, score = 8 + 8
umis assigned: [6, 28, 328, 346, 488]
of which 5 are surviving nonsolos
reads assigned: 1207
start codons at 1, 48, 249, 256
confident = true

REJECT CONTIGS

TIG 1[bases=639]
0-58 ==> 87-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
0-58 ==> 3458-3516 on rc of segment before IGHV3-60 exon 2 [len=3516] (mis=0)
0-58 ==> 3527-3585 on rc of segment before IGHV3-62 exon 2 [len=3585] (mis=0)
58-244 ==> 0-186 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=15)
408-457 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
457-639 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
cdr3 = CLVKDYFPEPVTVSWNSGALTS at 534, score = 5 + 5
umis assigned: [258, 333]
of which 2 are surviving nonsolos
reads assigned: 249
start codons at 14, 58, 102, 256, 304, 388, 392
confident = false
>vscore_40.1371_82.3%
ATGAAACATCTGTGGTTCTTCCTTCTCCTGGTGGCGGCTCCCAGATGGGTCCTGTCCCAGGTCCAGCTGCAGCGGTCGGGCCCAGGACTGGTGAAGCCGCCGGAGACCCTGTCCCTCATCTGCAGTGTCTCTGGTGCCTCCTTCAGTAAAAACTACTGGAGGTGGGTCCGGCAGCCCCCAGGGAAGACACTGGAGTGGATGGCGACTCTCAACAACAGCGGGAGCACCAGGATCTACCCCTCCCGCATGAGTCGAGTCAGCATTCTTGAAGACACGTCCAAGAATCAGGTCTCCGTGAGGCTGCCTACTCTGGCCGCTGCGGATACGGCCATGTATGTCGATTTGTCGAT
frameshifted full length stopped transcript of length 639
VJ delta = 60
delta too large
not full
not full
now this is a cell
paired!

TGTGCGAAAGACAGAAGATTTCACGGCGGATGGAGGCTGGCATTCGAGAGCTACGCTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAACCTGAGGACGAGGCTCACTATTACTGCAGTGCATATACAATCACCAGCACTTTGGTGTTCGGCGGAGGGACCGAGTTGACCGTCCTAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1383 = CGGGTCACAGGAATCG-1

using 331 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[326]
surviving nonsolo ucounts = 1[326]
ids = [5]

====================================================================================

UMI info for barcode CGGGTCACAGGAATCG-1 contig 1 = GCTCAGTTAG...
umi GTGTCGCTTG = 327 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=546]
0-25 ==> 27-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
25-373 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
371-410 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYGSSPVTF at 349, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 321
start codons at 25, 233, 236, 359, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1396 = CGGGTCACATTATCTC-1

using 352 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 138, 210]
surviving nonsolo ucounts = 2[138, 210]
ids = [4, 3]

====================================================================================

UMI info for barcode CGGGTCACATTATCTC-1 contig 1 = GGTAGAGAAG...
umi TTCTAGCTAA = 201 reads: +385 validated
umi TTCTCGCTGA = 133 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=541]
0-34 ==> 22-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
34-385 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=3)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
419-541 ==> 0-122 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 67 reads
cdr3 = CAAWDDSLSVLF at 355, score = 7 + 8
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 325
start codons at 34, 188, 338, 363, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1397 = CGGGTCACATTCACTT-1

using 144 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[143]
surviving nonsolo ucounts = 1[143]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=529]
0-364 ==> 7-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=9)
381-429 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
429-529 ==> 0-100 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
cdr3 = CARAHGDYYTLLDCW at 353, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 132
start codons at 14, 58, 144, 344
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1398 = CGGGTCACATTCCTCG-1

using 307 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[303]
surviving nonsolo ucounts = 1[303]
ids = [1]

====================================================================================

UMI info for barcode CGGGTCACATTCCTCG-1 contig 1 = GAAACAGAGC...
umi CCGGGGTAAT = 305 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=637]
38-390 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=22)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
426-637 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CSSWDSSLSAWVF at 359, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 301
start codons at 38, 177, 249, 367
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1408 = CGGGTCAGTCAGAAGC-1

using 252 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 3, 244]
surviving nonsolo ucounts = 1[244]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=469]
49-116 ==> 6507-6574 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=3)
80-267 ==> 0-187 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=11)
267-401 ==> 219-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=13) [SHIFT!]
404-454 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
cdr3 = CARENDAFDIW at 390, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 80, 140, 231, 236, 351, 435
confident = false
frameshifted full length stopped transcript of length 469
VJ delta = 42
delta too large
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1413 = CGGGTCAGTCCGAAGA-1

using 239 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 230]
surviving nonsolo ucounts = 1[230]
ids = [1]

====================================================================================

UMI info for barcode CGGGTCAGTCCGAAGA-1 contig 1 = AAAAACCACA...
umi CCTACCTCAA = 200 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=532]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-532 ==> 0-46 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1436 = CGGGTCAGTTCCCTTG-1

using 187 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[187]
surviving nonsolo ucounts = 1[187]
ids = [0]

====================================================================================

UMI info for barcode CGGGTCAGTTCCCTTG-1 contig 1 = ACCCAAAAAC...
umi CTGATCACAT = 174 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=463]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=23)
412-463 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
junction support: 1 umis using 15 reads
cdr3 = CARGSTSWYDYW at 396, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 54, 205, 252, 257, 289, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1437 = CGGGTCAGTTCGCTAA-1

using 886 reads

====================================================================================

graph has 302 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[7, 242, 291, 346]
surviving nonsolo ucounts = 3[242, 291, 346]
ids = [1, 0, 3]

====================================================================================

UMI info for barcode CGGGTCAGTTCGCTAA-1 contig 1 = TGGGGAGGAA...
umi AATTGATAGC = 296 reads: +388 validated
umi CTCACTCCAC = 243 reads: +388 validated
umi TCATCGTTAA = 344 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 3 umis using 135 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [0, 1, 3]
of which 3 are surviving nonsolos
reads assigned: 867
start codons at 32, 38, 107, 243, 462
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1444 = CGGGTCATCAACGGCC-1

using 1000 reads

====================================================================================

graph has 1312 edges initially, 32 edges after simplification

total ucounts = 526
nonsolo ucounts = 204[2^104, 3^48, 4^21, 5^12, 6^7, 7, 8^3, 9, 10, 12^2, 15, 17^3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1448 = CGGGTCATCACGAAGG-1

using 1006 reads

====================================================================================

graph has 394 edges initially, 12 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2, 9, 186, 226, 288, 291]
surviving nonsolo ucounts = 4[186, 226, 288, 291]
ids = [9, 6, 0, 2]

====================================================================================

UMI info for barcode CGGGTCATCACGAAGG-1 contig 1 = ACCCAAAAAC...
umi TTTTATATAG = 186 reads: +436 validated

UMI info for barcode CGGGTCATCACGAAGG-1 contig 2 = GGAGGAACTG...
umi GATGCTCGGG = 239 reads: +382 validated

UMI info for barcode CGGGTCATCACGAAGG-1 contig 3 = GATCAGGACT...
umi AGATCTCGGG = 295 reads: +397 validated

UMI info for barcode CGGGTCATCACGAAGG-1 contig 4 = TGGGAGGAAT...
umi ACCGCTAACT = 297 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=650]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-650 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false

TIG 2[bases=552]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=14)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CHQYDNWPQTF at 355, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 34, 83, 103, 239, 365, 458
confident = false

TIG 3[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-356 ==> 0-326 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=11)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CMNTLPGGFTF at 366, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false

TIG 4[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 287
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1450 = CGGGTCATCACTCCTG-1

using 507 reads

====================================================================================

graph has 222 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[6, 198, 302]
surviving nonsolo ucounts = 2[198, 302]
ids = [0, 1]

====================================================================================

UMI info for barcode CGGGTCATCACTCCTG-1 contig 1 = GAATCAGTCC...
umi AAGAGTATCT = 308 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 25, 31, 100, 236, 455
confident = false

REJECT CONTIGS

TIG 1[bases=524]
4-302 ==> 19-317 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=9)
332-370 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=6)
370-524 ==> 0-154 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CSSYTSTSTVF at 309, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 180
start codons at 142, 193, 196, 502
confident = false
not full
VJ delta = 27
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1458 = CGGGTCATCATCGGAT-1

using 253 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[2, 243]
surviving nonsolo ucounts = 1[243]
ids = [0]

====================================================================================

UMI info for barcode CGGGTCATCATCGGAT-1 contig 1 = TGGGGTCACA...
umi AAGTTTCCGC = 230 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=541]
0-39 ==> 123-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
39-379 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=23)
396-424 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
424-541 ==> 0-117 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 39 reads
cdr3 = CFSYGSSGRTF at 363, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 39, 247, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1461 = CGGGTCATCATGTAGC-1

using 420 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[6, 118, 292]
surviving nonsolo ucounts = 2[118, 292]
ids = [0, 2]

====================================================================================

UMI info for barcode CGGGTCATCATGTAGC-1 contig 1 = GAGTCAGACC...
umi AACAGACCAC = 115 reads: +386 -1 +1 non-validated
umi CACTACTCTC = 291 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 4-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
25-376 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=10)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 50 reads
cdr3 = CLQDYNYPRTF at 352, score = 9 + 8
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 398
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1464 = CGGGTCATCCACGTGG-1

using 524 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[100, 202, 217]
surviving nonsolo ucounts = 3[100, 202, 217]
ids = [3, 2, 5]

====================================================================================

UMI info for barcode CGGGTCATCCACGTGG-1 contig 1 = GCTCTGCTTC...
umi GCACTGTTGT = 205 reads: +394 validated
umi GCACTGTTTT = 101 reads: +394 validated
umi TCTCGAGACG = 221 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=656]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-656 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 83 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2, 3, 5]
of which 3 are surviving nonsolos
reads assigned: 513
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1466 = CGGGTCATCCGCTGTT-1

using 373 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[366]
surviving nonsolo ucounts = 1[366]
ids = [5]

====================================================================================

UMI info for barcode CGGGTCATCCGCTGTT-1 contig 1 = CAGGACACAG...
umi GTGACTGCTT = 365 reads: +298 -1X +89 invalidated

GOOD CONTIGS

TIG 1[bases=535]
11-362 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=13)
362-399 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
399-535 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQADSFPLTF at 338, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 361
start codons at 11, 17, 73, 86, 441
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1471 = CGGGTCATCGACGGAA-1

using 302 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[301]
surviving nonsolo ucounts = 1[301]
ids = [0]

====================================================================================

UMI info for barcode CGGGTCATCGACGGAA-1 contig 1 = TGGGAGGAGT...
umi CATCTGTTGT = 299 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=552]
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQSYSTPSF at 358, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 31, 37, 93, 106, 242, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1473 = CGGGTCATCGCAGGCT-1

using 401 reads

====================================================================================

graph has 170 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 153, 244]
surviving nonsolo ucounts = 1[153]
ids = [4]

====================================================================================

UMI info for barcode CGGGTCATCGCAGGCT-1 contig 1 = ATCATCCAAC...
umi TCCTAGACGG = 145 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=519]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
440-488 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
488-519 ==> 0-31 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 400, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 142
start codons at 58, 214, 256, 322, 355, 445
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1474 = CGGGTCATCGCGTTTC-1

using 267 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[264]
surviving nonsolo ucounts = 1[264]
ids = [0]

====================================================================================

UMI info for barcode CGGGTCATCGCGTTTC-1 contig 1 = GATCAGGACT...
umi ACAAAATGAC = 241 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=495]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=7)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
427-495 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CMQGLQSPRTF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1484 = CGGGTCATCTCGTTTA-1

using 241 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 7, 226]
surviving nonsolo ucounts = 1[226]
ids = [7]

====================================================================================

UMI info for barcode CGGGTCATCTCGTTTA-1 contig 1 = TGGGCCTCAG...
umi TTTGTACGGA = 210 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=556]
0-36 ==> 16-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
36-374 ==> 0-338 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
374-412 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
412-556 ==> 0-144 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQAWDSSTVVF at 351, score = 6 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 36, 41, 97, 184, 330, 334, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1500 = CGGTTAAAGATCTGCT-1

using 382 reads

====================================================================================

graph has 154 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[166, 213]
surviving nonsolo ucounts = 2[166, 213]
ids = [3, 2]

====================================================================================

UMI info for barcode CGGTTAAAGATCTGCT-1 contig 1 = GGCTTTCTGA...
umi TCCTCTTGTT = 166 reads: +439 validated

UMI info for barcode CGGTTAAAGATCTGCT-1 contig 2 = AGCTGTGGGC...
umi GTTAACTCAT = 202 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=525]
15-386 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=17)
408-454 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=13)
454-525 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARGAAHSGTVMIDYW at 375, score = 9 + 6
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 15, 36, 80, 408
confident = false

TIG 2[bases=571]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=12)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
422-571 ==> 0-149 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 27 reads
cdr3 = CNSRDRSGNHVLF at 355, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 40, 159, 188, 239, 338, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1507 = CGGTTAAAGCCTATGT-1

using 262 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[6, 250]
surviving nonsolo ucounts = 1[250]
ids = [3]

====================================================================================

UMI info for barcode CGGTTAAAGCCTATGT-1 contig 1 = GACACAGCAT...
umi CCCTTGGGTT = 254 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=532]
8-361 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
357-396 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
396-532 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQSYSTPRTF at 335, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 8, 14, 70, 83, 219, 438
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1509 = CGGTTAAAGCTAACTC-1

using 298 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 7, 287]
surviving nonsolo ucounts = 1[287]
ids = [3]

====================================================================================

UMI info for barcode CGGTTAAAGCTAACTC-1 contig 1 = GTCTCAGTCA...
umi GTCCCGCCCT = 262 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=484]
0-19 ==> 4-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
19-372 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=29)
370-407 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
407-484 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQGYSIPLTF at 346, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 19, 25, 81, 230, 284, 449
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1515 = CGGTTAAAGGAGTCTG-1

using 291 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 5, 9, 270]
surviving nonsolo ucounts = 1[270]
ids = [5]

====================================================================================

UMI info for barcode CGGTTAAAGGAGTCTG-1 contig 1 = TGGGGACTCC...
umi GACTAACCGT = 237 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=561]
21-379 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=20)
409-457 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
457-561 ==> 0-104 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CAHIVGFYFPNSGYYYFDSW at 366, score = 7 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 21, 65, 244, 247, 336, 511
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1520 = CGGTTAAAGTGAATTG-1

using 34 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 27]
surviving nonsolo ucounts = 1[27]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1523 = CGGTTAAAGTTAGGTA-1

using 246 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[245]
surviving nonsolo ucounts = 1[245]
ids = [1]

====================================================================================

UMI info for barcode CGGTTAAAGTTAGGTA-1 contig 1 = GTCTCCCTCA...
umi CTATCGTATG = 232 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=540]
0-56 ==> 3-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
56-409 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=4)
433-483 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
483-540 ==> 0-57 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARGPVTMIVHWDAFDFW at 398, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 56, 230, 254, 389, 419, 435, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1526 = CGGTTAACAACTGCTA-1

using 15577 reads

====================================================================================

graph has 5756 edges initially, 56 edges after simplification

total ucounts = 588
nonsolo ucounts = 301[2^105, 3^60, 4^37, 5^21, 6^6, 7^6, 8, 9^2, 10^4, 12, 13^3, 16, 19, 45, 57, 91, 104, 106, 123, 136, 138, 168, 178, 199, 206, 212, 213, 239, 244, 249, 251, 257, 262, 263, 264, 265^3, 271, 272, 274^2, 283^2, 284, 291^2, 293, 297, 312, 318, 332, 333, 334, 349, 368, 372, 381, 390, 391, 398, 413, 445, 446, 460, 462]
surviving nonsolo ucounts = 50[45, 104, 106, 123, 136, 138, 168, 178, 199, 206, 212, 213, 239, 244, 249, 251, 257, 262, 263, 264, 265^3, 271, 272, 274^2, 283^2, 284, 291^2, 293, 297, 312, 318, 332, 333, 334, 349, 368, 372, 381, 390, 398, 413, 445, 446, 460, 462]
ids = [69, 23, 176, 414, 119, 345, 300, 157, 192, 497, ...]

====================================================================================

UMI info for barcode CGGTTAACAACTGCTA-1 contig 1 = TGGGGATGCT...
umi AAACTCCTTT = 302 reads: +436 validated
umi AACCCAGTGG = 98 reads: -381 +1 -10X +1 -5X +38 invalidated
umi ACAATCTCTA = 291 reads: -45X +3 -2XX +3 -9XX +2 -1XX +1 -1XX +369 invalidated
umi ACCTCCGGAC = 44 reads: -436 non-validated
umi ATCCCTCCGT = 5 reads: -381X +1 -17X +1 -1 +35 invalidated
umi CAAAGGGGCT = 1 reads: -373X +1 -2X +1 -4X +1 -1X +1 -8X +1 -5X +13 -1 +14 -10 invalidated
umi CACTTATTTG = 106 reads: +436 validated
umi CAGCTCAGGT = 47 reads: -288X +148 invalidated
umi CATTACGTCT = 7 reads: -376 +1 -4X +1 -1X +1 -8X +1 -5XX +38 invalidated
umi CCCGCGGCCA = 250 reads: +436 validated
umi CCCTCGTCAT = 259 reads: -2X +434 invalidated
umi CCTTATCTTT = 275 reads: +436 validated
umi CTCGTGACGG = 399 reads: +436 validated
umi CTCTATAGGA = 262 reads: +436 validated
umi CTTATAGACA = 5 reads: -373X +1 -2X +1 -4XX +1 -1XX +1 -8XX +1 -5XX +38 invalidated
umi GCCAAAAACG = 259 reads: +436 validated
umi GGTCATTCGC = 281 reads: +436 validated
umi GTCCTTCTTT = 242 reads: -45X +3 -2XX +3 -9XX +2 -1XX +1 -1XX +369 invalidated
umi TACTGAAAGG = 371 reads: +436 validated
umi TAGACTCGGT = 2 reads: -410 +26 non-validated
umi TAGAGCCTTC = 336 reads: +436 validated
umi TCAATGCAGA = 238 reads: +436 validated
umi TCTTGTCATG = 317 reads: +436 validated
umi TGACGGGCAA = 207 reads: +436 validated
umi TGATGAGTTA = 375 reads: +436 validated
umi TGGGTTATGG = 216 reads: +436 validated
umi TTTGCCCGAT = 328 reads: +436 validated

UMI info for barcode CGGTTAACAACTGCTA-1 contig 2 = AGGAGTCAGA...
umi AAACTGACAC = 269 reads: +394 validated
umi AAATTGGGTA = 266 reads: +394 validated
umi ACCAGAGCCT = 353 reads: +394 validated
umi ACGCTACTAA = 441 reads: -10X +384 invalidated
umi AGACGCAAAT = 273 reads: +394 validated
umi ATAACATGGA = 248 reads: +394 validated
umi ATACCACTTT = 466 reads: +394 validated
umi ATCGCAGATC = 411 reads: +394 validated
umi ATTGGGTCTA = 283 reads: +394 validated
umi CAGGGTATTG = 265 reads: +394 validated
umi CCTAGGCCAG = 337 reads: +394 validated
umi GATAAGGTGG = 286 reads: +394 validated
umi GCTCTTGTAT = 142 reads: +394 validated
umi GGATCCGTTC = 243 reads: +394 validated
umi TAATATTGCT = 290 reads: +394 validated
umi TAGCTAAGAC = 390 reads: +394 validated
umi TATATGTATC = 297 reads: +394 validated
umi TCGTGTGAAT = 273 reads: +394 validated
umi TGATTTCCAA = 264 reads: +394 validated
umi TGCGTATTCG = 332 reads: +394 validated
umi TTACATTGGG = 217 reads: +394 validated
umi TTTAGACTCA = 268 reads: +394 validated
umi TTTCGTCCGT = 315 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=528]
21-398 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=0)
419-457 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
457-528 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 20 umis using 547 reads
cdr3 = CARQGSGTLPRYW at 387, score = 9 + 7
umis assigned: [7, 23, 53, 69, 119, 157, 176, 177, 192, 212] and 17 others
of which 27 are surviving nonsolos
reads assigned: 5440
start codons at 5, 21, 30, 42, 86
confident = true

TIG 2[bases=557]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 23 umis using 1084 reads
cdr3 = CQQYNSYSPGCSF at 354, score = 8 + 7
umis assigned: [8, 19, 61, 72, 87, 106, 111, 122, 148, 179] and 13 others
of which 23 are surviving nonsolos
reads assigned: 6809
start codons at 27, 33, 89, 102, 334, 463
confident = true
now this is a cell
paired!

GTGACCGCCGCAGACACGGCTGTGTATTACTGTGCGAGACAAGGTTCGGGGACGCTCCCACGCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTCTCCGGGGTGCAGTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1529 = CGGTTAACAAGCCATT-1

using 371 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 368]
surviving nonsolo ucounts = 1[368]
ids = [0]

====================================================================================

UMI info for barcode CGGTTAACAAGCCATT-1 contig 1 = GAGGAACTGC...
umi AACCGCCTGC = 314 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=510]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=9)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
415-510 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQFNKWPPTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 33, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1535 = CGGTTAACAATGGACG-1

using 300 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 5, 287]
surviving nonsolo ucounts = 1[287]
ids = [2]

====================================================================================

UMI info for barcode CGGTTAACAATGGACG-1 contig 1 = AGGAGTCAGA...
umi CCACTTCTTA = 286 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
387-415 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYYSYPRTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1536 = CGGTTAACACAACGTT-1

using 282 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 277]
surviving nonsolo ucounts = 1[277]
ids = [2]

====================================================================================

UMI info for barcode CGGTTAACACAACGTT-1 contig 1 = GGCTGGGGTC...
umi TAGCCATCGT = 266 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=591]
42-390 ==> 0-348 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
430-591 ==> 0-161 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CSSYTSSSLYVF at 366, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 42, 199, 243, 250, 253, 394, 562
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1539 = CGGTTAACACCACGTG-1

using 198 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[194]
surviving nonsolo ucounts = 1[194]
ids = [3]

====================================================================================

UMI info for barcode CGGTTAACACCACGTG-1 contig 1 = ATCATCCAAC...
umi GACAATAGGC = 176 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=493]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
440-488 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
junction support: 1 umis using 17 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 400, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 173
start codons at 58, 214, 256, 322, 355, 445
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1541 = CGGTTAACACGAAACG-1

using 494 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 487]
surviving nonsolo ucounts = 1[487]
ids = [3]

====================================================================================

UMI info for barcode CGGTTAACACGAAACG-1 contig 1 = TGGGTGATCA...
umi TCACATTTGG = 485 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=571]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
397-435 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CMQALQTPLFTF at 371, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 481
start codons at 35, 68, 104, 192, 354, 374, 477
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1543 = CGGTTAACACGGTTTA-1

using 271 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 8, 259]
surviving nonsolo ucounts = 1[259]
ids = [1]

====================================================================================

UMI info for barcode CGGTTAACACGGTTTA-1 contig 1 = GACTCCTGTG...
umi AGTTTGATGG = 241 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=527]
17-375 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=3)
390-438 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
438-527 ==> 0-89 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 38 reads
cdr3 = CARRRSPWFGALDYW at 362, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 17, 61, 240, 243, 323, 332, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1550 = CGGTTAACAGCGATCC-1

using 337 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[337]
surviving nonsolo ucounts = 1[337]
ids = [0]

====================================================================================

UMI info for barcode CGGTTAACAGCGATCC-1 contig 1 = GGGGAGGAAC...
umi TGTTTTGCTT = 340 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQRSNWPFTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 333
start codons at 36, 241, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1556 = CGGTTAACAGTCAGCC-1

using 290 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 282]
surviving nonsolo ucounts = 1[282]
ids = [3]

====================================================================================

UMI info for barcode CGGTTAACAGTCAGCC-1 contig 1 = CTGGGCCTCA...
umi CGGTTCGGTT = 261 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=512]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-377 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
378-416 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
416-512 ==> 0-96 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQAWDSSTGVVF at 352, score = 6 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 37, 42, 98, 185, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1557 = CGGTTAACAGTGAGTG-1

using 454 reads

====================================================================================

graph has 180 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[3, 4, 5, 11, 430]
surviving nonsolo ucounts = 1[430]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=443]
2-193 ==> 178-369 on |392|IGLV9-49|L-REGION+V-REGION| [len=369] (mis=1)
194-232 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
232-443 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 423
start codons at 22, 62, 140, 170
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1558 = CGGTTAACATAAAGGT-1

using 285 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[283]
surviving nonsolo ucounts = 1[283]
ids = [2]

====================================================================================

UMI info for barcode CGGTTAACATAAAGGT-1 contig 1 = AGGAGTCAGT...
umi AGACTCACCC = 282 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
27-364 ==> 0-337 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=27)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQMFSIPFTF at 354, score = 6 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 27, 33, 89, 102, 238, 241, 331, 363, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1562 = CGGTTAACATGGTAGG-1

using 322 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 313]
surviving nonsolo ucounts = 1[313]
ids = [4]

====================================================================================

UMI info for barcode CGGTTAACATGGTAGG-1 contig 1 = TTTATGGGAG...
umi CGGCGCAAAG = 283 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=516]
35-388 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
385-423 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
423-516 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQSYTTPWTF at 362, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 3, 35, 41, 110, 246, 465
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1563 = CGGTTAACATTGGGCC-1

using 282 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[282]
surviving nonsolo ucounts = 1[282]
ids = [0]

====================================================================================

UMI info for barcode CGGTTAACATTGGGCC-1 contig 1 = GGAGTCAGAC...
umi TGCATTCCGT = 279 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQYNSYSETF at 353, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 26, 32, 88, 101, 333, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1572 = CGGTTAAGTCACTTCC-1

using 348 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[344]
surviving nonsolo ucounts = 1[344]
ids = [2]

====================================================================================

UMI info for barcode CGGTTAAGTCACTTCC-1 contig 1 = GATCAGGACT...
umi ACGGTCACAG = 345 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CMQALQTPPTF at 366, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 342
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1579 = CGGTTAAGTCTAGCCG-1

using 228 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[12, 213]
surviving nonsolo ucounts = 1[213]
ids = [2]

====================================================================================

UMI info for barcode CGGTTAAGTCTAGCCG-1 contig 1 = GCTGGGGTCT...
umi GCTCACACCG = 203 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=535]
41-392 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=4)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
429-535 ==> 0-106 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CSSYTSSSTYVF at 365, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 41, 198, 242, 249, 252, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1581 = CGGTTAAGTCTGGTCG-1

using 383 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 377]
surviving nonsolo ucounts = 1[377]
ids = [5]

====================================================================================

UMI info for barcode CGGTTAAGTCTGGTCG-1 contig 1 = GGGAGTCTCA...
umi CTTTTACCAG = 377 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CQQSYTTLLTF at 350, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 373
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1587 = CGGTTAAGTGTCTGAT-1

using 839 reads

====================================================================================

graph has 230 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 9[2^3, 3^2, 4, 7^2, 806]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1589 = CGGTTAAGTTAAGATG-1

using 797 reads

====================================================================================

graph has 220 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[165, 631]
surviving nonsolo ucounts = 2[165, 631]
ids = [0, 1]

====================================================================================

UMI info for barcode CGGTTAAGTTAAGATG-1 contig 1 = GCTCTGCTTC...
umi ACGGTTTCTT = 163 reads: +394 validated
umi CCTTTTGGAT = 631 reads: -365 +28 -1XX invalidated

GOOD CONTIGS

TIG 1[bases=656]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=3)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
445-656 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CQSYDSSLSAPYVF at 375, score = 8 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 786
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1590 = CGGTTAAGTTATTCTC-1

using 254 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[251]
surviving nonsolo ucounts = 1[251]
ids = [2]

====================================================================================

UMI info for barcode CGGTTAAGTTATTCTC-1 contig 1 = GCTCTGCTTC...
umi CGCACTTCAG = 250 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=585]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-585 ==> 0-140 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1591 = CGGTTAAGTTTAAGCC-1

using 243 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 14, 225]
surviving nonsolo ucounts = 1[225]
ids = [3]

====================================================================================

UMI info for barcode CGGTTAAGTTTAAGCC-1 contig 1 = GCTCTGCTTC...
umi TGCTGACGGG = 214 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=586]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=10)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
442-586 ==> 0-144 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQSYDINLIGVIF at 375, score = 7 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 51, 114, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1592 = CGGTTAAGTTTAGCTG-1

using 162 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[161]
surviving nonsolo ucounts = 1[161]
ids = [1]

====================================================================================

UMI info for barcode CGGTTAAGTTTAGCTG-1 contig 1 = GGGGTCTCAG...
umi GTCAATGTCA = 151 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=476]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
426-476 ==> 0-50 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CSSHAGSTRVLF at 362, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 150
start codons at 38, 195, 246, 345, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1595 = CGGTTAATCAAGGTAA-1

using 760 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 6, 750]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=301]
3-61 ==> 5942-6000 on rc of segment after IGHV1OR15-1 exon 1 [len=6000] (mis=6)
38-79 ==> 10099-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
61-253 ==> 0-192 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=3)
250-301 ==> 20-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [1]
of which 0 are surviving nonsolos
reads assigned: 737
start codons at 61, 212
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1596 = CGGTTAATCAATAAGG-1

using 11 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 1[10]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1597 = CGGTTAATCACAGTAC-1

using 237 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 233]
surviving nonsolo ucounts = 1[233]
ids = [2]

====================================================================================

UMI info for barcode CGGTTAATCACAGTAC-1 contig 1 = GGTAGCTCAG...
umi TCGACAGGTA = 230 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=638]
0-36 ==> 50-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
36-389 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=10)
389-427 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
427-638 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 35 reads
cdr3 = CQSYDSSNQAVF at 363, score = 6 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 36, 99, 190, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1602 = CGGTTAATCCACGTTC-1

using 339 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 335]
surviving nonsolo ucounts = 1[335]
ids = [2]

====================================================================================

UMI info for barcode CGGTTAATCCACGTTC-1 contig 1 = GGGGAGGAGT...
umi TACTGGGAGA = 334 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=552]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYDNLPTF at 358, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 332
start codons at 31, 37, 93, 106, 245, 368, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1605 = CGGTTAATCCTCATTA-1

using 2424 reads

====================================================================================

graph has 3034 edges initially, 42 edges after simplification

total ucounts = 1015
nonsolo ucounts = 435[2^192, 3^100, 4^55, 5^36, 6^16, 7^8, 8^8, 9^7, 10, 11^4, 12, 15^2, 17, 18, 26, 37, 287]
surviving nonsolo ucounts = 1[287]
ids = [380]

====================================================================================

UMI info for barcode CGGTTAATCCTCATTA-1 contig 1 = TGGGGGCAGG...
umi CCGGGGTTAG = 272 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=518]
34-387 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=4)
384-422 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
422-518 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 54 reads
cdr3 = CQQSYSTPRTF at 361, score = 9 + 7
umis assigned: [380]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 34, 40, 96, 109, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1619 = CGGTTAATCTGCAAGT-1

using 189 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 5, 11, 167]
surviving nonsolo ucounts = 1[167]
ids = [2]

====================================================================================

UMI info for barcode CGGTTAATCTGCAAGT-1 contig 1 = GGCTGGGGTC...
umi CGTCTAGCCT = 152 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=451]
42-396 ==> 0-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
395-433 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 24 reads
cdr3 = CSSYTSSSTLVVF at 366, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 151
start codons at 42, 199, 243, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1628 = CGTAGCGAGAATTGTG-1

using 137 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 11, 120]
surviving nonsolo ucounts = 2[11, 120]
ids = [0, 2]

====================================================================================

UMI info for barcode CGTAGCGAGAATTGTG-1 contig 1 = GAGGAATCAG...
umi CAGCGATGAG = 11 reads: +1 -1 +213 -75 +98 non-validated
umi TACACCATAA = 108 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=483]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-483 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 117
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1639 = CGTAGCGAGCTCAACT-1

using 129 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^3, 3, 117]
surviving nonsolo ucounts = 1[117]
ids = [4]

====================================================================================

UMI info for barcode CGTAGCGAGCTCAACT-1 contig 1 = AGCTTCAGCT...
umi CCGCACTCAA = 106 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=562]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-355 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-562 ==> 0-127 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CVAWDDSLYAWVF at 368, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 103
start codons at 47, 351, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1641 = CGTAGCGAGGCATGTG-1

using 242 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 8, 224]
surviving nonsolo ucounts = 1[224]
ids = [0]

====================================================================================

UMI info for barcode CGTAGCGAGGCATGTG-1 contig 1 = AGGAACTGCT...
umi AAGTCATATT = 203 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=513]
24-383 ==> 0-359 on |294|IGKV3D-7|L-REGION+V-REGION| [len=359] (mis=3)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
418-513 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQDYNLPCSF at 357, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 24, 32, 102, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1642 = CGTAGCGAGGGAGTAA-1

using 234 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[234]
surviving nonsolo ucounts = 1[234]
ids = [0]

====================================================================================

UMI info for barcode CGTAGCGAGGGAGTAA-1 contig 1 = GAGGAACTGC...
umi CAACAGTGCA = 217 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=487]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=2)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
412-487 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQYNNWLTF at 354, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 33, 102, 238, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1643 = CGTAGCGAGGTGACCA-1

using 458 reads

====================================================================================

graph has 120 edges initially, 12 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 223, 233]
surviving nonsolo ucounts = 2[223, 233]
ids = [2, 0]

====================================================================================

UMI info for barcode CGTAGCGAGGTGACCA-1 contig 1 = GAGGAACTGC...
umi CGAAATGGGG = 50 reads: -234 +3 -1X +1 -1XX +1 -1XX +6 -1XX +8 -1XX +6 -1XX +4 -1XX +27 -1XX +14 -2XX +9 -1XX +2 -1XX +10 -2XX +1 -2XX +4 -2XX +20 -1XX +13 invalidated
umi TGTCGGTTGA = 221 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYNNWPRTF at 354, score = 9 + 8
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 269
start codons at 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1644 = CGTAGCGAGGTGTGGT-1

using 227 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 221]
surviving nonsolo ucounts = 1[221]
ids = [3]

====================================================================================

UMI info for barcode CGTAGCGAGGTGTGGT-1 contig 1 = TGGGGAGGAA...
umi TTACGTGGTG = 226 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=555]
0-37 ==> 10-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
37-382 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQRSNWPLTF at 358, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 37, 242, 245, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1649 = CGTAGCGAGTGTTTGC-1

using 236 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 8, 220]
surviving nonsolo ucounts = 1[220]
ids = [1]

====================================================================================

UMI info for barcode CGTAGCGAGTGTTTGC-1 contig 1 = GGCATTTCCA...
umi AGTACTTCTG = 194 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=492]
0-44 ==> 35-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
44-397 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=8)
398-416 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=2)
414-477 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
junction support: 1 umis using 19 reads
cdr3 = CAREEYTRSSDYYYYGMDVW at 386, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 44, 200, 347, 434
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1651 = CGTAGCGAGTTCGCAT-1

using 330 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 5, 320]
surviving nonsolo ucounts = 1[320]
ids = [1]

====================================================================================

UMI info for barcode CGTAGCGAGTTCGCAT-1 contig 1 = AGTGCTTTCT...
umi AATATCGCAT = 254 reads: +460 validated

GOOD CONTIGS

TIG 1[bases=497]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
397-428 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=4)
426-477 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
477-497 ==> 0-20 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARGSGMGYCSGGSCYLNWFDPW at 377, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 17, 38, 82, 168, 395
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1658 = CGTAGCGCAAGGACTG-1

using 206 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[200]
surviving nonsolo ucounts = 1[200]
ids = [5]

====================================================================================

UMI info for barcode CGTAGCGCAAGGACTG-1 contig 1 = AGCTTCAGCT...
umi TGCAGGCGCA = 187 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=560]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-560 ==> 0-125 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1659 = CGTAGCGCAAGTTCTG-1

using 50 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[50]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1666 = CGTAGCGCACGACGAA-1

using 297 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[294]
surviving nonsolo ucounts = 1[294]
ids = [2]

====================================================================================

UMI info for barcode CGTAGCGCACGACGAA-1 contig 1 = AGCTTCAGCT...
umi GCAATGAGCG = 291 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=0)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
435-548 ==> 0-113 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CAAWDDSLNGPVF at 368, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 285
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1671 = CGTAGCGCAGCCTTTC-1

using 339 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 334]
surviving nonsolo ucounts = 1[334]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=368]
0-26 ==> 5974-6000 on rc of segment after IGKV1-5 exon 1 [len=6000] (mis=1)
0-26 ==> 5270-5296 on rc of segment before IGKV1-13 exon 2 [len=5296] (mis=1)
0-26 ==> 783-809 on rc of segment before IGKV2-23 exon 2 [len=809] (mis=1)
0-26 ==> 9984-10010 on rc of segment before IGKV2-40 exon 1 [len=10010] (mis=1)
0-26 ==> 787-813 on segment before IGKV1D-22 exon 1 [len=813] (mis=1)
11-48 ==> 5674-5711 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=0)
26-48 ==> 0-22 on |244|IGKV1D-13|L-REGION+V-REGION| [len=351] (mis=0)
44-195 ==> 200-351 on |244|IGKV1D-13|L-REGION+V-REGION| [len=351] (mis=7) [SHIFT!]
195-232 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
232-368 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYNSYPLTF at 171, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 330
start codons at 26, 32, 55, 58, 151, 274
confident = false
not full
frameshifted full length stopped transcript of length 368
VJ delta = 195
delta too large
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1674 = CGTAGCGCAGTAAGCG-1

using 434 reads

====================================================================================

graph has 176 edges initially, 6 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[185, 247]
surviving nonsolo ucounts = 2[185, 247]
ids = [2, 1]

====================================================================================

UMI info for barcode CGTAGCGCAGTAAGCG-1 contig 1 = GGGAGAGCCC...
umi TCTCAGCCGG = 166 reads: +382 validated

UMI info for barcode CGTAGCGCAGTAAGCG-1 contig 2 = GGAGTCAGAC...
umi CCTGCTCGCG = 208 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=493]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
391-429 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
429-493 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQRSNWPITF at 368, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 47, 252, 255, 471
confident = false

TIG 2[bases=478]
0-32 ==> 21-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
32-377 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=0)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
414-478 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYYSYPPTF at 353, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1675 = CGTAGCGCAGTCACTA-1

using 179 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[176]
surviving nonsolo ucounts = 1[176]
ids = [2]

====================================================================================

UMI info for barcode CGTAGCGCAGTCACTA-1 contig 1 = TGAGCGCAGA...
umi AAATGGCCTT = 167 reads: +388 validated
umi AAATTTAATT = 1 reads: -44 +5 -1X +5 -1X +5 -3 +7 -1 +3 -1 +1 -1X +1 -5X +4 -1 +1 -3X +1 -2X +1 -2X +1 -288 invalidated

GOOD CONTIGS

TIG 1[bases=558]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=13)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-558 ==> 0-134 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CGAWDTSLSAWVF at 357, score = 7 + 8
umis assigned: [2, 3]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1676 = CGTAGCGCATACAGCT-1

using 213 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[3, 6, 7^2, 11, 177]
surviving nonsolo ucounts = 1[177]
ids = [4]

====================================================================================

UMI info for barcode CGTAGCGCATACAGCT-1 contig 1 = AGGAATCAGT...
umi CATTGCTATG = 161 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=496]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-496 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 160
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1679 = CGTAGCGCATCGATTG-1

using 510 reads

====================================================================================

graph has 228 edges initially, 6 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2, 3, 5, 226, 266]
surviving nonsolo ucounts = 2[226, 266]
ids = [10, 2]

====================================================================================

UMI info for barcode CGTAGCGCATCGATTG-1 contig 1 = GGCATGGAAG...
umi TGTGCGTCCT = 229 reads: +382 validated

UMI info for barcode CGTAGCGCATCGATTG-1 contig 2 = GGAGTCAGTC...
umi CACTGGGTTC = 271 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=521]
3-315 ==> 0-312 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=29)
347-385 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
385-521 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CMQYDDWPRTF at 324, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 3, 72, 232, 327, 334, 337, 427
confident = false

TIG 2[bases=550]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-361 ==> 0-335 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=18)
386-414 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQTHTVPRTF at 353, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 26, 32, 88, 101, 230, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1681 = CGTAGCGCATGCAATC-1

using 149 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 3, 143]
surviving nonsolo ucounts = 1[143]
ids = [3]

====================================================================================

UMI info for barcode CGTAGCGCATGCAATC-1 contig 1 = GGAGGAACTG...
umi GATGGGCTAA = 1 reads: -308 +9 -1 +13 -1 +14 -1 +13 -3X +1 -24 invalidated
umi GATGGGCTCC = 125 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=459]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
384-422 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
422-459 ==> 0-37 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQQRSNWPPIFTF at 355, score = 9 + 8
umis assigned: [2, 3]
of which 1 are surviving nonsolos
reads assigned: 123
start codons at 34, 239, 242
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1683 = CGTAGCGCATTAGGCT-1

using 205 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[205]
surviving nonsolo ucounts = 1[205]
ids = [0]

====================================================================================

UMI info for barcode CGTAGCGCATTAGGCT-1 contig 1 = GGGGTCTCAG...
umi CGCAGTCCTG = 196 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-38 ==> 3-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=3)
38-382 ==> 0-344 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=20)
388-426 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
426-547 ==> 0-121 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CSSYISSTTLGF at 362, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 38, 246, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1685 = CGTAGCGGTAACGTTC-1

using 336 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 333]
surviving nonsolo ucounts = 1[333]
ids = [0]

====================================================================================

UMI info for barcode CGTAGCGGTAACGTTC-1 contig 1 = GAGTCAGACC...
umi GCTGCCGTTC = 292 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=498]
0-25 ==> 22-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
25-376 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=25)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
413-498 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQGNSFPYTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 25, 31, 87, 100, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1687 = CGTAGCGGTAAGTGGC-1

using 94 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[93]
surviving nonsolo ucounts = 1[93]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=446]
4-38 ==> 5966-6000 on rc of segment after IGHV4-4 exon 1 [len=6000] (mis=0)
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=9)
405-446 ==> 0-41 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
cdr3 = CARAHGDYYTLLDCW at 377, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 92
start codons at 17, 38, 82, 168, 368
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1690 = CGTAGCGGTAGGGTAC-1

using 106 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 101]
surviving nonsolo ucounts = 1[101]
ids = [3]

====================================================================================

UMI info for barcode CGTAGCGGTAGGGTAC-1 contig 1 = GGGGTCACAA...
umi TTCATAGGGC = 97 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=579]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=11)
385-423 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
423-579 ==> 0-156 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CCSKAGRSYVF at 362, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 96
start codons at 38, 177, 246, 387, 555
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1692 = CGTAGCGGTCAAAGAT-1

using 230 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[230]
surviving nonsolo ucounts = 1[230]
ids = [0]

====================================================================================

UMI info for barcode CGTAGCGGTCAAAGAT-1 contig 1 = GAGGAATCAG...
umi CCATCGAGCA = 221 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=469]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=6)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
416-469 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQHKSYPFTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1694 = CGTAGCGGTCCAGTAT-1

using 157 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 149]
surviving nonsolo ucounts = 1[149]
ids = [0]

====================================================================================

UMI info for barcode CGTAGCGGTCCAGTAT-1 contig 1 = GTGATCAGGA...
umi AACTCTCCAT = 140 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=491]
32-392 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=5)
388-426 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
426-491 ==> 0-65 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CMQGTHSVTF at 368, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 139
start codons at 32, 65, 93, 101, 189, 351, 371, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1695 = CGTAGCGGTCCCGACA-1

using 75 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 11[2^3, 3, 4, 5^2, 6, 9^2, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1696 = CGTAGCGGTCGGATCC-1

using 134 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[134]
surviving nonsolo ucounts = 1[134]
ids = [0]

====================================================================================

UMI info for barcode CGTAGCGGTCGGATCC-1 contig 1 = TCACAAGAGG...
umi TGCTACGCAT = 128 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=515]
0-34 ==> 128-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
34-374 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=6)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
422-515 ==> 0-93 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CCSYAVSSTWVF at 358, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 34, 173, 235, 242, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1701 = CGTAGCGGTGCTTCTC-1

using 87 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[6, 80]
surviving nonsolo ucounts = 1[80]
ids = [0]

====================================================================================

UMI info for barcode CGTAGCGGTGCTTCTC-1 contig 1 = AGCTCTGAGA...
umi AGATAGGCTT = 77 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=544]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=25)
464-512 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
512-544 ==> 0-32 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 8 reads
cdr3 = CAKLRLSMLRGASRRIFDSW at 421, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 77
start codons at 79, 230, 367, 382, 442
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1703 = CGTAGCGGTGGTCTCG-1

using 167 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^3, 156]
surviving nonsolo ucounts = 1[156]
ids = [1]

====================================================================================

UMI info for barcode CGTAGCGGTGGTCTCG-1 contig 1 = GGGGCTCCAA...
umi AACTCCGCAA = 140 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=589]
45-397 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=18)
395-433 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
433-589 ==> 0-156 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CSAWDSSLNVWVF at 366, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 139
start codons at 45, 184, 374, 391
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1704 = CGTAGCGGTGTCGCTG-1

using 576 reads

====================================================================================

graph has 178 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[254, 320]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1711 = CGTAGCGGTTTGGGCC-1

using 225 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 218]
surviving nonsolo ucounts = 1[218]
ids = [5]

====================================================================================

UMI info for barcode CGTAGCGGTTTGGGCC-1 contig 1 = AGAGCTGCTC...
umi TTTCTACCTC = 196 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=514]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=14)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
419-514 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQYDSSPALTF at 355, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 31, 226, 239, 406, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1714 = CGTAGCGTCAGCGACC-1

using 203 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[88, 113]
surviving nonsolo ucounts = 2[88, 113]
ids = [0, 2]

====================================================================================

UMI info for barcode CGTAGCGTCAGCGACC-1 contig 1 = GAGGAATCAG...
umi ATTCTCCGAT = 88 reads: +388 validated
umi TTAGCTACCC = 112 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 26 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 196
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1720 = CGTAGCGTCCCATTAT-1

using 128 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 4, 6, 111]
surviving nonsolo ucounts = 1[111]
ids = [3]

====================================================================================

UMI info for barcode CGTAGCGTCCCATTAT-1 contig 1 = TCTGCTTCAG...
umi CCTAACCATG = 107 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=538]
0-49 ==> 2-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
49-405 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
405-443 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
443-538 ==> 0-95 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CQSYDSSLSGLYVF at 373, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 107
start codons at 49, 203, 206, 257, 356, 383, 407
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1721 = CGTAGCGTCCGAACGC-1

using 6083 reads

====================================================================================

graph has 3004 edges initially, 70 edges after simplification

total ucounts = 522
nonsolo ucounts = 217[2^86, 3^36, 4^21, 5^11, 6^6, 7^4, 8^2, 9^2, 10^2, 11, 14^2, 58, 61, 71^2, 73, 79, 84, 90^3, 91^2, 96, 102, 104^2, 105, 108, 110, 112, 114^2, 115^4, 116, 122, 124, 128, 129, 130^2, 131, 144, 154^2, 161, 167, 175, 179, 187, 192, 201]
surviving nonsolo ucounts = 42[58, 71^2, 73, 79, 84, 90^3, 91^2, 102, 104^2, 105, 108, 110, 112, 114^2, 115^4, 116, 122, 124, 128, 129, 130^2, 131, 144, 154^2, 161, 167, 175, 179, 187, 192, 201]
ids = [175, 278, 326, 210, 321, 281, 43, 107, 406, 7, ...]

====================================================================================

UMI info for barcode CGTAGCGTCCGAACGC-1 contig 1 = GCTCGAAACA...
umi AGCATAAGCG = 106 reads: -138X +250 invalidated
umi CACGAGACGT = 133 reads: +388 validated
umi CATTTTACCG = 110 reads: +388 validated
umi CTGCGGGTCA = 72 reads: +388 validated
umi CTTACGGTTG = 25 reads: -388 non-validated
umi TCTTCTACCG = 88 reads: +388 validated
umi TGTAACTTTA = 43 reads: -354X +1 -4XX +2 -4XX +2 -4XX +1 -2XX +1 -6XX +1 -4XX +2 invalidated
umi TTTCTAGAAG = 154 reads: +388 validated

UMI info for barcode CGTAGCGTCCGAACGC-1 contig 2 = TCGGCGGTGT...
umi CGACCACTCT = 58 reads: +406 validated
umi GCTATAACAC = 42 reads: -377X +2 -9X +2 -2X +1 -2X +2 -2X +2 -1X +4 invalidated
umi GCTATAGGCA = 103 reads: +391 -15 non-validated
umi GGCAACTCAC = 31 reads: -37X +5 -2XX +13 -1XX +8 -1XX +20 -1XX +5 -1XX +8 -1XX +6 -1X +5 -14 +9 -1XX +5 -1XX +3 -3XX +2 -2XX +4 -1XX +40 -2XX +1 -2XX +1 -1XX +2 -6XX +1 -2XX +1 -1XX +1 -1XX +3 -1XX +1 -1XX +1 -2XX +1 -1X +2 -171 invalidated

UMI info for barcode CGTAGCGTCCGAACGC-1 contig 3 = TGGGGAGAGC...
umi AACACCATCT = 115 reads: +388 validated
umi AACAGCCGCC = 89 reads: +38 -1 +1 -1 +347 non-validated
umi ACCGGTATGC = 89 reads: +388 validated
umi AGGTTTTTTG = 110 reads: +388 validated
umi ATATGTGGGT = 108 reads: +388 validated
umi CACGGCATTA = 100 reads: +388 validated
umi CGATAGGTTG = 115 reads: +388 validated
umi CGTAACGGCA = 129 reads: +388 validated
umi CTATCATAGC = 125 reads: +388 validated
umi CTTCCTGCAC = 194 reads: +388 validated
umi GACAGATAGC = 167 reads: -230 +158 non-validated
umi GACAGCAACG = 200 reads: +388 validated
umi GACGCTTAGA = 148 reads: +388 validated
umi GCGAGATCCG = 70 reads: +388 validated
umi GCGTAACGGT = 84 reads: +10 -2 +376 non-validated
umi GCTATCGACC = 117 reads: +388 validated
umi GGCTGGGGGG = 105 reads: +388 validated
umi GTATCTTATC = 70 reads: +388 validated
umi TACAATGTTT = 188 reads: +388 validated
umi TGCATAACGC = 130 reads: +388 validated
umi TTGCGCCAAC = 126 reads: +388 validated
umi TTGGATACTA = 117 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=641]
42-394 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=22)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
430-641 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 6 umis using 114 reads
cdr3 = CSAWDSSLNVWVF at 363, score = 7 + 8
umis assigned: [69, 136, 155, 210, 219, 430, 459, 511]
of which 8 are surviving nonsolos
reads assigned: 719
start codons at 42, 181, 371, 388
confident = true

TIG 2[bases=526]
0-49 ==> 31-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=0)
49-400 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=21)
405-455 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
455-526 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 0 umis using 0 reads
cdr3 = CVKEEDAFDIW at 391, score = 9 + 8
umis assigned: [175, 283, 284, 296]
of which 2 are surviving nonsolos
reads assigned: 230
start codons at 49, 200, 205, 266, 352, 407, 436
confident = true

TIG 3[bases=573]
0-49 ==> 0-49 on |289|IGKV3D-15|5'UTR| [len=49] (mis=3)
49-396 ==> 0-347 on |290|IGKV3D-15|L-REGION+V-REGION| [len=347] (mis=11)
398-437 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
437-573 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 22 umis using 445 reads
cdr3 = CQQYNTWPPMYTF at 370, score = 9 + 8
umis assigned: [5, 7, 43, 81, 100, 137, 177, 189, 204, 223] and 12 others
of which 22 are surviving nonsolos
reads assigned: 2650
start codons at 49, 118, 254, 397, 479
confident = true

REJECT CONTIGS

TIG 1[bases=565]
0-75 ==> 5533-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
391-429 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWDLLLHASSTKSSITF at 350, score = 4 + 8
umis assigned: [107, 363]
of which 2 are surviving nonsolos
reads assigned: 247
start codons at 30, 63, 99, 187, 349, 369, 471
confident = false
not full
frameshifted full length transcript of length 565
VJ delta = 30
not full

TIG 2[bases=551]
8-89 ==> 5665-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=6)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [30, 126, 220, 221, 321, 328, 357, 406]
of which 8 are surviving nonsolos
reads assigned: 961
start codons at 32, 38, 94, 107, 243, 457
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1732 = CGTAGCGTCTCTTGAT-1

using 116 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 113]
surviving nonsolo ucounts = 1[113]
ids = [0]

====================================================================================

UMI info for barcode CGTAGCGTCTCTTGAT-1 contig 1 = TTCACCTTCT...
umi GCGGATTCTG = 107 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=443]
14-374 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-443 ==> 0-32 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CMQALQTPWTF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 106
start codons at 14, 47, 83, 171, 333, 353
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1733 = CGTAGCGTCTGTACGA-1

using 92 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[89]
surviving nonsolo ucounts = 1[89]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1743 = CGTAGGCAGAGAACAG-1

using 384 reads

====================================================================================

graph has 150 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[187, 195]
surviving nonsolo ucounts = 2[187, 195]
ids = [2, 3]

====================================================================================

UMI info for barcode CGTAGGCAGAGAACAG-1 contig 1 = AGTGCTTTCT...
umi CTCTATCACC = 175 reads: +451 validated

UMI info for barcode CGTAGGCAGAGAACAG-1 contig 2 = GATCAGGACT...
umi GTCTTGCATA = 197 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=556]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
420-468 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
468-556 ==> 0-88 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARGSGILVIAIEDYYFDHW at 377, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 169
start codons at 17, 38, 82, 168, 255, 522
confident = false

TIG 2[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CMQALQIRETF at 366, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1747 = CGTAGGCAGATATACG-1

using 632 reads

====================================================================================

graph has 244 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[301, 328]
surviving nonsolo ucounts = 2[301, 328]
ids = [0, 3]

====================================================================================

UMI info for barcode CGTAGGCAGATATACG-1 contig 1 = AGGAATCAGT...
umi ATTTTTTGAG = 301 reads: +388 validated
umi CGTTCGTGAG = 328 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 110 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [0, 3]
of which 2 are surviving nonsolos
reads assigned: 619
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1750 = CGTAGGCAGATGCCAG-1

using 118 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[114]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1755 = CGTAGGCAGCCAACAG-1

using 24 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1762 = CGTAGGCAGGAACTGC-1

using 643 reads

====================================================================================

graph has 310 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 6[2^2, 4, 6, 299, 317]
surviving nonsolo ucounts = 2[299, 317]
ids = [5, 9]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1768 = CGTAGGCAGGGAACGG-1

using 121 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 117]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1774 = CGTAGGCAGTGGGCTA-1

using 206 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2, 4, 5^3, 10, 172]
surviving nonsolo ucounts = 1[172]
ids = [9]

====================================================================================

UMI info for barcode CGTAGGCAGTGGGCTA-1 contig 1 = GGGGTCTCAG...
umi TTGCGCTGCA = 159 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=580]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=23)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
426-580 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CSSYAGNNNLLF at 362, score = 6 + 9
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 157
start codons at 38, 174, 195, 246, 342, 345, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1778 = CGTAGGCAGTTAGGTA-1

using 270 reads

====================================================================================

graph has 124 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[26, 242]
surviving nonsolo ucounts = 2[26, 242]
ids = [1, 3]

====================================================================================

UMI info for barcode CGTAGGCAGTTAGGTA-1 contig 1 = AGAGCTCTGG...
umi TCCAGAGCCG = 221 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=541]
0-22 ==> 38-60 on |373|IGLV4-69|5'UTR| [len=60] (mis=0)
22-381 ==> 0-359 on |374|IGLV4-69|L-REGION+V-REGION| [len=359] (mis=2)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
413-541 ==> 0-128 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQTWGTGILF at 355, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 22, 183, 223, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1787 = CGTAGGCCACCCTATC-1

using 123 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[10, 108]
surviving nonsolo ucounts = 1[108]
ids = [6]

====================================================================================

UMI info for barcode CGTAGGCCACCCTATC-1 contig 1 = AGGAACTGCT...
umi TTCGTTAGAA = 1 reads: -353X +3 -1 +6 -1 +3 -2 +1 -3 +1 -7 +1 invalidated
umi TTCGTTTGCA = 105 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=440]
0-32 ==> 15-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
32-377 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
414-440 ==> 0-26 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 20 reads
cdr3 = CQQRSNWPWTF at 353, score = 9 + 8
umis assigned: [5, 6]
of which 1 are surviving nonsolos
reads assigned: 104
start codons at 32, 237, 240
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1794 = CGTAGGCCAGAGTGTG-1

using 807 reads

====================================================================================

graph has 1156 edges initially, 10 edges after simplification

total ucounts = 435
nonsolo ucounts = 148[2^63, 3^38, 4^15, 5^10, 6^10, 7, 8^5, 9^3, 10, 12, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1802 = CGTAGGCCATCCGGGT-1

using 164 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 159]
surviving nonsolo ucounts = 1[159]
ids = [0]

====================================================================================

UMI info for barcode CGTAGGCCATCCGGGT-1 contig 1 = AGGAGTCAGA...
umi ATTCGTGTCA = 143 reads: +388 validated
umi ATTTGTGTAA = 1 reads: -153 +6 -1 +1 -1 +5 -1 +13 -1 +3 -1 +2 -1 +11 -1X +6 -181 invalidated

GOOD CONTIGS

TIG 1[bases=479]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=9)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-479 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [0, 1]
of which 1 are surviving nonsolos
reads assigned: 143
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1810 = CGTAGGCGTACATGTC-1

using 295 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 130, 157]
surviving nonsolo ucounts = 2[130, 157]
ids = [3, 2]

====================================================================================

UMI info for barcode CGTAGGCGTACATGTC-1 contig 1 = AAGCAGAGCC...
umi ATACCTCTAG = 141 reads: +391 validated
umi ATACCTCTTT = 116 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=557]
0-25 ==> 61-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
25-378 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=18)
378-416 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
416-557 ==> 0-141 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 2 umis using 54 reads
cdr3 = CQSYDGNTKWVF at 352, score = 5 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 254
start codons at 25, 179, 362, 365, 378
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1822 = CGTAGGCGTCTCACCT-1

using 226 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^3, 4, 101, 111]
surviving nonsolo ucounts = 2[101, 111]
ids = [9, 8]

====================================================================================

UMI info for barcode CGTAGGCGTCTCACCT-1 contig 1 = GGGAGCTCAG...
umi TGTACGCCGC = 111 reads: +397 validated
umi TTCCGTGCTT = 101 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=592]
59-419 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=5)
418-456 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
456-592 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 22 reads
cdr3 = CMQGTHWPWTF at 395, score = 8 + 8
umis assigned: [8, 9]
of which 2 are surviving nonsolos
reads assigned: 211
start codons at 59, 92, 120, 128, 216, 378, 398, 498
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1829 = CGTAGGCGTGTTGAGG-1

using 568 reads

====================================================================================

graph has 268 edges initially, 12 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2, 3, 4, 6, 252, 298]
surviving nonsolo ucounts = 2[252, 298]
ids = [0, 4]

====================================================================================

UMI info for barcode CGTAGGCGTGTTGAGG-1 contig 1 = GAGTCAGTCT...
umi AAATAAGTGG = 252 reads: +388 validated
umi CCAATGACAT = 88 reads: -246X +17 -1XX +11 -1XX +20 -1XX +3 -1XX +1 -1XX +15 -2XX +3 -1XX +8 -1XX +3 -2XX +1 -3XX +2 -2XX +1 -1XX +3 -3XX +20 -1XX +13 invalidated

GOOD CONTIGS

TIG 1[bases=549]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=5)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQSYSTPYTF at 352, score = 9 + 8
umis assigned: [0, 4]
of which 2 are surviving nonsolos
reads assigned: 327
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1839 = CGTAGGCGTTTCGCTC-1

using 222 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[5, 214]
surviving nonsolo ucounts = 1[214]
ids = [0]

====================================================================================

UMI info for barcode CGTAGGCGTTTCGCTC-1 contig 1 = AGCTCTCAGA...
umi AAAGGCCGGT = 213 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=583]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=8)
433-451 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=2)
449-512 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
512-583 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CAREEYTRSSDYYYYGMDVW at 421, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 79, 235, 382, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1845 = CGTAGGCTCACATAGC-1

using 128 reads

====================================================================================

graph has 154 edges initially, 4 edges after simplification

total ucounts = 37
nonsolo ucounts = 23[2^4, 3^7, 4^3, 5^3, 6, 8, 9, 10, 11, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1853 = CGTAGGCTCATGTCTT-1

using 407 reads

====================================================================================

graph has 138 edges initially, 6 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[79, 324]
surviving nonsolo ucounts = 2[79, 324]
ids = [4, 5]

====================================================================================

UMI info for barcode CGTAGGCTCATGTCTT-1 contig 1 = AGCATGGACA...
umi TAATACTCCA = 64 reads: +388 validated

UMI info for barcode CGTAGGCTCATGTCTT-1 contig 2 = AGAGCTGCTC...
umi TGATTTTCAC = 294 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=481]
3-354 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
353-391 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
391-481 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CLQYSSSPWTF at 330, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 64
start codons at 3, 9, 78, 214, 433
confident = false

TIG 2[bases=506]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=12)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
416-506 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYGSSPFNF at 355, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 285
start codons at 31, 239, 365, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1858 = CGTAGGCTCCAATGGT-1

using 189 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[186]
surviving nonsolo ucounts = 1[186]
ids = [1]

====================================================================================

UMI info for barcode CGTAGGCTCCAATGGT-1 contig 1 = GAAGGGCTGG...
umi CCAGCTGTAC = 171 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=456]
0-62 ==> 24-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
62-415 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=17)
415-453 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 26 reads
cdr3 = CQSYDSSPSVVF at 389, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 166
start codons at 62, 125, 216, 267, 399
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1865 = CGTAGGCTCCTAAGTG-1

using 258 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[257]
surviving nonsolo ucounts = 1[257]
ids = [1]

====================================================================================

UMI info for barcode CGTAGGCTCCTAAGTG-1 contig 1 = GTCAGTCTCA...
umi CTAGACTGCA = 262 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=24)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CHQSFSTPWTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 23, 29, 85, 98, 336, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1871 = CGTAGGCTCTCGGACG-1

using 169 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 14, 150]
surviving nonsolo ucounts = 1[150]
ids = [5]

====================================================================================

UMI info for barcode CGTAGGCTCTCGGACG-1 contig 1 = TTCTCACAAT...
umi TTATTTCTCG = 128 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=476]
8-368 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
368-405 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
405-476 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CMQALQTPPTF at 344, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 128
start codons at 8, 41, 77, 327, 347, 447
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1874 = CGTAGGCTCTGTTTGT-1

using 18 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1876 = CGTAGGCTCTTCGGTC-1

using 250 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 5, 235]
surviving nonsolo ucounts = 1[235]
ids = [5]

====================================================================================

UMI info for barcode CGTAGGCTCTTCGGTC-1 contig 1 = ATCACATAAC...
umi CATGCTCTTG = 221 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=511]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=10)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
479-511 ==> 0-32 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CARSELVIAIQRFDYW at 400, score = 8 + 6
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 58, 209, 256, 355
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1881 = CGTCACTAGACAGAGA-1

using 77 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[6, 71]
surviving nonsolo ucounts = 1[71]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1890 = CGTCACTAGCCTATGT-1

using 961 reads

====================================================================================

graph has 1140 edges initially, 20 edges after simplification

total ucounts = 451
nonsolo ucounts = 184[2^89, 3^46, 4^16, 5^7, 6^9, 7^5, 8^5, 9^2, 11^2, 12, 13, 85]
surviving nonsolo ucounts = 1[85]
ids = [408]

====================================================================================

UMI info for barcode CGTCACTAGCCTATGT-1 contig 1 = AGTCCCAGTC...
umi TGGTTTCTTA = 75 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=423]
0-20 ==> 38-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
20-352 ==> 0-332 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=24)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 14 reads
cdr3 = CQHLVTHPISF at 347, score = 9 + 7
umis assigned: [408]
of which 1 are surviving nonsolos
reads assigned: 75
start codons at 20, 26, 231, 234
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1892 = CGTCACTAGCGCTCCA-1

using 587 reads

====================================================================================

graph has 248 edges initially, 8 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 184, 198, 202]
surviving nonsolo ucounts = 3[184, 198, 202]
ids = [0, 1, 3]

====================================================================================

UMI info for barcode CGTCACTAGCGCTCCA-1 contig 1 = GCTCTGCTTC...
umi CACAGGCTGC = 193 reads: +391 validated

UMI info for barcode CGTCACTAGCGCTCCA-1 contig 2 = ATCAGTCCCA...
umi GTATAGCAGG = 208 reads: +388 validated

UMI info for barcode CGTCACTAGCGCTCCA-1 contig 3 = GTGGGCTCAG...
umi AGACTGACCA = 175 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=595]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-595 ==> 0-153 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 51, 205, 208, 259, 358, 385
confident = false

TIG 2[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 23, 29, 98, 234, 453
confident = false

TIG 3[bases=570]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=14)
379-417 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
417-570 ==> 0-153 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CYSADSSGDHVVF at 350, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 172
start codons at 35, 96, 165, 170, 234, 296, 333, 378
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1893 = CGTCACTAGCGGCTTC-1

using 182 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[182]
surviving nonsolo ucounts = 1[182]
ids = [0]

====================================================================================

UMI info for barcode CGTCACTAGCGGCTTC-1 contig 1 = TGATCAGGAC...
umi CTGAGGCTTT = 177 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=501]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=0)
390-428 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
428-501 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CMQALQTPPTF at 367, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 173
start codons at 31, 64, 100, 188, 350, 370, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1895 = CGTCACTAGGCAGTCA-1

using 330 reads

====================================================================================

graph has 178 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 7[2^2, 3^2, 4, 138, 178]
surviving nonsolo ucounts = 2[138, 178]
ids = [2, 6]

====================================================================================

UMI info for barcode CGTCACTAGGCAGTCA-1 contig 1 = GAGGAATCAG...
umi TGCGAGATGC = 182 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 28, 34, 103, 239, 458
confident = false

REJECT CONTIGS

TIG 1[bases=460]
0-31 ==> 28-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
0-31 ==> 11333-11364 on rc of segment before IGHV3-19 exon 1 [len=11364] (mis=1)
0-31 ==> 8666-8697 on rc of segment before IGHV3-57 exon 1 [len=8697] (mis=1)
0-31 ==> 5969-6000 on rc of segment after IGHV1OR15-2 exon 1 [len=6000] (mis=1)
17-49 ==> 10108-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
31-384 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
433-460 ==> 12-39 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 373, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 31, 229, 234, 251, 295, 328
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1896 = CGTCACTAGGCATTGG-1

using 85 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 14[2^2, 3^2, 4^4, 5, 8, 9, 11^2, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1898 = CGTCACTAGGCCCTTG-1

using 267 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[265]
surviving nonsolo ucounts = 1[265]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=492]
4-56 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
31-80 ==> 0-49 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
76-319 ==> 102-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=11)
318-356 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=7)
356-492 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQRRTWPPAF at 295, score = 9 + 6
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 31, 179, 398
confident = false
not full
full length transcript of length 492
VJ delta = 71
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1902 = CGTCACTAGGGTATCG-1

using 40 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 12, 21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1903 = CGTCACTAGGTAGCTG-1

using 433 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[6^2, 7, 413]
surviving nonsolo ucounts = 1[413]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1907 = CGTCACTAGGTTCCTA-1

using 218 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 214]
surviving nonsolo ucounts = 1[214]
ids = [0]

====================================================================================

UMI info for barcode CGTCACTAGGTTCCTA-1 contig 1 = GAATCAGTCC...
umi ATCTCGCCGC = 197 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=465]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-465 ==> 0-52 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1912 = CGTCACTAGTCCATAC-1

using 24844 reads

====================================================================================

graph has 6871 edges initially, 98 edges after simplification

total ucounts = 741
nonsolo ucounts = 382[2^123, 3^66, 4^29, 5^13, 6^6, 7^7, 8^9, 9^3, 10, 12, 13^2, 14, 16, 17, 19, 24, 25, 29, 35, 38^3, 56, 62, 66, 73^2, 85, 88, 90, 91, 104, 108, 115, 116, 118^3, 121, 122, 124, 126, 136^2, 138, 144, 145, 146^3, 147^3, 148^3, 149^2, 150, 154^2, 157, 158, 161, 162^2, 165, 166^2, 167, 170, 171^2, 176^2, 178^2, 182^2, 183, 184, 185, 194, 196, 199, 200, 204, 207^2, 208^2, 210, 211, 213, 214, 217, 218, 222, 225^2, 228^3, 230, 232^2, 235, 242, 245, 247, 250, 252, 256^2, 261, 269, 270, 276, 277, 284, 299, 301, 312, 355, 399, 409, 456, 518, 558, 580, 660, 676, 684]
surviving nonsolo ucounts = 112[29, 35, 38^3, 73^2, 85, 88, 90, 91, 104, 108, 115, 118^3, 121, 122, 124, 126, 136^2, 138, 144, 145, 146^3, 147^3, 148^3, 149^2, 150, 154^2, 157, 158, 161, 162^2, 165, 166^2, 167, 170, 171^2, 176^2, 178^2, 182^2, 183, 184, 185, 194, 196, 199, 200, 204, 207^2, 208^2, 210, 211, 213, 214, 217, 218, 222, 225^2, 228^3, 230, 232^2, 235, 242, 245, 247, 250, 252, 256^2, 261, 269, 270, 276, 277, 284, 299, 301, 312, 355, 399, 409, 456, 518, 558, 580, 660, 676, 684]
ids = [423, 479, 302, 334, 396, 78, 439, 586, 572, 406, ...]

====================================================================================

UMI info for barcode CGTCACTAGTCCATAC-1 contig 1 = GTGGGTCCAG...
umi ACATGCGTTA = 223 reads: +385 validated
umi ACGTGATGTA = 74 reads: +385 validated
umi ACTCGTGCTT = 685 reads: -343X +1 -6XX +35 invalidated
umi ACTTTATTCG = 206 reads: +385 validated
umi AGCGATTATT = 116 reads: +385 validated
umi AGCGTGGCCT = 147 reads: +385 validated
umi ATATAATTCT = 208 reads: +385 validated
umi ATCCACCTCA = 581 reads: -336X +1 -3XX +1 -2XX +1 -6XX +35 invalidated
umi ATGTAAGGTC = 153 reads: +385 validated
umi CAAAAGTGGC = 221 reads: +385 validated
umi CACTATCTTT = 524 reads: -334 +1 -1XX +1 -3XX +1 -2XX +1 -6XX +35 invalidated
umi CACTTTCTAC = 410 reads: +385 validated
umi CATCCTCCCA = 175 reads: +385 validated
umi CATGTACCGT = 117 reads: +385 validated
umi CATTCACGGA = 148 reads: +385 validated
umi CATTCGTCAC = 181 reads: +385 validated
umi CCTATTGGTT = 122 reads: +385 validated
umi CCTGGCGGAC = 202 reads: +385 validated
umi CCTGTATTTT = 215 reads: +385 validated
umi CGGCGTAGAT = 175 reads: +385 validated
umi CGGCTAGTCC = 159 reads: +385 validated
umi CGTCTAGCAT = 234 reads: +385 validated
umi CTCTTCGGCA = 151 reads: +385 validated
umi GAACTGGGTT = 187 reads: +385 validated
umi GAACTTGCCT = 145 reads: +385 validated
umi GCCAGATGCG = 120 reads: +385 validated
umi GCGATGCAAT = 162 reads: +385 validated
umi GCTACCTAGA = 76 reads: +356 -1X +28 invalidated
umi GCTTTCGGTC = 230 reads: +385 validated
umi GGATAAGGCC = 166 reads: +385 validated
umi GGTTTCCCCT = 196 reads: +385 validated
umi GTAGTTACCA = 210 reads: +385 validated
umi GTGTTCACTC = 672 reads: -328X +1 -6XX +2 -3XX +1 -2XX +1 -6XX +35 invalidated
umi TACATTGATT = 222 reads: +385 validated
umi TACCTTCATT = 144 reads: +385 validated
umi TACTTAGGTT = 350 reads: +385 validated
umi TAGTTCGGGG = 165 reads: +385 validated
umi TATGCCCTCG = 120 reads: +385 validated
umi TCACAGCTCC = 462 reads: -337 +1 -5X +1 -6XX +35 invalidated
umi TCACGATTGT = 87 reads: +385 validated
umi TTATCTCAGT = 143 reads: +385 validated
umi TTGATCCTGG = 553 reads: -336 +2 -2XX +1 -2XX +1 -6XX +35 invalidated

UMI info for barcode CGTCACTAGTCCATAC-1 contig 2 = TCTGAGGATA...
umi AAACTACCAG = 201 reads: +391 validated
umi ACTCATAACT = 125 reads: +391 validated
umi ACTTCCCTCC = 162 reads: +391 validated
umi AGCCTGTATC = 143 reads: +391 validated
umi AGCTTACCGT = 173 reads: +391 validated
umi ATCGCTAGTA = 185 reads: +391 validated
umi CAACAATTCG = 145 reads: +391 validated
umi CATTGTCAGT = 146 reads: +391 validated
umi CCACAGTGGG = 402 reads: -375 +16 non-validated
umi CCTTTTACGC = 661 reads: -255X +136 invalidated
umi CGCATCGTTT = 166 reads: +391 validated
umi CGTACTTCCT = 112 reads: +322 -69 non-validated
umi GACATTTTGT = 159 reads: +391 validated
umi GATCCCGTCA = 207 reads: +391 validated
umi GGCTATATTG = 180 reads: +391 validated
umi GTGACTAAAA = 167 reads: +391 validated
umi TAATACAGAT = 183 reads: +391 validated
umi TAGTCGCGCC = 170 reads: +391 validated
umi TATGCTGGGC = 88 reads: +391 validated
umi TCACTTCCGT = 106 reads: +391 validated
umi TCCATGCTTT = 137 reads: +391 validated
umi TCCGGAACCT = 90 reads: +391 validated
umi TCCGTTCCTC = 141 reads: +391 validated
umi TCTCCTCCAC = 210 reads: +391 validated
umi TCTCGGGTAA = 177 reads: +391 validated
umi TGAGCACATC = 150 reads: +391 validated
umi TGGCAGACTC = 233 reads: +391 validated
umi TGTTGGATAG = 128 reads: +30 -1 +6 -1 +1 -1 +1 -2X +348 invalidated
umi TTACATATAC = 144 reads: +391 validated
umi TTCGTAACCC = 145 reads: +391 validated

UMI info for barcode CGTCACTAGTCCATAC-1 contig 3 = TGGGGGACTC...
umi ACACACGGGA = 174 reads: +427 validated
umi ACCCCTTCGT = 249 reads: +427 validated
umi ACCTGCGAGT = 147 reads: +7 -1 +419 non-validated
umi ACGACTCTGT = 207 reads: +427 validated
umi ACTAATAGTA = 296 reads: +427 validated
umi ACTCTCACGG = 205 reads: +427 validated
umi AGTGCACAAT = 215 reads: +427 validated
umi ATCACGGTAA = 275 reads: +427 validated
umi CACAATGTTC = 256 reads: +427 validated
umi CACAATTGGC = 284 reads: +427 validated
umi CAGTTGTCCC = 179 reads: +289 -1XX +1 -2XX +1 -2XX +1 -2 +128 invalidated
umi CAGTTTCTTA = 137 reads: -395X +1 -8XX +1 -11XX +2 -1XX +1 -6XX +1 invalidated
umi CCTTTCATTT = 227 reads: +427 validated
umi CGGGGCATGT = 250 reads: +427 validated
umi CGTTGCCAAT = 35 reads: -427 non-validated
umi CTGATTGCAC = 223 reads: +427 validated
umi GAGTCTCAGC = 33 reads: +75 -10 +292 -17 +33 non-validated
umi GATTCGCAAA = 91 reads: +427 validated
umi GCAATTACAG = 214 reads: +427 validated
umi GCCCACTAAA = 1 reads: -427 non-validated
umi GTATACCGTA = 34 reads: -7 +420 non-validated
umi GTGCTTCGCT = 212 reads: +407 -9 +11 non-validated
umi TAAGATCCGT = 284 reads: +427 validated
umi TAATCATTAT = 257 reads: +427 validated
umi TACCCAAACC = 108 reads: +357 -4 +56 -10 non-validated
umi TACGTTCCTT = 305 reads: +427 validated
umi TATCTAAGCT = 135 reads: +427 validated
umi TCGAGTGGGA = 217 reads: +427 validated
umi TCGCCAGGCT = 273 reads: +427 validated
umi TCTGAATCCT = 202 reads: +427 validated
umi TCTTACTCCG = 128 reads: +427 validated
umi TCTTTCAATG = 155 reads: +427 validated
umi TGAATTCTCC = 228 reads: +427 validated
umi TGCGCGTTCA = 262 reads: +427 validated
umi TTATCAGTCA = 214 reads: +427 validated
umi TTCGCGGGCA = 223 reads: +427 validated
umi TTTCCGTCGG = 311 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=631]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
382-420 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
420-631 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 36 umis using 978 reads
cdr3 = CQSADSSGTYQEVF at 350, score = 8 + 8
umis assigned: [50, 78, 86, 91, 102, 103, 133, 144, 165, 188] and 32 others
of which 42 are surviving nonsolos
reads assigned: 9708
start codons at 35, 96, 165, 183
confident = true

TIG 2[bases=688]
0-86 ==> 0-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
86-439 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=2)
439-477 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
477-688 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 28 umis using 753 reads
cdr3 = CQSYDSSNHGVF at 413, score = 6 + 8
umis assigned: [2, 84, 90, 101, 108, 151, 189, 241, 246, 295] and 20 others
of which 30 are surviving nonsolos
reads assigned: 5363
start codons at 86, 149, 240, 291, 423, 438
confident = true

TIG 3[bases=520]
22-380 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=1)
386-449 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=5)
449-520 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 31 umis using 574 reads
cdr3 = CAHRGGRKDYYYYMDVW at 367, score = 7 + 7
umis assigned: [39, 61, 69, 70, 82, 87, 121, 142, 197, 198] and 27 others
of which 37 are surviving nonsolos
reads assigned: 7134
start codons at 22, 66, 245, 248, 328, 337, 406
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1918 = CGTCACTAGTGTCTCA-1

using 93 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^4, 83]
surviving nonsolo ucounts = 1[83]
ids = [6]

====================================================================================

UMI info for barcode CGTCACTAGTGTCTCA-1 contig 1 = ACTTTCTGAG...
umi TCCGCTGGGT = 83 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=525]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=9)
411-459 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
459-525 ==> 0-66 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 7 reads
cdr3 = CARGAGITTRAYYFDYW at 377, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 82
start codons at 14, 35, 79
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1936 = CGTCACTCACGGTGTC-1

using 247 reads

====================================================================================

graph has 338 edges initially, 22 edges after simplification

total ucounts = 103
nonsolo ucounts = 50[2^23, 3^9, 4^7, 5^2, 6, 7^3, 8^2, 11, 14, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1937 = CGTCACTCACTAAGTC-1

using 218 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 215]
surviving nonsolo ucounts = 1[215]
ids = [2]

====================================================================================

UMI info for barcode CGTCACTCACTAAGTC-1 contig 1 = GTCAGACTCA...
umi TTCTAATCTG = 203 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=507]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=9)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-507 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQYNSYPLTF at 350, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 23, 29, 85, 98, 234, 237, 330, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1941 = CGTCACTCAGCCAGAA-1

using 8122 reads

====================================================================================

graph has 3353 edges initially, 64 edges after simplification

total ucounts = 510
nonsolo ucounts = 220[2^80, 3^43, 4^14, 5^13, 6^7, 7^5, 8^2, 9, 10, 11, 13, 14^3, 20^2, 32, 34, 38^2, 49, 60, 68, 70, 82, 83, 90, 97, 99, 101, 116, 124, 127, 128, 132, 143, 145, 151, 152, 153, 154^2, 158, 160, 161, 167^2, 173, 176, 177^2, 178, 181, 183^2, 187, 191, 194^2, 196, 268, 461, 652]
surviving nonsolo ucounts = 45[32, 34, 49, 60, 68, 70, 82, 83, 90, 97, 99, 101, 116, 124, 127, 128, 132, 143, 145, 151, 152, 153, 154^2, 158, 160, 161, 167^2, 173, 176, 177^2, 178, 181, 183^2, 187, 191, 194^2, 196, 268, 461, 652]
ids = [33, 49, 41, 490, 475, 339, 58, 358, 486, 380, ...]

====================================================================================

UMI info for barcode CGTCACTCAGCCAGAA-1 contig 1 = GAGCTACAAC...
umi ATTAAGTGTA = 34 reads: +400 validated
umi CAAATATGCA = 77 reads: +400 validated
umi CAACCTAGTT = 153 reads: +400 validated
umi CACGTAGCGC = 177 reads: +400 validated
umi CAGGATATCG = 154 reads: +400 validated
umi CATATAATTT = 184 reads: +400 validated
umi CCTACTTTAG = 178 reads: +400 validated
umi CCTCAGCCCC = 129 reads: +400 validated
umi CCTCTCGAGT = 193 reads: +400 validated
umi CCTTATCCGT = 149 reads: +400 validated
umi CTACCGGGTC = 126 reads: +400 validated
umi CTGCAAACCA = 155 reads: +400 validated
umi GATACTCTCA = 193 reads: +400 validated
umi GCCATGCAGC = 101 reads: +400 validated
umi GCGCTGACAG = 145 reads: +400 validated
umi GTGTCAGACT = 162 reads: -83X +317 invalidated
umi TACATGCGCC = 84 reads: +400 validated
umi TATTACAGCG = 138 reads: -365X +3 -1XX +6 -2XX +6 -5XX +7 -1XX +4 invalidated
umi TGTACTACAC = 191 reads: +400 validated
umi TGTTACAGTG = 171 reads: +400 validated
umi TGTTTCTCCC = 183 reads: +400 validated
umi TTCTTTTCCT = 91 reads: +400 validated
umi TTTACAGTCA = 173 reads: +400 validated

UMI info for barcode CGTCACTCAGCCAGAA-1 contig 2 = ATCACATAAC...
umi ACACTACGTT = 168 reads: +415 validated
umi ATAACATGCG = 31 reads: +298 -10 +58 -1 +1 -22 +25 non-validated
umi CCAGGATTTA = 118 reads: +367 -1 +10 -37 non-validated
umi CCTGTCGGGA = 260 reads: -341X +1 -2X +1 -4XX +4 -1XX +1 -9XX +1 -1XX +1 -5XX +43 invalidated
umi GCACCTCGGT = 142 reads: +378 -1 +36 non-validated
umi GCGGTCGGTC = 144 reads: +415 validated
umi GTCCTGCACC = 162 reads: +415 validated
umi GTGCGCTACA = 182 reads: +415 validated
umi TATGATACTA = 98 reads: +415 validated
umi TTCAAGCGCT = 87 reads: +347 -2X +1 -1 +2 -1X +1 -2X +7 -2 +1 -1 +1 -1 +1 -1 +3 -2 +3 -1 +4 -5X +4 -1 +2 -1 +6 -11 invalidated
umi TTGTCATCAT = 153 reads: +415 validated
umi TTTATACGAG = 156 reads: +393 -1 +6 -15 non-validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=0)
393-430 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 21 umis using 421 reads
cdr3 = CQQYYSTPPTF at 369, score = 9 + 8
umis assigned: [49, 58, 59, 73, 85, 92, 139, 143, 147, 151] and 13 others
of which 23 are surviving nonsolos
reads assigned: 3294
start codons at 30, 99, 352, 472
confident = true

TIG 2[bases=575]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=3)
425-473 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
473-575 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 7 umis using 78 reads
cdr3 = CARGPGVGARFDYW at 400, score = 9 + 7
umis assigned: [16, 33, 112, 150, 258, 279, 319, 327, 380, 472] and 2 others
of which 12 are surviving nonsolos
reads assigned: 1674
start codons at 58, 209, 256, 355, 491, 552
confident = true

REJECT CONTIGS

TIG 1[bases=309]
12-37 ==> 4932-4957 on rc of segment before IGLL1 exon 1 [len=6445] (mis=0)
60-98 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
96-144 ==> 6397-6445 on rc of segment before IGLL1 exon 1 [len=6445] (mis=4)
98-309 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
umis assigned: [93, 350]
of which 2 are surviving nonsolos
reads assigned: 1090
start codons at 62, 230
confident = false
did not find CDR3

TIG 2[bases=734]
3-86 ==> 3251-3334 on rc of segment before IGKV2-24 exon 2 [len=3774] (mis=5)
3-86 ==> 3248-3331 on segment before IGKV2D-23 exon 1 [len=3772] (mis=5)
36-396 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=39)
399-436 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
436-716 ==> 0-280 on rc of segment before IGKJ4 exon 1 [len=280] (mis=0)
cdr3 = CMQATQFPPLTF at 372, score = 9 + 9
umis assigned: [41, 80, 128, 339, 439, 475, 490]
of which 7 are surviving nonsolos
reads assigned: 722
start codons at 69, 105, 193, 355, 375, 453, 552
confident = false
not full
VJ delta = 13
not full
now this is a cell
paired!

AGATCTGAGGACACGGCCGTGTATTACTGTGCGCGGGGGCCAGGGGTGGGAGCTAGATTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCTCCCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1942 = CGTCACTCAGCGATCC-1

using 8737 reads

====================================================================================

graph has 7697 edges initially, 128 edges after simplification

total ucounts = 1484
nonsolo ucounts = 1120[2^197, 3^144, 4^114, 5^115, 6^107, 7^80, 8^80, 9^58, 10^48, 11^39, 12^36, 13^27, 14^22, 15^19, 16^6, 17^5, 18^4, 19, 20, 21^2, 22, 28, 31, 42, 67, 81, 88, 98, 115, 143, 149, 154, 169^2, 176]
surviving nonsolo ucounts = 10[18, 88, 98, 115, 143, 149, 154, 169^2, 176]
ids = [962, 917, 911, 240, 838, 1358, 775, 423, 760, 200]

====================================================================================

UMI info for barcode CGTCACTCAGCGATCC-1 contig 1 = GAGTCAGTCC...
umi ACTACTGTCG = 176 reads: +394 validated
umi AGATGACGGT = 113 reads: +362 -3 +29 non-validated
umi CACACTAGCA = 168 reads: +394 validated
umi GAGCGGTCTT = 171 reads: +394 validated
umi GAGTTTCCGT = 153 reads: +394 validated
umi GCCTCATTGC = 145 reads: -8 +386 non-validated
umi GGTTACTTTA = 98 reads: +394 validated
umi GGTTTCTTCA = 88 reads: +394 validated
umi GTCGTGTATC = 20 reads: -2 +296 -24 +72 non-validated
umi TTAGGCGCAC = 149 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=555]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
381-419 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 8 umis using 190 reads
cdr3 = CQQYDNLPPLFTF at 352, score = 9 + 8
umis assigned: [200, 240, 423, 760, 775, 838, 911, 917, 962, 1358]
of which 10 are surviving nonsolos
reads assigned: 1264
start codons at 25, 31, 87, 100, 239, 362, 461
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1944 = CGTCACTCAGCTATTG-1

using 381 reads

====================================================================================

graph has 102 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 25, 351]
surviving nonsolo ucounts = 2[25, 351]
ids = [4, 3]

====================================================================================

UMI info for barcode CGTCACTCAGCTATTG-1 contig 1 = GGGACTGATC...
umi GGTCTCCTCG = 334 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=501]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=2)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=2)
395-433 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
433-501 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CMQALQTRETF at 372, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 332
start codons at 36, 69, 105, 193, 355, 375, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1948 = CGTCACTCAGGAATCG-1

using 423 reads

====================================================================================

graph has 120 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[98, 137, 185]
surviving nonsolo ucounts = 3[98, 137, 185]
ids = [2, 3, 1]

====================================================================================

UMI info for barcode CGTCACTCAGGAATCG-1 contig 1 = GGGGGGTCTC...
umi GGTAGTACTC = 135 reads: +388 validated

UMI info for barcode CGTCACTCAGGAATCG-1 contig 2 = GTCAGACTCA...
umi CAGTGATGGA = 174 reads: +391 validated
umi CTCCTGTTCG = 91 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=547]
40-401 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
390-428 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
428-547 ==> 0-119 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CSSYTSSSTLVF at 364, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 134
start codons at 40, 197, 241, 248, 251
confident = true

TIG 2[bases=474]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=9)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
414-474 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 41 reads
cdr3 = CQQYNNYSPYTF at 350, score = 8 + 8
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 261
start codons at 23, 29, 85, 98, 234, 237, 330, 456
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1955 = CGTCACTCATATACGC-1

using 162 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 4, 155]
surviving nonsolo ucounts = 1[155]
ids = [2]

====================================================================================

UMI info for barcode CGTCACTCATATACGC-1 contig 1 = GGCTGGGGTC...
umi TATCGTCGCT = 150 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=538]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-386 ==> 0-344 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=20)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
430-538 ==> 0-108 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CCSHAGSYIWVF at 366, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 149
start codons at 42, 178, 181, 199, 253, 349, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1960 = CGTCACTCATGTTGAC-1

using 765 reads

====================================================================================

graph has 1140 edges initially, 10 edges after simplification

total ucounts = 408
nonsolo ucounts = 157[2^85, 3^25, 4^21, 5^10, 6^4, 7^2, 8^6, 9^2, 10, 21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1966 = CGTCACTCATTTGCCC-1

using 217 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[215]
surviving nonsolo ucounts = 1[215]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1971 = CGTCACTGTAAGTAGT-1

using 1453 reads

====================================================================================

graph has 2085 edges initially, 28 edges after simplification

total ucounts = 778
nonsolo ucounts = 320[2^163, 3^70, 4^35, 5^26, 6^8, 7^7, 8^8, 9^2, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1973 = CGTCACTGTACGAAAT-1

using 150 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 144]
surviving nonsolo ucounts = 1[144]
ids = [3]

====================================================================================

UMI info for barcode CGTCACTGTACGAAAT-1 contig 1 = GGGTCTCAGG...
umi TGGGGTCATT = 138 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=464]
0-37 ==> 126-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
37-391 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
425-464 ==> 0-39 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CSSHAGSTRVLF at 361, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 137
start codons at 37, 194, 245, 344, 371
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1981 = CGTCACTGTATTCTCT-1

using 246 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 5^2, 230]
surviving nonsolo ucounts = 1[230]
ids = [4]

====================================================================================

UMI info for barcode CGTCACTGTATTCTCT-1 contig 1 = AGAGCTCTGG...
umi TACAACCCGA = 211 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=456]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
394-432 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
432-456 ==> 0-24 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQYGSSPRITF at 368, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 44, 252, 378
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1986 = CGTCACTGTCGAATCT-1

using 415 reads

====================================================================================

graph has 510 edges initially, 10 edges after simplification

total ucounts = 231
nonsolo ucounts = 76[2^34, 3^15, 4^11, 5^7, 6^4, 7^3, 8, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.1999 = CGTCACTGTGTCAATC-1

using 619 reads

====================================================================================

graph has 178 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 4, 182, 213, 214]
surviving nonsolo ucounts = 3[182, 213, 214]
ids = [8, 2, 3]

====================================================================================

UMI info for barcode CGTCACTGTGTCAATC-1 contig 1 = GGGGATCAGT...
umi ATAATGCTAC = 209 reads: +388 validated
umi CTCGTTTAGT = 213 reads: +388 validated
umi TTCGCACACC = 184 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 93 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [2, 3, 8]
of which 3 are surviving nonsolos
reads assigned: 599
start codons at 27, 33, 102, 238, 457
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2004 = CGTCACTGTTATCGGT-1

using 8276 reads

====================================================================================

graph has 4106 edges initially, 52 edges after simplification

total ucounts = 812
nonsolo ucounts = 349[2^151, 3^58, 4^37, 5^20, 6^17, 7^8, 8^6, 9^2, 10, 11^4, 13^3, 14, 16^2, 22, 27, 54, 70, 101, 118, 125, 127^2, 129, 132, 133, 134, 138, 139, 141^2, 142, 144, 152, 158, 168, 170, 171, 172, 176, 184, 189, 196^2, 201, 213, 223, 259, 262, 316, 344, 351, 481]
surviving nonsolo ucounts = 35[54, 70, 101, 118, 125, 127^2, 129, 132, 134, 138, 139, 141^2, 142, 144, 152, 158, 168, 170, 172, 176, 184, 189, 196^2, 201, 213, 223, 259, 262, 316, 344, 351, 481]
ids = [573, 524, 209, 577, 472, 99, 232, 76, 622, 135, ...]

====================================================================================

UMI info for barcode CGTCACTGTTATCGGT-1 contig 1 = AGCTTCAGCT...
umi AAAGACTGGC = 144 reads: +388 validated
umi ACCCTCCCTC = 128 reads: +365 -1 +22 non-validated
umi ACGGGTTCAC = 265 reads: +388 validated
umi ACTCCGGCTT = 127 reads: +388 validated
umi AGCGGGTCCT = 180 reads: +388 validated
umi AGGGTAGTTC = 140 reads: +388 validated
umi AGTTAAATAA = 191 reads: +388 validated
umi AGTTAAATGA = 147 reads: +380 -1X +7 invalidated
umi ATACCTCGTT = 169 reads: +388 validated
umi ATCGTTTCAC = 152 reads: +388 validated
umi ATCTTGTCAG = 167 reads: +388 validated
umi ATTGTTTTGT = 138 reads: +383 -1 +4 non-validated
umi CAAATCCTCC = 101 reads: +388 validated
umi CACCTTTCAC = 323 reads: -346X +1 -6X +3 -1XX +31 invalidated
umi CATTTTTAGG = 183 reads: +388 validated
umi CCTGTTCGCT = 137 reads: +388 validated
umi CGTCGCGCTT = 85 reads: +6 -1XX +1 -1XX +1 -2XX +14 -1XX +6 -1XX +7 -2XX +28 -1XX +5 -1XX +7 -1XX +7 -1XX +4 -1XX +20 -1XX +2 -3XX +3 -1XX +17 -6XX +1 -30X +1 -2XX +17 -1XX +1 -1XX +1 -1XX +4 -1XX +2 -2XX +1 -1XX +26 -1XX +10 -1XX +29 -1XX +10 -1XX +25 -5XX +1 -4X +1 -3X +3 -1X +4 -1X +2 -28X +1 -1X +9 -1X invalidated
umi CTCTTAGTCC = 213 reads: +388 validated
umi GACGCGGGCT = 353 reads: +388 validated
umi GATCTATTAC = 107 reads: +6 -1XX +1 -1XX +1 -1XX +7 -1XX +11 -1XX +52 -1XX +1 -1XX +5 -3XX +5 -1XX +19 -1XX +28 -1XX +4 -1XX +15 -1XX +8 -40X +2 -1X +13 -1XX +16 -1XX +94 -1XX +2 -4XX +3 -1XX +31 invalidated
umi GATGCTAACT = 123 reads: +388 validated
umi GTGGACTATC = 52 reads: +388 validated
umi TAGACCCGGC = 147 reads: +161 -3XX +2 -1 +221 invalidated
umi TCCATGCCCC = 197 reads: +388 validated
umi TCCGCTCCGC = 162 reads: +388 validated
umi TTCGAAGTCT = 137 reads: +388 validated

UMI info for barcode CGTCACTGTTATCGGT-1 contig 2 = GAGAGCATCA...
umi AGGGCGATGG = 135 reads: +436 validated
umi AGTCAACGGA = 247 reads: +419 -17 non-validated
umi CACCCAAGCC = 188 reads: +436 validated
umi CACTGTTTGG = 125 reads: +384 -52 non-validated
umi CTTATTTCAT = 170 reads: +436 validated
umi GGCTTCTGCG = 71 reads: +436 validated
umi GTGTACCCCT = 114 reads: +436 validated
umi TGAACTGGTT = 190 reads: +436 validated
umi TTATTCGCAA = 221 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=4)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 22 umis using 507 reads
cdr3 = CAAWDDSLNVVVF at 368, score = 8 + 8
umis assigned: [7, 76, 88, 99, 125, 136, 147, 148, 153, 176] and 16 others
of which 24 are surviving nonsolos
reads assigned: 4183
start codons at 47, 351, 376, 381, 393
confident = true

TIG 2[bases=571]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=1)
415-436 ==> 0-21 on |32|IGHD6-13|D-REGION| [len=21] (mis=2)
437-500 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
500-571 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 75 reads
cdr3 = CARGHSSSWYSYYYYYGMDVW at 406, score = 8 + 7
umis assigned: [135, 141, 227, 232, 425, 524, 577, 708, 762]
of which 9 are surviving nonsolos
reads assigned: 1436
start codons at 64, 220, 262, 267, 299, 328, 361, 457
confident = true

REJECT CONTIGS

TIG 1[bases=318]
1-172 ==> 939-1110 on rc of segment before IGHD3-16 exon 1 [len=1110] (mis=0)
196-247 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=0)
247-318 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [240]
of which 1 are surviving nonsolos
reads assigned: 337
start codons at 23, 82
confident = false
did not find CDR3
now this is a cell
paired!

TATTACTGTGCGAGAGGACATAGCAGCAGCTGGTACTCTTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> GGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAATGTCGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2005 = CGTCACTGTTCACGGC-1

using 150 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 143]
surviving nonsolo ucounts = 1[143]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2007 = CGTCACTGTTCGGCAC-1

using 102 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 96]
surviving nonsolo ucounts = 1[96]
ids = [3]

====================================================================================

UMI info for barcode CGTCACTGTTCGGCAC-1 contig 1 = GGAGAAGAGC...
umi TCCTTAATCA = 91 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=466]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
383-421 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
421-466 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CQQYGSSPFTF at 360, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 91
start codons at 36, 244, 370, 412
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2010 = CGTCACTGTTTAAGCC-1

using 256 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 253]
surviving nonsolo ucounts = 1[253]
ids = [0]

====================================================================================

UMI info for barcode CGTCACTGTTTAAGCC-1 contig 1 = GGTCAGAGCT...
umi AAACTAACAG = 252 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=569]
0-48 ==> 4-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
48-396 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
395-433 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
433-569 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQYGMPPSTF at 372, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 48, 190, 256, 382, 387, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2011 = CGTCACTGTTTGACTG-1

using 960 reads

====================================================================================

graph has 292 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 953]
surviving nonsolo ucounts = 1[953]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=341]
28-171 ==> 217-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
167-205 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
205-341 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQALQTWTF at 147, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 943
start codons at 130, 150, 247
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2016 = CGTCACTTCAGAGCTT-1

using 279 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[3^2, 6, 266]
surviving nonsolo ucounts = 1[266]
ids = [2]

====================================================================================

UMI info for barcode CGTCACTTCAGAGCTT-1 contig 1 = GTCAGACCCA...
umi CGCTAGGTTA = 271 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=553]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQHYNSFFLRYIF at 350, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 23, 29, 85, 98, 234, 330, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2017 = CGTCACTTCAGCAACT-1

using 179 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[177]
surviving nonsolo ucounts = 1[177]
ids = [1]

====================================================================================

UMI info for barcode CGTCACTTCAGCAACT-1 contig 1 = CTGGGCCTCA...
umi TCTCAAGGAT = 171 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=528]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-383 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=11)
381-419 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
419-528 ==> 0-109 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQAWDSSTASYVF at 352, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 168
start codons at 37, 42, 98, 185, 331, 335, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2026 = CGTCACTTCCACGTTC-1

using 223 reads

====================================================================================

graph has 106 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 7[2^3, 3, 5, 33, 174]
surviving nonsolo ucounts = 1[174]
ids = [1]

====================================================================================

UMI info for barcode CGTCACTTCCACGTTC-1 contig 1 = GAATCAGTCC...
umi ATTACGCCAT = 165 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=466]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-466 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 161
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2031 = CGTCACTTCCGCGGTA-1

using 157 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 22, 127]
surviving nonsolo ucounts = 1[127]
ids = [8]

====================================================================================

REJECT CONTIGS

TIG 1[bases=437]
0-349 ==> 7-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
349-387 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
387-437 ==> 0-50 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 317, score = 7 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 117
start codons at 147, 150, 201, 300, 327, 351
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2035 = CGTCACTTCGACAGCC-1

using 224 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 3[5^2, 205]
surviving nonsolo ucounts = 1[205]
ids = [4]

====================================================================================

UMI info for barcode CGTCACTTCGACAGCC-1 contig 1 = GTGGGCTCAG...
umi CACAAACGCA = 2 reads: -339 +1 -4X +5 -1 +4 -1 +2 -1 +4 -1 +1 -3X +2 -4 +1 -2 +1 -2 +3 invalidated
umi CACTTACGCA = 193 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=579]
0-36 ==> 4-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
36-373 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=3)
380-418 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
418-579 ==> 0-161 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CNSRDRSDTQWVF at 351, score = 8 + 8
umis assigned: [3, 4]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 36, 155, 184, 235, 261, 334
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2042 = CGTCACTTCTGGGCCA-1

using 34 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[34]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2050 = CGTCAGGAGAAGATTC-1

using 186 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 178]
surviving nonsolo ucounts = 1[178]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=499]
0-74 ==> 5666-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
411-499 ==> 0-88 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQSNNYPWTF at 350, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 23, 29, 85, 98, 255, 330, 453
confident = false
not full
full length stopped transcript of length 499
frameshifted full length stopped transcript of length 499
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2056 = CGTCAGGAGAGGGATA-1

using 276 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[271]
surviving nonsolo ucounts = 1[271]
ids = [2]

====================================================================================

UMI info for barcode CGTCAGGAGAGGGATA-1 contig 1 = TCAGTTAGGA...
umi CCCGTTACTA = 273 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=544]
0-23 ==> 24-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
23-368 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQRSNWRGVTF at 344, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 23, 228, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2063 = CGTCAGGAGCAACGGT-1

using 869 reads

====================================================================================

graph has 310 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2^2, 5, 17, 159, 238, 443]
surviving nonsolo ucounts = 3[159, 238, 443]
ids = [5, 0, 9]

====================================================================================

UMI info for barcode CGTCAGGAGCAACGGT-1 contig 1 = GGGGCAAACA...
umi CTGTAGGGAC = 161 reads: +388 validated
umi TCCCTGCCGG = 437 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=641]
42-394 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=22)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
430-641 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 99 reads
cdr3 = CSSWDSSLSAWVF at 363, score = 7 + 8
umis assigned: [5, 9]
of which 2 are surviving nonsolos
reads assigned: 592
start codons at 42, 181, 253, 371
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2066 = CGTCAGGAGCCTCGTG-1

using 71 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2^4, 3, 4, 5, 47]
surviving nonsolo ucounts = 1[47]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2068 = CGTCAGGAGCGCTCCA-1

using 705 reads

====================================================================================

graph has 206 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[705]
surviving nonsolo ucounts = 1[705]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2070 = CGTCAGGAGCTTCGCG-1

using 2343 reads

====================================================================================

graph has 1648 edges initially, 34 edges after simplification

total ucounts = 430
nonsolo ucounts = 159[2^57, 3^32, 4^25, 5^7, 6^9, 7^5, 8^4, 9^5, 10^2, 11, 12, 13, 18, 19, 39, 153, 158, 189, 222, 229, 238, 240]
surviving nonsolo ucounts = 8[39, 153, 158, 189, 222, 229, 238, 240]
ids = [133, 192, 43, 291, 163, 38, 276, 375]

====================================================================================

UMI info for barcode CGTCAGGAGCTTCGCG-1 contig 1 = CTGCTCAGTT...
umi TCCCGCTTGT = 236 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=548]
0-27 ==> 70-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
27-372 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=7)
373-412 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYSNWPLYTF at 348, score = 9 + 8
umis assigned: [375]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 27, 232, 454
confident = true

REJECT CONTIGS

TIG 1[bases=570]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=12)
396-434 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
434-570 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [38, 133, 163, 192, 276]
of which 5 are surviving nonsolos
reads assigned: 872
start codons at 30, 99, 352, 476
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2071 = CGTCAGGAGGAACTGC-1

using 226 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[225]
surviving nonsolo ucounts = 1[225]
ids = [1]

====================================================================================

UMI info for barcode CGTCAGGAGGAACTGC-1 contig 1 = GGAGGAACTG...
umi TCAGTTAGGA = 232 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=549]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=2)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYNNWLTF at 355, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 34, 103, 239, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2072 = CGTCAGGAGGACACCA-1

using 168 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 3, 163]
surviving nonsolo ucounts = 1[163]
ids = [0]

====================================================================================

UMI info for barcode CGTCAGGAGGACACCA-1 contig 1 = ACCCAAAAAC...
umi CTACTTGTCT = 148 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=504]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 146
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2076 = CGTCAGGAGGCGACAT-1

using 99 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 28
nonsolo ucounts = 16[2^2, 3, 4^4, 5^4, 6^2, 10^2, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2078 = CGTCAGGAGGGAGTAA-1

using 11384 reads

====================================================================================

graph has 3290 edges initially, 22 edges after simplification

total ucounts = 256
nonsolo ucounts = 123[2^36, 3^15, 4^7, 5^2, 6^3, 7, 11^2, 12, 18, 22, 27, 41, 55, 72, 101, 107, 110, 116, 123^2, 153, 155, 156, 160, 163, 164, 170, 172, 173^2, 179, 181, 185^2, 189, 190, 194, 202, 205, 219, 224, 226, 227, 232^2, 234, 236^2, 238, 240, 241, 242, 243, 248, 249, 251, 255, 257, 269, 280, 288, 305, 528, 573]
surviving nonsolo ucounts = 51[72, 101, 107, 110, 116, 123^2, 153, 155, 156, 160, 163, 164, 170, 172, 173^2, 179, 181, 185^2, 189, 190, 194, 202, 205, 219, 224, 226, 227, 232^2, 234, 236^2, 238, 240, 241, 242, 243, 248, 249, 251, 255, 257, 269, 280, 288, 305, 528, 573]
ids = [37, 241, 97, 152, 237, 154, 194, 106, 93, 4, ...]

====================================================================================

UMI info for barcode CGTCAGGAGGGAGTAA-1 contig 1 = TGGGGAGGAA...
umi AACATATTCA = 160 reads: +379 validated
umi AATCATCCTC = 197 reads: +379 validated
umi ACATATAGGC = 246 reads: +379 validated
umi ACCTACAAGC = 213 reads: +379 validated
umi ACGGAAAGCC = 187 reads: +379 validated
umi ACTCAAATCA = 178 reads: +379 validated
umi ACTCTATTCT = 527 reads: +379 validated
umi AGCTATCAAT = 183 reads: +379 validated
umi AGGAGCCCGT = 304 reads: +379 validated
umi ATTACTCTCT = 185 reads: +379 validated
umi ATTATGCCTT = 237 reads: +379 validated
umi ATTCGTTAGT = 220 reads: +379 validated
umi ATTGACTTGG = 188 reads: +379 validated
umi CAATTTCCGT = 242 reads: +23 -1XX +355 invalidated
umi CATATCTTAG = 189 reads: +379 validated
umi CCCGTTCGCT = 105 reads: +379 validated
umi CCTAGCGCGT = 156 reads: +379 validated
umi CGAGTATCGT = 191 reads: +379 validated
umi CGCTTGTTAT = 252 reads: +379 validated
umi CTATAGTTCT = 242 reads: +379 validated
umi CTGACTGATC = 238 reads: +379 validated
umi CTGATCCCCG = 229 reads: +379 validated
umi GATGCCAATA = 108 reads: +379 validated
umi GCACTAGGAG = 124 reads: +379 validated
umi GCCTTGTAGC = 170 reads: +379 validated
umi GGGTACCTCG = 242 reads: +379 validated
umi GTCCAGCAAC = 243 reads: +379 validated
umi GTGCACTCGC = 287 reads: +379 validated
umi GTTCGAGGCT = 236 reads: +379 validated
umi TACAAACACC = 261 reads: +379 validated
umi TATAAGCACA = 232 reads: +379 validated
umi TATATATCCA = 248 reads: +379 validated
umi TATTTCTGAT = 270 reads: +379 validated
umi TCGATACCAC = 259 reads: +379 validated
umi TCGTCATCGT = 238 reads: +379 validated
umi TCTGACGCCG = 238 reads: +379 validated
umi TGGGCTCGCG = 230 reads: +379 validated
umi TGGGTCGGTT = 114 reads: +379 validated
umi TGGTACGGTG = 163 reads: +379 validated
umi TTTCCTCTTT = 281 reads: +379 validated

UMI info for barcode CGTCAGGAGGGAGTAA-1 contig 2 = AGCTCTGGGA...
umi ACTTCTGAAG = 72 reads: +390 -10 +30 non-validated
umi AGGAATAGCA = 221 reads: +430 validated
umi CACATTCAGA = 157 reads: +420 -10 non-validated
umi CCATAACGTC = 139 reads: +386 -2 +1 -1 +5 -1 +1 -1 +2 -1 +4 -1 +2 -22 non-validated
umi CCGCCATTAC = 175 reads: +410 -1 +5 -1 +1 -12 non-validated
umi CTGAGTATTC = 180 reads: +430 validated
umi CTGTGAATTC = 174 reads: +430 validated
umi GCAGAAATCG = 155 reads: +428 -2 non-validated
umi TAAATCTGTA = 126 reads: +430 validated
umi TTCGTCCCGG = 108 reads: +206 -8XX +1 -2XX +165 -48 invalidated

GOOD CONTIGS

TIG 1[bases=552]
0-37 ==> 60-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
37-382 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=2)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 40 umis using 1428 reads
cdr3 = CQQYNNWLTF at 358, score = 9 + 9
umis assigned: [4, 17, 21, 26, 29, 32, 34, 39, 42, 64] and 30 others
of which 40 are surviving nonsolos
reads assigned: 8679
start codons at 37, 106, 242, 458
confident = true

TIG 2[bases=581]
0-80 ==> 40-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=0)
80-433 ==> 0-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=10)
436-454 ==> 13-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=0)
457-510 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=2)
510-581 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 3 umis using 25 reads
cdr3 = CARPEVVAATPKDWYFDLW at 422, score = 9 + 7
umis assigned: [37, 41, 76, 93, 102, 140, 144, 156, 194, 241]
of which 10 are surviving nonsolos
reads assigned: 1470
start codons at 80, 236, 383
confident = true
now this is a cell
paired!

GCCGTGTATTACTGTGCGAGGCCCGAGGTGGTAGCTGCTACTCCGAAGGACTGGTACTTCGATCTCTGGGGCCGTGGCACCCTGGTCACTGTCTCCTCAG <==> ACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2091 = CGTCAGGAGTTCGCAT-1

using 242 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[4, 232]
surviving nonsolo ucounts = 1[232]
ids = [7]

====================================================================================

UMI info for barcode CGTCAGGAGTTCGCAT-1 contig 1 = AGTCTGGGCC...
umi TGTGATGGTT = 223 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=563]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-372 ==> 0-332 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=36)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
422-563 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQVWDRSRDHVVF at 355, score = 6 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 40, 89, 101, 124, 338, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2095 = CGTCAGGCAACACCTA-1

using 6548 reads

====================================================================================

graph has 3368 edges initially, 32 edges after simplification

total ucounts = 433
nonsolo ucounts = 173[2^73, 3^26, 4^14, 5^10, 6^5, 7^5, 8^3, 9, 11, 12, 14^2, 15, 17, 50, 57, 74, 84, 105, 108, 111, 116, 129, 136, 147, 150, 155, 159, 169, 173, 176, 177, 190, 197, 208, 210, 217, 224, 229, 258, 290, 306, 480, 692]
surviving nonsolo ucounts = 28[57, 74, 105, 108, 111, 116, 129, 136, 147, 150, 155, 159, 169, 173, 176, 177, 190, 197, 208, 210, 217, 224, 229, 258, 290, 306, 480, 692]
ids = [34, 324, 98, 425, 200, 416, 189, 431, 9, 179, ...]

====================================================================================

UMI info for barcode CGTCAGGCAACACCTA-1 contig 1 = AGCTCTGGGA...
umi AACGCCACTA = 144 reads: +430 validated
umi ACAATCAGCA = 59 reads: +401 -29 non-validated
umi ACCCCCAAGC = 303 reads: -276X +154 invalidated
umi AGGCGAGGGT = 162 reads: +420 -10 non-validated
umi ATAGTGTGGG = 231 reads: +430 validated
umi ATCTGTTTTC = 104 reads: +430 validated
umi CAAAATCGAA = 172 reads: +430 validated
umi CCAATGTCTC = 242 reads: +428 -2 non-validated
umi CCTTAGTACT = 135 reads: +413 -17 non-validated
umi CGATATGCGG = 130 reads: +405 -1 +6 -18 non-validated
umi CGCTTCACTA = 117 reads: +430 validated
umi CTATACTCTT = 174 reads: +430 validated
umi CTTCAAGCTC = 199 reads: +430 validated
umi GCCTTTAAAG = 193 reads: +402 -1 +2 -2 +1 -1 +6 -1 +3 -1 +2 -1X +1 -6X invalidated
umi GCGCGCAATC = 22 reads: +46 -4XX +1 -6XX +1 -4XX +1 -1XX +1 -2XX +2 -1XX +1 -359XX invalidated
umi GGAATCTATC = 157 reads: +430 validated
umi GTTACTTCGC = 67 reads: +374 -1 +1 -2 +28 -1 +6 -1 +5 -1 +9 -1 non-validated
umi TCCAGGTCTA = 171 reads: +47 -7XX +1 -2X +1 -8X +2 -337X +1 -6X +1 -1X +2 -2X +1 -2X +1 -1X +1 -4X +2 invalidated
umi TTTCTACATC = 115 reads: +430 validated
umi TTTGTTCCGT = 162 reads: +415 -1 +14 non-validated
umi TTTTTATATC = 108 reads: +332 -2 +96 non-validated
umi TTTTTTTTGA = 133 reads: +361 -1 +68 non-validated

UMI info for barcode CGTCAGGCAACACCTA-1 contig 2 = GGGGAGTCAG...
umi ATGCGTCTCC = 208 reads: +391 validated
umi CCGTACATCA = 483 reads: +391 validated
umi CCGTTTCTCT = 211 reads: +391 validated
umi CTTTGAACAA = 237 reads: +188 -1XX +202 invalidated
umi GCGATAATAG = 226 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=581]
0-80 ==> 0-80 on |166|IGHV3-73|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |167|IGHV3-73|L-REGION+V-REGION| [len=359] (mis=1)
433-464 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=9)
460-510 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
510-581 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 13 umis using 158 reads
cdr3 = CTRQCSGGSCDDAFDIW at 428, score = 8 + 8
umis assigned: [9, 34, 42, 71, 89, 98, 109, 140, 179, 189] and 12 others
of which 22 are surviving nonsolos
reads assigned: 3229
start codons at 80, 236, 321, 360, 389, 439, 459, 462, 491
confident = true

TIG 2[bases=555]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=4)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 5 umis using 236 reads
cdr3 = CQQSYSTLGLTF at 355, score = 9 + 9
umis assigned: [102, 161, 164, 248, 281]
of which 5 are surviving nonsolos
reads assigned: 1319
start codons at 28, 34, 90, 103, 239, 461
confident = true
now this is a cell
paired!

GACACGGCCGTGTATTACTGTACTAGACAATGTAGTGGTGGTAGCTGCGATGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> AGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCTCGGTCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2105 = CGTCAGGCACACAGAG-1

using 35 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[34]
surviving nonsolo ucounts = 1[34]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2107 = CGTCAGGCACGAGAGT-1

using 200 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[4, 5, 9, 180]
surviving nonsolo ucounts = 1[180]
ids = [5]

====================================================================================

UMI info for barcode CGTCAGGCACGAGAGT-1 contig 1 = GGGAGATTCC...
umi TACGCAAGCC = 174 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=539]
56-373 ==> 0-317 on |138|IGHV3-43|L-REGION+V-REGION| [len=354] (mis=41)
441-504 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=5)
504-539 ==> 0-35 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CAKTLRPFYIYTSGYEDYYSGMDVW at 398, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 173
start codons at 56, 201, 207, 212, 273, 291, 359, 441, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2110 = CGTCAGGCACGGATAG-1

using 447 reads

====================================================================================

graph has 152 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[4, 10, 208, 223]
surviving nonsolo ucounts = 2[208, 223]
ids = [0, 5]

====================================================================================

UMI info for barcode CGTCAGGCACGGATAG-1 contig 1 = AGAGCTGCTC...
umi AGAGAAGGGC = 195 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=474]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
416-474 ==> 0-58 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQYGSSPRTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 31, 239, 365, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2112 = CGTCAGGCACGTGAGA-1

using 196 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 193]
surviving nonsolo ucounts = 1[193]
ids = [1]

====================================================================================

UMI info for barcode CGTCAGGCACGTGAGA-1 contig 1 = GGAGGAACTG...
umi CGAACTGCGA = 191 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=7)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQRRTWPPAF at 355, score = 9 + 6
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 34, 83, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2120 = CGTCAGGCAGGCGATA-1

using 184 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[184]
surviving nonsolo ucounts = 1[184]
ids = [0]

====================================================================================

UMI info for barcode CGTCAGGCAGGCGATA-1 contig 1 = CTGGGCCTCA...
umi TGCGTGCTTG = 176 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=548]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-371 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
413-548 ==> 0-135 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQAWDSTEVVF at 352, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 175
start codons at 37, 42, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2133 = CGTCAGGGTACGAAAT-1

using 208 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 5, 197]
surviving nonsolo ucounts = 1[197]
ids = [2]

====================================================================================

UMI info for barcode CGTCAGGGTACGAAAT-1 contig 1 = GGGGAGCTCT...
umi GCCGCGTTCA = 188 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=508]
55-415 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=10)
417-455 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
455-508 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CMQGSHWPPWTF at 391, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 55, 88, 116, 124, 212, 374, 394, 497
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2135 = CGTCAGGGTACTTAGC-1

using 642 reads

====================================================================================

graph has 355 edges initially, 4 edges after simplification

total ucounts = 21
nonsolo ucounts = 9[2^3, 3, 8, 10^2, 290, 303]
surviving nonsolo ucounts = 2[290, 303]
ids = [6, 14]

====================================================================================

UMI info for barcode CGTCAGGGTACTTAGC-1 contig 1 = ACTTGGTGAT...
umi GGTCACGTCC = 258 reads: +448 validated

UMI info for barcode CGTCAGGGTACTTAGC-1 contig 2 = GTCAGACCCT...
umi CCAAGAGTCT = 290 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=485]
0-35 ==> 44-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
35-388 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=9)
399-426 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=4)
422-483 ==> 0-61 on |58|IGHJ6|J-REGION| [len=61] (mis=5)
junction support: 1 umis using 14 reads
cdr3 = CARVGRARITMVRGVPNYYYYMDVW at 377, score = 9 + 7
umis assigned: [14]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 35, 191, 312, 338, 407, 440
confident = false

TIG 2[bases=547]
0-29 ==> 24-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
29-374 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=0)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYYSYPRTF at 350, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 287
start codons at 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2144 = CGTCAGGGTCAGTGGA-1

using 317 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 313]
surviving nonsolo ucounts = 1[313]
ids = [2]

====================================================================================

UMI info for barcode CGTCAGGGTCAGTGGA-1 contig 1 = AGGAGTCAGT...
umi GACTCACCAA = 315 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=5)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYDNLPFTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 27, 33, 89, 102, 241, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2151 = CGTCAGGGTCTCTCTG-1

using 11 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2152 = CGTCAGGGTCTGATCA-1

using 245 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^2, 5, 6, 14, 212]
surviving nonsolo ucounts = 1[212]
ids = [7]

====================================================================================

UMI info for barcode CGTCAGGGTCTGATCA-1 contig 1 = AGCTTCAGCT...
umi TAGATACGCC = 201 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=520]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-520 ==> 0-85 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 24 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 47, 201, 351, 376, 381, 501
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2153 = CGTCAGGGTGCAACTT-1

using 254 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[7, 242]
surviving nonsolo ucounts = 1[242]
ids = [4]

====================================================================================

UMI info for barcode CGTCAGGGTGCAACTT-1 contig 1 = ATCACATAAC...
umi TGCCGGATCG = 238 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=556]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=5)
434-485 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=0)
485-556 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CALRGRIAAADDNWFDPW at 400, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 58, 209, 256, 355
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2177 = CGTCAGGTCCAAGCCG-1

using 131 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[130]
surviving nonsolo ucounts = 1[130]
ids = [1]

====================================================================================

UMI info for barcode CGTCAGGTCCAAGCCG-1 contig 1 = GGGGAGGAAC...
umi TGCGTGTGTC = 122 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=478]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-478 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CQQRSNWPLTF at 357, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 121
start codons at 36, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2178 = CGTCAGGTCCACGAAT-1

using 172 reads

====================================================================================

graph has 194 edges initially, 4 edges after simplification

total ucounts = 36
nonsolo ucounts = 27[2^8, 3^3, 4, 5^4, 6^2, 7, 8, 9^2, 11, 14^2, 15^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2179 = CGTCAGGTCCCATTTA-1

using 445 reads

====================================================================================

graph has 208 edges initially, 44 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 195, 248]
surviving nonsolo ucounts = 2[195, 248]
ids = [0, 2]

====================================================================================

UMI info for barcode CGTCAGGTCCCATTTA-1 contig 1 = GGGGAGTCAG...
umi TTCTGACCTG = 247 reads: +388 validated

UMI info for barcode CGTCAGGTCCCATTTA-1 contig 2 = GGGGAGTCAG...
umi CTTGTGCTTC = 194 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=10)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQSYTTLLTF at 355, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 28, 34, 90, 103, 239, 458
confident = false

TIG 2[bases=552]
28-379 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=11)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYDSFSWTF at 355, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 28, 34, 90, 103, 239, 242, 335, 365, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2182 = CGTCAGGTCCGTCATC-1

using 444 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 4, 434]
surviving nonsolo ucounts = 1[434]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=337]
10-161 ==> 209-360 on |271|IGKV2D-26|L-REGION+V-REGION| [len=360] (mis=2)
163-201 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
201-337 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQDAQDPPGTF at 137, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 425
start codons at 21, 120, 140, 147, 243
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2183 = CGTCAGGTCCTACAGA-1

using 443 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[442]
surviving nonsolo ucounts = 1[442]
ids = [0]

====================================================================================

UMI info for barcode CGTCAGGTCCTACAGA-1 contig 1 = TGGGAGGAAT...
umi CGATTTCTAA = 441 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 78 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 433
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2185 = CGTCAGGTCCTTTCTC-1

using 441 reads

====================================================================================

graph has 178 edges initially, 24 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 208, 224]
surviving nonsolo ucounts = 2[208, 224]
ids = [2, 7]

====================================================================================

UMI info for barcode CGTCAGGTCCTTTCTC-1 contig 1 = GAGGAGTCAG...
umi CGTTCGTAGG = 218 reads: +382 validated

UMI info for barcode CGTCAGGTCCTTTCTC-1 contig 2 = GGAGTCAGAC...
umi ATGTATAACC = 201 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=502]
34-282 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=35)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
416-502 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CLHYDNRRRTF at 355, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 34, 90, 103, 242, 365, 458
confident = false

TIG 2[bases=500]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
414-500 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYNSYPLTF at 353, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 26, 32, 88, 101, 237, 240, 333, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2186 = CGTCAGGTCGCGGATC-1

using 42 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2^2, 3, 4, 5^2, 7, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2189 = CGTCAGGTCTAACTTC-1

using 227 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 4, 216]
surviving nonsolo ucounts = 1[216]
ids = [2]

====================================================================================

UMI info for barcode CGTCAGGTCTAACTTC-1 contig 1 = AGGAGTCAGA...
umi CACTTGTCGC = 205 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
0-27 ==> 2-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
27-378 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=2)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-490 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CLQDYNYPLTF at 354, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 27, 33, 89, 102, 184, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2190 = CGTCAGGTCTACCAGA-1

using 322 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[6, 311]
surviving nonsolo ucounts = 1[311]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2192 = CGTCAGGTCTATCGCC-1

using 236 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 3^2, 4, 222]
surviving nonsolo ucounts = 1[222]
ids = [5]

====================================================================================

UMI info for barcode CGTCAGGTCTATCGCC-1 contig 1 = GAGGAGTCAG...
umi TAGTCATGCT = 224 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=16)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQSYNTPRTF at 355, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 28, 34, 90, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2195 = CGTCAGGTCTGATACG-1

using 258 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[253]
surviving nonsolo ucounts = 1[253]
ids = [2]

====================================================================================

UMI info for barcode CGTCAGGTCTGATACG-1 contig 1 = TGATCAGGAC...
umi GCAGCGTGGT = 238 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=509]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=2)
390-428 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
428-509 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CMQALQTRETF at 367, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 31, 64, 100, 188, 350, 370, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2199 = CGTCAGGTCTTACCTA-1

using 287 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[286]
surviving nonsolo ucounts = 1[286]
ids = [0]

====================================================================================

UMI info for barcode CGTCAGGTCTTACCTA-1 contig 1 = AGGTTCCAGC...
umi AATGCCATTG = 284 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=550]
0-58 ==> 43-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
58-414 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=4)
428-479 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
479-550 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CATTSSSSWNWFDPW at 403, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 14, 58, 102
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2201 = CGTCAGGTCTTCCTTC-1

using 180 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 5, 169]
surviving nonsolo ucounts = 1[169]
ids = [2]

====================================================================================

UMI info for barcode CGTCAGGTCTTCCTTC-1 contig 1 = TGGGGAGGAA...
umi GCATCGGTTC = 160 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=468]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-468 ==> 0-48 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 158
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2204 = CGTCCATAGAAGATTC-1

using 3315 reads

====================================================================================

graph has 2056 edges initially, 44 edges after simplification

total ucounts = 421
nonsolo ucounts = 209[2^89, 3^41, 4^26, 5^14, 6^7, 7^3, 8^4, 9^3, 10^3, 11^2, 12, 13^2, 14, 16, 53, 71, 108, 166, 183, 202, 217, 253, 274, 279, 288, 292]
surviving nonsolo ucounts = 11[53, 71, 166, 183, 202, 217, 253, 274, 279, 288, 292]
ids = [419, 8, 115, 106, 189, 260, 244, 157, 322, 117, ...]

====================================================================================

UMI info for barcode CGTCCATAGAAGATTC-1 contig 1 = GGGAGAGGAG...
umi AAATTACACA = 73 reads: +369 -49 non-validated
umi ATTCTCGATA = 150 reads: +418 validated
umi ATTTGGTAAG = 292 reads: +418 validated
umi CCAGTTAACG = 274 reads: +418 validated
umi TTTTCTATTG = 56 reads: +2 -1 +3 -1 +3 -1 +407 non-validated

UMI info for barcode CGTCCATAGAAGATTC-1 contig 2 = GGAGTCAGTC...
umi ATGATGGGTG = 184 reads: +388 validated
umi CGAACTCACC = 203 reads: +388 validated
umi CTACTAGATA = 293 reads: +388 validated
umi GCAAGGGCAC = 259 reads: +388 validated
umi GCTGCTTACT = 214 reads: +388 validated
umi TAGCCGCGCT = 278 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=562]
0-73 ==> 6-79 on |154|IGHV3-66|5'UTR| [len=79] (mis=0)
73-423 ==> 0-350 on |155|IGHV3-66|L-REGION+V-REGION| [len=350] (mis=5)
441-491 ==> 11-61 on |58|IGHJ6|J-REGION| [len=61] (mis=0)
491-562 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 4 umis using 57 reads
cdr3 = CARVMGSSSFYYMDVW at 412, score = 9 + 7
umis assigned: [8, 115, 117, 157, 419]
of which 5 are surviving nonsolos
reads assigned: 818
start codons at 73, 229, 373, 424, 448
confident = true

TIG 2[bases=550]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 6 umis using 193 reads
cdr3 = CQQSYSTPWTF at 353, score = 9 + 8
umis assigned: [106, 189, 210, 244, 260, 322]
of which 6 are surviving nonsolos
reads assigned: 1405
start codons at 26, 32, 88, 101, 237, 456
confident = true
now this is a cell
paired!

GAGGACACGGCTGTGTATTACTGTGCGAGAGTTATGGGTAGCAGCAGTTTCTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2205 = CGTCCATAGAATTCCC-1

using 1034 reads

====================================================================================

graph has 1504 edges initially, 34 edges after simplification

total ucounts = 530
nonsolo ucounts = 235[2^120, 3^49, 4^31, 5^12, 6^10, 7^4, 8^6, 10, 11^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2208 = CGTCCATAGACAGGCT-1

using 208 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[203]
surviving nonsolo ucounts = 1[203]
ids = [3]

====================================================================================

UMI info for barcode CGTCCATAGACAGGCT-1 contig 1 = GAGGAATCAG...
umi CCCGACCTGT = 205 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2214 = CGTCCATAGATATGGT-1

using 677 reads

====================================================================================

graph has 304 edges initially, 4 edges after simplification

total ucounts = 16
nonsolo ucounts = 7[2, 3^3, 11, 76, 570]
surviving nonsolo ucounts = 2[76, 570]
ids = [2, 15]

====================================================================================

UMI info for barcode CGTCCATAGATATGGT-1 contig 1 = AGGAGTCAGA...
umi ATTACCCGCA = 74 reads: +30 -1X +351 invalidated

GOOD CONTIGS

TIG 1[bases=445]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=11)
372-409 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
409-445 ==> 0-36 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CQQAKSFSF at 354, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 72
start codons at 27, 33, 89, 102, 238
confident = false

REJECT CONTIGS

TIG 1[bases=418]
4-172 ==> 1932-2100 on segment after IGLV3-12 exon 2 [len=6000] (mis=0)
169-207 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
207-418 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
umis assigned: [15]
of which 1 are surviving nonsolos
reads assigned: 558
start codons at 22, 29, 100, 128
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2218 = CGTCCATAGATGTGTA-1

using 358 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[149, 205]
surviving nonsolo ucounts = 2[149, 205]
ids = [1, 4]

====================================================================================

UMI info for barcode CGTCCATAGATGTGTA-1 contig 1 = ACCCAAAAAC...
umi ATTGCATTCG = 144 reads: +436 validated
umi GGAAGTTATT = 197 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=524]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-524 ==> 0-34 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 40 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 336
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2219 = CGTCCATAGCAGGTCA-1

using 224 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 6, 213]
surviving nonsolo ucounts = 1[213]
ids = [1]

====================================================================================

UMI info for barcode CGTCCATAGCAGGTCA-1 contig 1 = GACTCAGTCA...
umi ATGTGACTTA = 195 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=472]
19-370 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=5)
371-410 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
410-472 ==> 0-62 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQYNSYSRYTF at 346, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 19, 25, 81, 94, 230, 233, 326, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2221 = CGTCCATAGCGATAGC-1

using 181 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[3^2, 4, 166]
surviving nonsolo ucounts = 2[4, 166]
ids = [2, 8]

====================================================================================

UMI info for barcode CGTCCATAGCGATAGC-1 contig 1 = GGGAATCAGT...
umi ATGTTTCGGA = 4 reads: -382X +2 -2X +1 -1X invalidated
umi TCCAGGCTAA = 165 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [2, 8]
of which 2 are surviving nonsolos
reads assigned: 168
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2223 = CGTCCATAGCGTAATA-1

using 240 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 234]
surviving nonsolo ucounts = 1[234]
ids = [4]

====================================================================================

UMI info for barcode CGTCCATAGCGTAATA-1 contig 1 = GAAGAGCTGC...
umi TCGGTATTGA = 216 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=494]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-494 ==> 0-76 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQYGSSPGTF at 357, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2224 = CGTCCATAGCGTGTCC-1

using 126 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 121]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2226 = CGTCCATAGCTCCCAG-1

using 275 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 127, 140]
surviving nonsolo ucounts = 2[127, 140]
ids = [2, 1]

====================================================================================

UMI info for barcode CGTCCATAGCTCCCAG-1 contig 1 = TGAGCGCAGA...
umi CATCGCGGGC = 136 reads: +394 validated
umi CCCGATCCTG = 127 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=523]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-361 ==> 0-325 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=10)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
430-523 ==> 0-93 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 37 reads
cdr3 = CAVWDDSLDTGRGVF at 357, score = 7 + 8
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 256
start codons at 36, 190, 241, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2229 = CGTCCATAGGATATAC-1

using 254 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 247]
surviving nonsolo ucounts = 1[247]
ids = [1]

====================================================================================

UMI info for barcode CGTCCATAGGATATAC-1 contig 1 = GGAGTCAGTC...
umi CAAAAACATC = 227 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=21)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
414-495 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQSNTSPRTF at 353, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 26, 32, 88, 101, 237, 240, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2233 = CGTCCATAGGCTCAGA-1

using 1385 reads

====================================================================================

graph has 1745 edges initially, 32 edges after simplification

total ucounts = 738
nonsolo ucounts = 307[2^159, 3^79, 4^21, 5^18, 6^12, 7^10, 8^3, 9^2, 10, 12, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2237 = CGTCCATAGGTGACCA-1

using 408 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 399]
surviving nonsolo ucounts = 1[399]
ids = [1]

====================================================================================

UMI info for barcode CGTCCATAGGTGACCA-1 contig 1 = GTCAGACTCA...
umi CACAAGCCCA = 367 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=478]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-478 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 70 reads
cdr3 = CQQYNSYPLTF at 350, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 363
start codons at 23, 29, 85, 98, 234, 237, 330, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2241 = CGTCCATAGTAGCGGT-1

using 154 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[152]
surviving nonsolo ucounts = 1[152]
ids = [0]

====================================================================================

UMI info for barcode CGTCCATAGTAGCGGT-1 contig 1 = ATCAGTCCCA...
umi AGCGTCGCTG = 142 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=506]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-506 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 142
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2243 = CGTCCATAGTCAATAG-1

using 201 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 4, 188]
surviving nonsolo ucounts = 1[188]
ids = [9]

====================================================================================

UMI info for barcode CGTCCATAGTCAATAG-1 contig 1 = GAATCAGTCC...
umi TGTCTTACGG = 169 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=486]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-486 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2245 = CGTCCATAGTCGCCGT-1

using 21 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 18]
surviving nonsolo ucounts = 1[18]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2255 = CGTCCATCAAGAGTCG-1

using 97 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 88]
surviving nonsolo ucounts = 2[3, 88]
ids = [4, 5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=465]
5-333 ==> 23-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=18)
332-370 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
370-465 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 309, score = 9 + 8
umis assigned: [4, 5, 6]
of which 2 are surviving nonsolos
reads assigned: 84
start codons at 57, 193, 412
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2258 = CGTCCATCAATTCCTT-1

using 4156 reads

====================================================================================

graph has 5784 edges initially, 84 edges after simplification

total ucounts = 2132
nonsolo ucounts = 903[2^414, 3^239, 4^103, 5^61, 6^31, 7^17, 8^14, 9^11, 10^3, 11^5, 12^2, 13^2, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2270 = CGTCCATCACTTGGAT-1

using 273 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[6, 263]
surviving nonsolo ucounts = 1[263]
ids = [4]

====================================================================================

UMI info for barcode CGTCCATCACTTGGAT-1 contig 1 = AGTCAGTCCC...
umi GGTCTATTTG = 265 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 34-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
24-375 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=0)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQLNSYPQTF at 351, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 24, 30, 86, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2279 = CGTCCATCAGTGGAGT-1

using 100 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 92]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2291 = CGTCCATCATTCTTAC-1

using 677 reads

====================================================================================

graph has 226 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 205, 467]
surviving nonsolo ucounts = 2[205, 467]
ids = [1, 0]

====================================================================================

UMI info for barcode CGTCCATCATTCTTAC-1 contig 1 = AGCTTCAGCT...
umi AGTCTTCACT = 468 reads: +385 validated
umi CCCGTGCTCC = 202 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=593]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
432-593 ==> 0-161 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 97 reads
cdr3 = CAAWDDSLNGLF at 368, score = 8 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 656
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2295 = CGTCCATGTAAGAGAG-1

using 239 reads

====================================================================================

graph has 98 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[79, 158]
surviving nonsolo ucounts = 2[79, 158]
ids = [2, 3]

====================================================================================

UMI info for barcode CGTCCATGTAAGAGAG-1 contig 1 = AGAAGAGCTG...
umi GGAACCGTTC = 73 reads: +385 validated

UMI info for barcode CGTCCATGTAAGAGAG-1 contig 2 = GACTCCTGTG...
umi TCATTAGTCT = 155 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=439]
0-34 ==> 18-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
34-382 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
381-419 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
419-439 ==> 0-20 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CQQYGSSPITF at 358, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 72
start codons at 34, 242, 368
confident = false

TIG 2[bases=526]
17-375 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
400-450 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
450-526 ==> 0-76 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 13 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 362, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 153
start codons at 17, 61, 240, 243, 246, 332, 402
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2296 = CGTCCATGTAAGTAGT-1

using 306 reads

====================================================================================

graph has 100 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[128, 174]
surviving nonsolo ucounts = 2[128, 174]
ids = [5, 3]

====================================================================================

UMI info for barcode CGTCCATGTAAGTAGT-1 contig 1 = GCTGGGGTCT...
umi TCACCTGCTC = 127 reads: +385 validated

UMI info for barcode CGTCCATGTAAGTAGT-1 contig 2 = AGTGCTTTCT...
umi GAATCCAATG = 164 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=580]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
426-580 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CSSYGGSNRVF at 365, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 124
start codons at 41, 198, 249, 348, 375
confident = false

TIG 2[bases=545]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
453-545 ==> 0-92 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 25 reads
cdr3 = CARYFAFVNYYFDKW at 377, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 17, 38, 82
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2301 = CGTCCATGTCAAAGAT-1

using 210 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[210]
surviving nonsolo ucounts = 1[210]
ids = [0]

====================================================================================

UMI info for barcode CGTCCATGTCAAAGAT-1 contig 1 = GCTACAACAG...
umi TGTTGTTTAT = 211 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=564]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
389-428 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQYYGSPRTF at 367, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 25, 28, 83, 97, 350, 380, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2303 = CGTCCATGTCAACATC-1

using 240 reads

====================================================================================

graph has 110 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[4, 88, 145]
surviving nonsolo ucounts = 2[88, 145]
ids = [5, 4]

====================================================================================

UMI info for barcode CGTCCATGTCAACATC-1 contig 1 = TGAGAGTCAT...
umi GAGTAATCAT = 133 reads: +451 validated

UMI info for barcode CGTCCATGTCAACATC-1 contig 2 = AGCTTCAGCT...
umi TCTTTGCGGG = 85 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=500]
8-379 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
411-459 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
459-500 ==> 0-41 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARGSGILVIAIEDYYFDHW at 368, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 130
start codons at 8, 29, 73, 159, 246
confident = false

TIG 2[bases=526]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
435-526 ==> 0-91 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CAAWDDSLNGWVF at 368, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 83
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2309 = CGTCCATGTCATCCCT-1

using 407 reads

====================================================================================

graph has 166 edges initially, 36 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 197, 205]
surviving nonsolo ucounts = 2[197, 205]
ids = [3, 4]

====================================================================================

UMI info for barcode CGTCCATGTCATCCCT-1 contig 1 = AGGAGTCAGA...
umi TTATATCTGT = 194 reads: +388 validated

UMI info for barcode CGTCCATGTCATCCCT-1 contig 2 = GGGAATCAGT...
umi TTGACAAACG = 215 reads: +22 -1XX +235 -2XX +128 invalidated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQYNSYSITF at 354, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 27, 33, 89, 102, 334, 457
confident = false

TIG 2[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=16)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2315 = CGTCCATGTCGCGTGT-1

using 688 reads

====================================================================================

graph has 778 edges initially, 24 edges after simplification

total ucounts = 375
nonsolo ucounts = 134[2^66, 3^26, 4^18, 5^11, 6^5, 7^2, 9^2, 10, 12^2, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2318 = CGTCCATGTCTAGAGG-1

using 110 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[4, 106]
surviving nonsolo ucounts = 1[106]
ids = [0]

====================================================================================

UMI info for barcode CGTCCATGTCTAGAGG-1 contig 1 = AGCTTCAGCT...
umi AGCATTGCTT = 107 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
435-557 ==> 0-122 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CAAWDDSLNGWVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 106
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2322 = CGTCCATGTGCGCTTG-1

using 274 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 266]
surviving nonsolo ucounts = 1[266]
ids = [3]

====================================================================================

UMI info for barcode CGTCCATGTGCGCTTG-1 contig 1 = GGGGAGGAAC...
umi CTTAGGCTTT = 251 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=499]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-499 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQRSNWPLTF at 357, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 36, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2324 = CGTCCATGTGTCGCTG-1

using 203 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 200]
surviving nonsolo ucounts = 1[200]
ids = [1]

====================================================================================

UMI info for barcode CGTCCATGTGTCGCTG-1 contig 1 = GAATCAGTCC...
umi GCCTGATGCT = 171 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=483]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-483 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2342 = CGTCCATTCAAGCCTA-1

using 215 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[214]
surviving nonsolo ucounts = 1[214]
ids = [1]

====================================================================================

UMI info for barcode CGTCCATTCAAGCCTA-1 contig 1 = TGGGGAGACT...
umi GTTCTGTAAG = 210 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYDSFSWTF at 352, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 25, 31, 87, 100, 236, 239, 332, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2348 = CGTCCATTCATCTGCC-1

using 192 reads

====================================================================================

graph has 75 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 6, 180]
surviving nonsolo ucounts = 1[180]
ids = [6]

====================================================================================

UMI info for barcode CGTCCATTCATCTGCC-1 contig 1 = GAGGAACTGC...
umi GTTCTGTACG = 168 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=514]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=10)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
421-514 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQRSNWPPMYTF at 354, score = 10 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 166
start codons at 33, 238, 241, 381, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2355 = CGTCCATTCCTGCCAT-1

using 7801 reads

====================================================================================

graph has 3778 edges initially, 80 edges after simplification

total ucounts = 868
nonsolo ucounts = 381[2^179, 3^69, 4^41, 5^17, 6^15, 7^7, 8^2, 9, 10^5, 11^2, 12^2, 15, 16^2, 17, 77, 81, 91, 95, 99, 113, 116^2, 125, 127, 128, 133^2, 137, 141, 154, 158, 166, 171, 174, 175, 178, 182, 186, 199, 200^2, 201, 207, 211, 217, 228, 236, 247, 252, 260, 262]
surviving nonsolo ucounts = 37[77, 81, 91, 95, 99, 113, 116^2, 125, 127, 128, 133^2, 137, 141, 154, 158, 166, 171, 174, 175, 178, 182, 186, 199, 200^2, 201, 207, 211, 217, 228, 236, 247, 252, 260, 262]
ids = [253, 300, 141, 299, 215, 267, 662, 673, 116, 416, ...]

====================================================================================

UMI info for barcode CGTCCATTCCTGCCAT-1 contig 1 = GCCTGAGATT...
umi ACCTCTACGC = 2 reads: +8 -1X +2 -1X +9 -1X +7 -2X +1 -1X +3 -1X +3 -1 +2 -405X invalidated
umi CACCGTCACT = 99 reads: +448 validated
umi CATTCAACGC = 136 reads: +448 validated
umi CCAATAGCGG = 1 reads: -448 non-validated
umi CCGGTCGTGC = 93 reads: +439 -1 +8 non-validated
umi CCGGTCGTGG = 78 reads: +448 validated
umi GATCCAGCTC = 163 reads: +441 -7 non-validated
umi TATTAAATCC = 2 reads: +8 -1XX +2 -1XX +5 -431 invalidated
umi TCTCACTTGC = 2 reads: +8 -1X +2 -1X +9 -1X +5 -421 invalidated

UMI info for barcode CGTCCATTCCTGCCAT-1 contig 2 = GGGGTCACAA...
umi AAGCTTCCTT = 214 reads: +388 validated
umi AATGCCGCAG = 203 reads: +388 validated
umi ACATTGCATT = 197 reads: +388 validated
umi ACTGGCTATG = 196 reads: +388 validated
umi AGAGAGTCTG = 122 reads: +388 validated
umi AGCCCGGCCA = 222 reads: +388 validated
umi AGGTTTCTTT = 91 reads: +388 validated
umi AGTAATCGCC = 250 reads: +388 validated
umi ATCATCGCCA = 154 reads: +388 validated
umi CACGGGGGAG = 276 reads: +169 -6XX +2 -4XX +1 -3XX +1 -4XX +1 -3XX +1 -39X +3 -3XX +3 -5XX +1 -2XX +2 -1XX +4 -1XX +129 invalidated
umi CACTGTACGG = 210 reads: +388 validated
umi CATCAGCTTT = 176 reads: +388 validated
umi CATGAGTCTT = 78 reads: +1 -1X +386 invalidated
umi CGCGGCTATC = 187 reads: +388 validated
umi CGGATGGTAG = 178 reads: +388 validated
umi CTAATAGCGT = 180 reads: +388 validated
umi CTTCATATTA = 125 reads: +388 validated
umi GAACTTTTTC = 135 reads: +388 validated
umi GCAACACTTC = 138 reads: +115 -1XX +272 invalidated
umi GCCCTCTGTA = 185 reads: +388 validated
umi GGATTTTGTA = 135 reads: +194 -1XX +193 invalidated
umi GGGTTATAGG = 215 reads: +388 validated
umi GTCAGAACAC = 159 reads: +388 validated
umi TAGTGTTTCC = 251 reads: +169 -6XX +2 -4XX +1 -3XX +1 -4XX +1 -45 +1 -3XX +3 -5XX +1 -2XX +2 -1XX +4 -1XX +129 invalidated
umi TATACTGTTC = 116 reads: +388 validated
umi TCCTGGTCAG = 252 reads: +388 validated
umi TCGTCATGCA = 171 reads: +388 validated
umi TTTGTACTAT = 276 reads: +169 -6XX +2 -4XX +1 -3XX +1 -4XX +1 -44 +2 -3XX +3 -5XX +1 -2XX +2 -1XX +4 -1XX +129 invalidated

GOOD CONTIGS

TIG 1[bases=527]
58-413 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=31)
443-506 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
506-527 ==> 0-21 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 3 umis using 17 reads
cdr3 = CAKDIFGVGHSYGPNYLYYYGMDVW at 400, score = 9 + 7
umis assigned: [78, 215, 258, 267, 299, 300, 458, 673, 723]
of which 9 are surviving nonsolos
reads assigned: 567
start codons at 58, 203, 209, 214, 293, 361, 434, 463
confident = true

TIG 2[bases=637]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=10)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
426-637 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 28 umis using 916 reads
cdr3 = CCSYVGGITSVF at 362, score = 8 + 8
umis assigned: [30, 42, 64, 97, 116, 124, 141, 143, 159, 221] and 18 others
of which 28 are surviving nonsolos
reads assigned: 4959
start codons at 38, 177, 246, 372
confident = true
now this is a cell
paired!

AAAGATATATTTGGGGTGGGACACAGCTATGGTCCAAATTACCTCTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> TTTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCTGCTCATATGTAGGTGGTATCACTTCCGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2359 = CGTCCATTCGCGTTTC-1

using 158 reads

====================================================================================

graph has 142 edges initially, 4 edges after simplification

total ucounts = 27
nonsolo ucounts = 19[2^3, 4^4, 5^2, 7, 9^3, 10, 12, 14^2, 16, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2366 = CGTCCATTCTCTGAGA-1

using 519 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[519]
surviving nonsolo ucounts = 1[519]
ids = [0]

====================================================================================

UMI info for barcode CGTCCATTCTCTGAGA-1 contig 1 = GGAGGAACTG...
umi CTTTAGGTGC = 517 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=2)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 84 reads
cdr3 = CQQYNNWLGTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 513
start codons at 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2373 = CGTCCATTCTGGCGAC-1

using 87 reads

====================================================================================

graph has 124 edges initially, 6 edges after simplification

total ucounts = 19
nonsolo ucounts = 14[2^2, 3^4, 4, 5^3, 9^2, 11, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2376 = CGTCCATTCTGTCTCG-1

using 11250 reads

====================================================================================

graph has 4249 edges initially, 54 edges after simplification

total ucounts = 812
nonsolo ucounts = 353[2^141, 3^70, 4^43, 5^24, 6^11, 7^3, 8^7, 9^2, 10^3, 11, 13, 17, 23, 30, 54, 57, 96, 106^2, 107, 112, 126^2, 140, 151, 155, 179, 180, 182, 193, 195, 199^2, 208, 212, 213, 214, 227, 236, 238, 242^2, 252, 258, 270, 273, 275, 277^2, 280^2, 290, 301, 316, 336, 352, 471, 519]
surviving nonsolo ucounts = 44[9, 54, 96, 106^2, 107, 112, 126^2, 140, 151, 155, 179, 180, 182, 193, 195, 199^2, 208, 212, 213, 214, 227, 236, 238, 242^2, 252, 258, 270, 273, 275, 277^2, 280^2, 290, 301, 316, 336, 352, 471, 519]
ids = [456, 82, 351, 250, 555, 798, 498, 155, 313, 502, ...]

====================================================================================

UMI info for barcode CGTCCATTCTGTCTCG-1 contig 1 = TGGGGAGGAG...
umi AACAATCCTC = 250 reads: +388 validated
umi AAGCACTGCC = 272 reads: +388 validated
umi AATTTCCCCA = 191 reads: +388 validated
umi ACCTCAACTG = 54 reads: +34 -1 +353 non-validated
umi AGAATCTCTT = 270 reads: +388 validated
umi AGGAAAGTTC = 283 reads: +388 validated
umi AGGTGGCTCC = 126 reads: +388 validated
umi AGTACAGGTA = 316 reads: +388 validated
umi AGTTGCCCCC = 199 reads: +388 validated
umi ATACACCTCA = 153 reads: +388 validated
umi ATATTACATT = 333 reads: +388 validated
umi ATCGGAACTA = 179 reads: +388 validated
umi ATGTTAATAA = 208 reads: +388 validated
umi ATTTTCCCAA = 154 reads: +388 validated
umi CACATCTTTA = 107 reads: +388 validated
umi CAGAGTCTTA = 257 reads: +388 validated
umi CAGTCATTGT = 470 reads: +388 validated
umi CCATAGTCTC = 125 reads: +388 validated
umi CCCCACTGCT = 240 reads: +388 validated
umi CGATGCTTCG = 234 reads: +388 validated
umi CTAAGTACGT = 281 reads: +388 validated
umi CTGCTCGCCT = 215 reads: +388 validated
umi CTTACACTGT = 298 reads: +388 validated
umi GATACTCGGG = 228 reads: +388 validated
umi GCGTCTAGTG = 141 reads: +388 validated
umi GGGGCTTCTT = 204 reads: +34 -1 +2 -1 +1 -4XX +1 -5XX +2 -2XX +335 invalidated
umi GGGTTTCTAT = 238 reads: +388 validated
umi GGTGGCTACC = 192 reads: +388 validated
umi GTATAGATTA = 107 reads: +388 validated
umi GTTGAAACTC = 357 reads: +388 validated
umi TAAAGTAGCA = 187 reads: +132 -2XX +1 -1XX +252 invalidated
umi TAATTTGCCT = 518 reads: +388 validated
umi TCTTACATGG = 283 reads: +183 -1XX +204 invalidated
umi TGCCCCTCAC = 279 reads: +388 validated
umi TGCGTCCTTT = 203 reads: +388 validated
umi TGGCTATTGG = 283 reads: +388 validated
umi TTCGTCTCCT = 235 reads: +388 validated
umi TTTAGCGTCG = 108 reads: +384 -1 +3 non-validated

UMI info for barcode CGTCCATTCTGTCTCG-1 contig 2 = ACTTTCTGAG...
umi AAGCATAGGT = 288 reads: +439 validated
umi CAGCTTGGGG = 168 reads: +439 validated
umi CCTTGTGGGG = 96 reads: +439 validated
umi GACTATTGGC = 9 reads: +4 -1 +28 -1X +39 -35 +80 -100 +59 -25 +22 -1 +33 -11 invalidated
umi GCGCACTTGG = 100 reads: +439 validated
umi TGCCCTTCGC = 206 reads: -388X +3 -3X +2 -2XX +41 invalidated

GOOD CONTIGS

TIG 1[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 38 umis using 1366 reads
cdr3 = CQQSYSTPRTF at 359, score = 9 + 8
umis assigned: [13, 30, 58, 82, 130, 150, 155, 157, 167, 170] and 28 others
of which 38 are surviving nonsolos
reads assigned: 8632
start codons at 32, 38, 94, 107, 243, 462
confident = true

TIG 2[bases=545]
0-35 ==> 66-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
35-391 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=0)
411-474 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
474-545 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 4 umis using 54 reads
cdr3 = CARDFEYQLDREYYYYGMDVW at 380, score = 9 + 7
umis assigned: [32, 272, 351, 456, 498, 711]
of which 6 are surviving nonsolos
reads assigned: 861
start codons at 35, 79, 431
confident = true
now this is a cell
paired!

TATTACTGTGCGAGAGATTTCGAGTACCAGCTGGACCGGGAGTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCTCGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2380 = CGTCCATTCTTGCAAG-1

using 144 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 5[2^4, 127]
surviving nonsolo ucounts = 1[127]
ids = [3]

====================================================================================

UMI info for barcode CGTCCATTCTTGCAAG-1 contig 1 = AGGAGTCAGA...
umi CAATACAGGG = 124 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=467]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
415-467 ==> 0-52 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQQYNGQSRAF at 354, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 119
start codons at 27, 33, 102, 238, 241, 334, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2393 = CGTCTACAGAGGGCTT-1

using 276 reads

====================================================================================

graph has 112 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[87, 186]
surviving nonsolo ucounts = 2[87, 186]
ids = [0, 1]

====================================================================================

UMI info for barcode CGTCTACAGAGGGCTT-1 contig 1 = CACAGCATGG...
umi AAGATGGTTA = 185 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=527]
6-359 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
352-391 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
391-527 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQSYSTPSF at 333, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 6, 12, 68, 81, 217, 433
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2395 = CGTCTACAGAGTTGGC-1

using 123 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 116]
surviving nonsolo ucounts = 1[116]
ids = [3]

====================================================================================

UMI info for barcode CGTCTACAGAGTTGGC-1 contig 1 = TCATCCAACA...
umi ATTACACTGC = 118 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=500]
0-57 ==> 247-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
57-410 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=28)
403-430 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=6)
431-481 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
481-500 ==> 0-19 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARIMVRGVIMAPFDIW at 399, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 115
start codons at 57, 144, 255, 321, 354, 384, 411, 429
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2396 = CGTCTACAGATCCCAT-1

using 178 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[176]
surviving nonsolo ucounts = 1[176]
ids = [0]

====================================================================================

UMI info for barcode CGTCTACAGATCCCAT-1 contig 1 = GGACTCCTGT...
umi CTTGTGCGCC = 152 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=490]
18-368 ==> 0-350 on |94|IGHV2-26|L-REGION+V-REGION| [len=357] (mis=24)
385-436 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
436-490 ==> 0-54 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CASAAAPGDWFDPW at 363, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 149
start codons at 18, 174, 241, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2401 = CGTCTACAGCAATATG-1

using 85 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 4, 73]
surviving nonsolo ucounts = 1[73]
ids = [6]

====================================================================================

UMI info for barcode CGTCTACAGCAATATG-1 contig 1 = GGGTCACAAG...
umi TCTACGTATC = 66 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=433]
0-37 ==> 125-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
37-377 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=23)
394-422 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
junction support: 1 umis using 16 reads
cdr3 = CFSYGSSGRTF at 361, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 66
start codons at 37, 245, 371
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2407 = CGTCTACAGGAATCGC-1

using 163 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[5, 154]
surviving nonsolo ucounts = 1[154]
ids = [0]

====================================================================================

UMI info for barcode CGTCTACAGGAATCGC-1 contig 1 = TGAGCGCAGA...
umi AATTTACGTG = 152 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=563]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=2)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
424-563 ==> 0-139 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CGTWDSSLSAVVF at 357, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 150
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2408 = CGTCTACAGGATATAC-1

using 238 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[238]
surviving nonsolo ucounts = 1[238]
ids = [0]

====================================================================================

UMI info for barcode CGTCTACAGGATATAC-1 contig 1 = AGCTCTGAGA...
umi ACGCACTGCA = 227 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=506]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
junction support: 1 umis using 16 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2412 = CGTCTACAGGGCACTA-1

using 194 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 191]
surviving nonsolo ucounts = 1[191]
ids = [2]

====================================================================================

UMI info for barcode CGTCTACAGGGCACTA-1 contig 1 = GAGTCAGTCC...
umi GTTGCCCCTA = 171 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=476]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
375-413 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
413-476 ==> 0-63 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQQYDNLPVTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 165
start codons at 25, 31, 87, 100, 239, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2418 = CGTCTACAGTCAAGCG-1

using 2033 reads

====================================================================================

graph has 512 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 837, 1189]
surviving nonsolo ucounts = 2[837, 1189]
ids = [1, 3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=390]
5-226 ==> 132-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=2)
235-288 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=0)
288-390 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
cdr3 = CASATRSYWYFDLW at 215, score = 9 + 7
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 2003
start codons at 24, 29, 87, 90, 176, 306, 367
confident = false
VJ delta = 13
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2421 = CGTCTACAGTCGTACT-1

using 79 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[79]
surviving nonsolo ucounts = 1[79]
ids = [0]

====================================================================================

UMI info for barcode CGTCTACAGTCGTACT-1 contig 1 = GGGGTCACAA...
umi GCACCCGTCC = 77 reads: +373 -1 +20 non-validated

GOOD CONTIGS

TIG 1[bases=585]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
432-585 ==> 0-153 on |306|IGLC2|C-REGION| [len=317] (mis=3)
junction support: 1 umis using 7 reads
cdr3 = CCSEAGGGVPGLLF at 362, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 77
start codons at 38, 192
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2422 = CGTCTACAGTGATCGG-1

using 199 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[6, 191]
surviving nonsolo ucounts = 1[191]
ids = [0]

====================================================================================

UMI info for barcode CGTCTACAGTGATCGG-1 contig 1 = GAATCAGTCC...
umi AAGCGCATGG = 183 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=497]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-497 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2425 = CGTCTACAGTTGAGAT-1

using 57 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 9[2^2, 3^3, 4^2, 11, 21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2435 = CGTCTACCAATGAAAC-1

using 388 reads

====================================================================================

graph has 208 edges initially, 26 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 5, 10, 167, 198]
surviving nonsolo ucounts = 4[5, 10, 167, 198]
ids = [0, 8, 9, 7]

====================================================================================

UMI info for barcode CGTCTACCAATGAAAC-1 contig 1 = ATCAGTCCCA...
umi TCAATCTGCG = 195 reads: +388 validated
umi TCGTCCAAAC = 8 reads: -221 +2 -1X +8 -2XX +20 -1XX +2 -3XX +15 -1XX +2 -1XX +3 -1XX +4 -1XX +24 -1XX +4 -1X +2 -1X +10 -1X +2 -28 +1 -2X +15 -1X +7 invalidated

UMI info for barcode CGTCTACCAATGAAAC-1 contig 2 = GGGGAGGAAC...
umi ATATGTGTAG = 7 reads: +14 -1XX +41 -1X +6 -1XX +1 -1XX +3 -1X +4 -1X +21 -1X +19 -266 invalidated
umi TTCAATTCCG = 168 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [7, 8]
of which 2 are surviving nonsolos
reads assigned: 202
start codons at 23, 29, 98, 234, 453
confident = false

TIG 2[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQRSNWPGTF at 357, score = 9 + 8
umis assigned: [0, 9]
of which 2 are surviving nonsolos
reads assigned: 171
start codons at 36, 241, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2436 = CGTCTACCAATGGACG-1

using 212 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[212]
surviving nonsolo ucounts = 1[212]
ids = [0]

====================================================================================

UMI info for barcode CGTCTACCAATGGACG-1 contig 1 = AGAGCTCTGG...
umi TGCCCCGTGC = 199 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=496]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=12)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
429-496 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQYGSSPITF at 368, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 44, 252, 378, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2444 = CGTCTACCACCCTATC-1

using 152 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[152]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode CGTCTACCACCCTATC-1 contig 1 = GACTCAACAA...
umi TCCACAGGTG = 149 reads: +445 validated

GOOD CONTIGS

TIG 1[bases=506]
56-409 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=4)
447-501 ==> 9-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CAREGGAAAANPLMPFDYYGMDVW at 398, score = 9 + 7
umis assigned: [0]
of which 0 are surviving nonsolos
reads assigned: 147
start codons at 56, 207, 250, 254, 259, 263, 291, 320, 353, 437, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2449 = CGTCTACCACTGTCGG-1

using 518 reads

====================================================================================

graph has 835 edges initially, 24 edges after simplification

total ucounts = 232
nonsolo ucounts = 110[2^52, 3^29, 4^14, 5^3, 6^3, 8, 9^2, 11, 12, 15, 17^2, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2451 = CGTCTACCACTTGGAT-1

using 76 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 74]
surviving nonsolo ucounts = 1[74]
ids = [1]

====================================================================================

UMI info for barcode CGTCTACCACTTGGAT-1 contig 1 = ATGGACATGA...
umi GCATTCGCAT = 66 reads: +371 -1 +16 non-validated

GOOD CONTIGS

TIG 1[bases=436]
0-353 ==> 0-353 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=2)
351-388 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
388-436 ==> 0-48 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CQQYYSFPLTF at 327, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 65
start codons at 0, 6, 62, 75, 138, 211, 430
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2459 = CGTCTACCAGGTCCAC-1

using 199 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[13, 183]
surviving nonsolo ucounts = 1[183]
ids = [0]

====================================================================================

UMI info for barcode CGTCTACCAGGTCCAC-1 contig 1 = GATCAGGACT...
umi AGCACTATGT = 170 reads: +397 validated
umi ATGGAATATT = 2 reads: +6 -1X +15 -2 +5 -1X +2 -2X +8 -1X +4 -5X +2 -335 +3 -1X +4 invalidated

GOOD CONTIGS

TIG 1[bases=526]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=17)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
427-526 ==> 0-99 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 21 reads
cdr3 = CMQALQTPLTF at 366, score = 9 + 9
umis assigned: [0, 1]
of which 1 are surviving nonsolos
reads assigned: 171
start codons at 30, 63, 99, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2461 = CGTCTACCAGTCACTA-1

using 195 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 190]
surviving nonsolo ucounts = 1[190]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=546]
0-21 ==> 31-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-22 ==> 5715-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
21-369 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
372-410 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 189
start codons at 21, 229, 355, 452
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2465 = CGTCTACCATGCGCAC-1

using 52 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 48]
surviving nonsolo ucounts = 1[48]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2468 = CGTCTACCATTCTCAT-1

using 176 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 4, 166]
surviving nonsolo ucounts = 1[166]
ids = [2]

====================================================================================

UMI info for barcode CGTCTACCATTCTCAT-1 contig 1 = GCTCAGGAGG...
umi CTCACTCTTT = 163 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=482]
0-31 ==> 4-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
31-378 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=3)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
413-482 ==> 0-69 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CYSTDSSGNIRVF at 346, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 161
start codons at 31, 92, 161, 179, 230, 292, 329
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2492 = CGTCTACGTGTTTGGT-1

using 167 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 159]
surviving nonsolo ucounts = 1[159]
ids = [2]

====================================================================================

UMI info for barcode CGTCTACGTGTTTGGT-1 contig 1 = AGGAGTCAGA...
umi CTATACCTTC = 146 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=505]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=3)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
415-505 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQQYYSYPRTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 146
start codons at 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2496 = CGTCTACGTTGCCTCT-1

using 96 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[95]
surviving nonsolo ucounts = 1[95]
ids = [0]

====================================================================================

UMI info for barcode CGTCTACGTTGCCTCT-1 contig 1 = AGCCCAGCAC...
umi AAACATCTTG = 90 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=535]
0-65 ==> 2-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=2)
65-418 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=16)
453-501 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
501-535 ==> 0-34 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CARDAIGADSSGFYYGHFDYW at 407, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 89
start codons at 65, 210, 216, 221, 282, 286, 368, 417
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2497 = CGTCTACGTTGTTTGG-1

using 274 reads

====================================================================================

graph has 125 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 7, 263]
surviving nonsolo ucounts = 1[263]
ids = [0]

====================================================================================

UMI info for barcode CGTCTACGTTGTTTGG-1 contig 1 = GTCAGTCTCA...
umi CCGAAGGATA = 265 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 24-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQSYRRPITF at 350, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 23, 29, 85, 98, 234, 333, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2502 = CGTCTACTCAATACCG-1

using 620 reads

====================================================================================

graph has 194 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 3, 177, 437]
surviving nonsolo ucounts = 2[177, 437]
ids = [3, 0]

====================================================================================

UMI info for barcode CGTCTACTCAATACCG-1 contig 1 = AGTCTGGGCC...
umi CAGTAACGGT = 435 reads: +382 validated
umi TACAGTTCAA = 177 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=633]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-374 ==> 0-334 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=22)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
422-633 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 105 reads
cdr3 = CQVWDSTSVHWVF at 355, score = 8 + 8
umis assigned: [0, 3]
of which 2 are surviving nonsolos
reads assigned: 607
start codons at 40, 101, 159, 242, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2504 = CGTCTACTCACAACGT-1

using 15 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2525 = CGTCTACTCCTATGTT-1

using 173 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[172]
surviving nonsolo ucounts = 1[172]
ids = [1]

====================================================================================

UMI info for barcode CGTCTACTCCTATGTT-1 contig 1 = GGGACAGCTC...
umi AGTGCTGCTC = 157 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=466]
16-369 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
418-452 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 358, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 156
start codons at 16, 214, 219, 236, 280, 313
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2527 = CGTCTACTCCTTAATC-1

using 646 reads

====================================================================================

graph has 234 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 4, 636]
surviving nonsolo ucounts = 1[636]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=300]
0-75 ==> 5533-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-87 ==> 0-57 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
85-124 ==> 321-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0) [SHIFT!]
126-164 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
164-300 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQALQTPLFTF at 100, score = 4 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 618
start codons at 30, 63, 103, 206
confident = false
not full
frameshifted full length transcript of length 300
VJ delta = 280
delta too large
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2548 = CGTGAGCAGAAGATTC-1

using 359 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[2, 16, 140, 201]
surviving nonsolo ucounts = 2[140, 201]
ids = [3, 0]

====================================================================================

UMI info for barcode CGTGAGCAGAAGATTC-1 contig 1 = GATCAGGACT...
umi AAACCGGCAC = 202 reads: +397 validated
umi TTCCTCCGAG = 140 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 48 reads
cdr3 = CMQGLQTPIAF at 366, score = 9 + 7
umis assigned: [0, 3]
of which 2 are surviving nonsolos
reads assigned: 335
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2550 = CGTGAGCAGAATAGGG-1

using 164 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[164]
surviving nonsolo ucounts = 1[164]
ids = [0]

====================================================================================

UMI info for barcode CGTGAGCAGAATAGGG-1 contig 1 = GGCTGGGGTC...
umi GTTACGCTGC = 163 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
42-386 ==> 0-344 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=20)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
430-550 ==> 0-120 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CSSYISSTTLGF at 366, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 160
start codons at 42, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2551 = CGTGAGCAGACAATAC-1

using 146 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 140]
surviving nonsolo ucounts = 1[140]
ids = [3]

====================================================================================

UMI info for barcode CGTGAGCAGACAATAC-1 contig 1 = GAATCAGTCC...
umi CGGGTCCCTC = 118 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=458]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=1)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
413-458 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CLQHNSYPWTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 117
start codons at 25, 31, 100, 182, 236
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2553 = CGTGAGCAGAGCTGCA-1

using 160 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 157]
surviving nonsolo ucounts = 1[157]
ids = [1]

====================================================================================

UMI info for barcode CGTGAGCAGAGCTGCA-1 contig 1 = CTCGGGACGT...
umi ATCGTGTTAA = 140 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=545]
17-368 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
367-405 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
405-545 ==> 0-140 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CSSYTSSSTVVF at 341, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 139
start codons at 17, 174, 218, 225, 228
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2554 = CGTGAGCAGAGCTTCT-1

using 192 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 189]
surviving nonsolo ucounts = 1[189]
ids = [1]

====================================================================================

UMI info for barcode CGTGAGCAGAGCTTCT-1 contig 1 = GAAGAGCTGC...
umi TAGTTCGGCT = 163 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=511]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
415-511 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQQYGSSRTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 160
start codons at 33, 241, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2555 = CGTGAGCAGATGTGTA-1

using 16 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2560 = CGTGAGCAGCCGGTAA-1

using 3905 reads

====================================================================================

graph has 2253 edges initially, 42 edges after simplification

total ucounts = 368
nonsolo ucounts = 212[2^46, 3^29, 4^29, 5^15, 6^7, 7^15, 8^13, 9^9, 10^9, 11^8, 12^6, 13, 14^2, 15, 16, 17^2, 18, 26, 62, 78, 102, 105, 128, 133, 143, 147, 154, 159, 163, 172, 179, 189, 204, 234, 295]
surviving nonsolo ucounts = 16[62, 78, 102, 105, 128, 133, 143, 147, 159, 163, 172, 179, 189, 204, 234, 295]
ids = [125, 86, 331, 96, 303, 104, 293, 222, 32, 85, ...]

====================================================================================

UMI info for barcode CGTGAGCAGCCGGTAA-1 contig 1 = TGGGGAGGAG...
umi ACATGAGCAC = 161 reads: +388 validated
umi ACATGAGTGC = 175 reads: +388 validated
umi AGCCGTATAC = 237 reads: +388 validated
umi ATCTATGTTC = 78 reads: +388 validated
umi ATTCAGCTAA = 105 reads: +388 validated
umi CAAACATCGA = 133 reads: +388 validated
umi CATAGAGTCG = 62 reads: +388 validated
umi CGTTCCTCGG = 75 reads: +22 -1XX +18 -1XX +6 -1X +3 -1XX +9 -1XX +8 -1XX +36 -1XX +1 -2XX +12 -1XX +22 -2XX +4 -4XX +1 -2XX +5 -3XX +4 -1XX +8 -1XX +20 -1XX +3 -1XX +3 -1XX +12 -1XX +4 -1XX +9 -123 +2 -2X +15 -1X +7 invalidated
umi CTTTTCATAC = 147 reads: +388 validated
umi TATGTTGCCC = 143 reads: +388 validated
umi TCCTATTCTC = 133 reads: +388 validated
umi TTCAATCAAC = 180 reads: +388 validated
umi TTGTGCAGTT = 201 reads: +388 validated
umi TTTACGCACT = 186 reads: +388 validated

UMI info for barcode CGTGAGCAGCCGGTAA-1 contig 2 = GCCCCAGCCC...
umi ATCTATGGAA = 167 reads: +415 validated
umi CTCCCATTTC = 294 reads: -364 +51 non-validated
umi TGGCTTTATT = 11 reads: -354X +1 -3XX +1 -2XX +1 -2XX +1 -3XX +2 -1XX +1 -1XX +1 -3XX +1 -1XX +1 -1XX +29 -1XX +4 invalidated

GOOD CONTIGS

TIG 1[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 13 umis using 347 reads
cdr3 = CQQSYSTPFTF at 359, score = 9 + 8
umis assigned: [32, 33, 65, 86, 96, 104, 125, 194, 222, 293] and 4 others
of which 13 are surviving nonsolos
reads assigned: 1982
start codons at 32, 38, 94, 107, 243, 462
confident = true

TIG 2[bases=640]
0-65 ==> 171-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=0)
65-418 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=8)
444-480 ==> 10-46 on |54|IGHJ4|J-REGION| [len=46] (mis=1)
480-640 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARAFDDWYGLSNW at 407, score = 9 + 7
umis assigned: [85, 203, 331]
of which 3 are surviving nonsolos
reads assigned: 461
start codons at 65, 221, 282, 368, 534
confident = true
now this is a cell
paired!

AGAGCCGAGGACACGGCTGTCTATTACTGTGCAAGAGCATTCGACGACTGGTACGGGTTGTCCAACTGGGGCCAGGGAACCCTGGTCACCGTCTCGTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCGTTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2563 = CGTGAGCAGCTCAACT-1

using 167 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 159]
surviving nonsolo ucounts = 1[159]
ids = [4]

====================================================================================

UMI info for barcode CGTGAGCAGCTCAACT-1 contig 1 = GATCAGGACT...
umi TCAAACGCTC = 154 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=478]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-478 ==> 0-48 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 152
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2564 = CGTGAGCAGGACTGGT-1

using 124 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[124]
surviving nonsolo ucounts = 1[124]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=490]
0-331 ==> 40-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=64)
365-411 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=12)
411-490 ==> 0-79 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
cdr3 = CARGPLVRGILGKGYYLDLW at 320, score = 8 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 119
start codons at 25, 290
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2569 = CGTGAGCAGGGCTTGA-1

using 63 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 11[2^2, 3^4, 4, 5, 6, 7, 20]
surviving nonsolo ucounts = 1[20]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2570 = CGTGAGCAGGGTGTTG-1

using 80 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[80]
surviving nonsolo ucounts = 1[80]
ids = [0]

====================================================================================

UMI info for barcode CGTGAGCAGGGTGTTG-1 contig 1 = GGAGTCAGTC...
umi AAACGGCATT = 73 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=454]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-454 ==> 0-40 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 72
start codons at 26, 32, 88, 101, 237, 336
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2580 = CGTGAGCAGTTGAGTA-1

using 248 reads

====================================================================================

graph has 104 edges initially, 30 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[117, 129]
surviving nonsolo ucounts = 2[117, 129]
ids = [2, 3]

====================================================================================

UMI info for barcode CGTGAGCAGTTGAGTA-1 contig 1 = CAGGACACAG...
umi TCGTTTGAGC = 121 reads: +388 validated

UMI info for barcode CGTGAGCAGTTGAGTA-1 contig 2 = GTCAGACCCT...
umi TCCACATGTC = 109 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=498]
11-362 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
361-399 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
399-498 ==> 0-99 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CLQYSSSPWTF at 338, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 120
start codons at 11, 17, 86, 222, 441
confident = false

TIG 2[bases=510]
0-29 ==> 24-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
29-374 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=1)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
411-510 ==> 0-99 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQYYSYPITF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 107
start codons at 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2582 = CGTGAGCCAAACAACA-1

using 714 reads

====================================================================================

graph has 1074 edges initially, 10 edges after simplification

total ucounts = 395
nonsolo ucounts = 133[2^68, 3^28, 4^10, 5^11, 6^5, 7^2, 8^3, 9, 10, 11^2, 13, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2587 = CGTGAGCCAAGTTAAG-1

using 265 reads

====================================================================================

graph has 104 edges initially, 12 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[131, 134]
surviving nonsolo ucounts = 2[131, 134]
ids = [1, 0]

====================================================================================

UMI info for barcode CGTGAGCCAAGTTAAG-1 contig 1 = GATCAGGACT...
umi CCCATGTACA = 128 reads: +400 validated

UMI info for barcode CGTGAGCCAAGTTAAG-1 contig 2 = AGGAGTCAGT...
umi ATCCTACGGC = 123 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=521]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-521 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 124
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false

TIG 2[bases=503]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
412-503 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQQYDNLPTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 120
start codons at 27, 33, 89, 102, 241, 364, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2589 = CGTGAGCCAATCCAAC-1

using 188 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[5, 181]
surviving nonsolo ucounts = 1[181]
ids = [1]

====================================================================================

UMI info for barcode CGTGAGCCAATCCAAC-1 contig 1 = GAGGAATCAG...
umi GGCGCGTGTA = 185 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 179
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2597 = CGTGAGCCACTATCTT-1

using 164 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[162]
surviving nonsolo ucounts = 1[162]
ids = [1]

====================================================================================

UMI info for barcode CGTGAGCCACTATCTT-1 contig 1 = TGGGGGCTGG...
umi AAATGGATTA = 156 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=533]
46-395 ==> 0-349 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
396-434 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
434-533 ==> 0-99 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CSSYTSSSMGVF at 370, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 156
start codons at 46, 203, 247, 254, 257, 394
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2598 = CGTGAGCCACTTAACG-1

using 334 reads

====================================================================================

graph has 476 edges initially, 4 edges after simplification

total ucounts = 189
nonsolo ucounts = 68[2^31, 3^18, 4^8, 5^5, 6^4, 7, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2604 = CGTGAGCCAGTCAGCC-1

using 190 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[190]
surviving nonsolo ucounts = 1[190]
ids = [0]

====================================================================================

UMI info for barcode CGTGAGCCAGTCAGCC-1 contig 1 = GGGGTCTCAG...
umi TAAGATGGGC = 181 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=506]
0-38 ==> 3-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=3)
38-382 ==> 0-344 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=20)
388-426 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
426-506 ==> 0-80 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CSSYISSTTLGF at 362, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 38, 246, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2605 = CGTGAGCCAGTCGATT-1

using 119 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 117]
surviving nonsolo ucounts = 1[117]
ids = [1]

====================================================================================

UMI info for barcode CGTGAGCCAGTCGATT-1 contig 1 = TGAGCGCAGA...
umi TGGCATAGAC = 109 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=500]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=12)
389-427 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
427-500 ==> 0-73 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CATWETSLSAPYVF at 357, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 107
start codons at 36, 190, 365, 391
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2607 = CGTGAGCCATGCAACT-1

using 265 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[108, 155]
surviving nonsolo ucounts = 2[108, 155]
ids = [2, 3]

====================================================================================

UMI info for barcode CGTGAGCCATGCAACT-1 contig 1 = CAGTCCCACT...
umi TCTGCTCCTT = 108 reads: +388 validated
umi TTACTTTCTC = 156 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=545]
0-21 ==> 6-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
21-372 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
371-409 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
409-545 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 44 reads
cdr3 = CLQYSSSPWTF at 348, score = 9 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 260
start codons at 21, 27, 96, 232, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2615 = CGTGAGCGTACCTACA-1

using 191 reads

====================================================================================

graph has 128 edges initially, 26 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 30, 65, 92]
surviving nonsolo ucounts = 3[30, 65, 92]
ids = [2, 5, 1]

====================================================================================

UMI info for barcode CGTGAGCGTACCTACA-1 contig 1 = TCAGTTAGGA...
umi CATCACTATG = 80 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=503]
0-23 ==> 24-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
23-368 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=15)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
408-503 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CQQRSDWPPLTF at 344, score = 10 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 79
start codons at 23, 165, 224, 228, 231, 450
confident = false

REJECT CONTIGS

TIG 1[bases=444]
0-312 ==> 39-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=16)
311-349 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
349-444 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 288, score = 9 + 8
umis assigned: [2, 5]
of which 2 are surviving nonsolos
reads assigned: 76
start codons at 36, 172, 391
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2620 = CGTGAGCGTCAGATAA-1

using 75 reads

====================================================================================

graph has 40 edges initially, 4 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[35, 40]
surviving nonsolo ucounts = 1[40]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2624 = CGTGAGCGTCTCTCTG-1

using 1024 reads

====================================================================================

graph has 437 edges initially, 4 edges after simplification

total ucounts = 98
nonsolo ucounts = 47[2^5, 4^2, 5, 6, 9^2, 11, 12^3, 13^2, 15, 18, 19, 20^5, 21, 22, 23^2, 24, 25^3, 26^2, 27, 29, 30^2, 31, 32, 34, 35, 49^2, 56, 59]
surviving nonsolo ucounts = 39[6, 9^2, 11, 12^3, 13^2, 15, 18, 19, 20^5, 21, 22, 23^2, 24, 25^3, 26^2, 27, 29, 30^2, 31, 32, 34, 35, 49^2, 56, 59]
ids = [18, 29, 49, 64, 56, 66, 72, 52, 93, 25, ...]

====================================================================================

UMI info for barcode CGTGAGCGTCTCTCTG-1 contig 1 = GGGGTCACAA...
umi AACTAGGTGA = 56 reads: +250 -3 +129 non-validated
umi AATTCGTATC = 60 reads: +382 validated
umi ACGGGAAATG = 21 reads: -1 +196 -2 +183 non-validated
umi AGCTTTTTCC = 34 reads: -2 +266 -1 +27 -2 +84 non-validated
umi ATATGGAATA = 26 reads: +115 -2X +1 -1X +76 -6 +125 -32 +1 -1 +22 invalidated
umi CACTACCAGC = 24 reads: +337 -45 non-validated
umi CACTCTGGCT = 6 reads: -78 +3 -1X +67 -1 +74 -158 invalidated
umi CAGGCCCATT = 19 reads: +94 -6 +156 -1 +45 -1 +63 -16 non-validated
umi CCACCCACCT = 25 reads: +46 -1 +1 -1 +4 -1 +9 -37 +212 -55 +15 non-validated
umi CCGCGTATTA = 27 reads: +191 -18 +9 -1X +57 -1 +64 -2 +39 invalidated
umi CGATTAGGTA = 15 reads: +19 -10 +62 -1 +4 -61 +173 -19 +33 non-validated
umi CGCCTCGTTA = 24 reads: +285 -68 +29 non-validated
umi CGCGCATCTC = 9 reads: -11 +5 -2 +2 -2 +4 -1 +2 -1 +1 -1 +6 -1 +101 -62 +5 -1 +1 -1 +79 -7 +78 -8 non-validated
umi CGCGGTTCTC = 23 reads: -66 +307 -9 non-validated
umi CTGCTGCTAT = 52 reads: +19 -2 +70 -2 +3 -2 +1 -1 +2 -1 +226 -2X +1 -10X +9 -1 +30 invalidated
umi CTGTACCTTT = 25 reads: +46 -1 +142 -1X +144 -4 +15 -1 +5 -1 +22 invalidated
umi CTTCAACGAG = 18 reads: +42 -7 +333 non-validated
umi CTTCAGTCTC = 33 reads: +266 -25 +83 -7 +1 non-validated
umi GAGCTACAAT = 21 reads: +24 -1X +226 -11 +1 -1 +1 -2 +115 invalidated
umi GAGGTTTTAG = 9 reads: +66 -8 +56 -66 +185 -1 non-validated
umi GCAGCGGCCG = 22 reads: +284 -36 +62 non-validated
umi GCCGACCACG = 14 reads: -11 +4 -1 +25 -1 +7 -1 +31 -1 +3 -1 +81 -5 +1 -2 +1 -1 +1 -1 +1 -1 +1 -1 +1 -1 +5 -1 +3 -2 +2 -1 +1 -1 +146 -35 non-validated
umi GCCTTGGGCT = 20 reads: -10 +38 -1 +17 -10 +7 -1 +2 -1 +3 -1 +147 -3XX +1 -4X +71 -1 +62 -2 invalidated
umi GCGGTTTTAT = 12 reads: -4 +7 -1 +10 -1 +64 -23 +151 -42 +56 -23 non-validated
umi GGCCATGCGT = 21 reads: -2 +235 -1 +1 -5 +138 non-validated
umi GGGCAATTGT = 11 reads: -4 +104 -41 +83 -14 +1 -1 +1 -1 +7 -1X +1 -1 +2 -1 +1 -1 +3 -1 +1 -1 +4 -1 +1 -2 +5 -1 +10 -1 +5 -81 invalidated
umi GGTACATGAC = 13 reads: +52 -29 +94 -15 +93 -44 +29 -1X +25 invalidated
umi GTAGCGTTCC = 20 reads: +332 -1 +1 -1 +30 -17 non-validated
umi TATTAAGCGT = 31 reads: -37 +338 -7 non-validated
umi TCTCGATGGG = 25 reads: +16 -1 +20 -12 +333 non-validated
umi TGAACTCCTT = 25 reads: +287 -63 +11 -1 +6 -1 +3 -1 +3 -1 +5 non-validated
umi TGGTATCCAA = 29 reads: -11 +330 -2 +39 non-validated
umi TGTTTGATTA = 31 reads: +212 -1 +169 non-validated
umi TTGGTGACTG = 22 reads: -12 +280 -3 +87 non-validated
umi TTGTAAGGGT = 13 reads: +35 -4 +229 -52 +1 -1 +6 -1 +6 -1 +13 -1 +10 -1 +21 non-validated
umi TTGTGGAGCG = 31 reads: +325 -7 +5 -2 +43 non-validated
umi TTTGTGACCT = 31 reads: +316 -10 +56 non-validated

GOOD CONTIGS

TIG 1[bases=631]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=0)
382-420 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
420-631 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 9 umis using 57 reads
cdr3 = CCSYAGSRVF at 362, score = 8 + 8
umis assigned: [1, 4, 5, 7, 9, 17, 18, 19, 20, 22] and 27 others
of which 37 are surviving nonsolos
reads assigned: 880
start codons at 38, 177, 239, 246, 372
confident = true

REJECT CONTIGS

TIG 1[bases=472]
0-61 ==> 18-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
0-62 ==> 5938-6000 on rc of segment after IGHV3-41 exon 1 [len=6000] (mis=5)
25-72 ==> 3154-3201 on rc of segment before IGHV3-33 exon 2 [len=3201] (mis=6)
54-77 ==> 6531-6554 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=0)
61-414 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=1)
428-472 ==> 0-44 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
cdr3 = CAKEPRSRGYFDYW at 403, score = 9 + 6
umis assigned: [35, 72]
of which 2 are surviving nonsolos
reads assigned: 45
start codons at 61, 212, 217, 364
confident = false
VJ delta = 8
not full
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2628 = CGTGAGCGTTAAGAAC-1

using 118 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[117]
surviving nonsolo ucounts = 1[117]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2629 = CGTGAGCGTTATTCTC-1

using 330 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[328]
surviving nonsolo ucounts = 1[328]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=556]
0-34 ==> 18-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-34 ==> 5966-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
34-334 ==> 0-300 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=31)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 34, 83, 462
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2631 = CGTGAGCGTTCTCATT-1

using 89 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 25
nonsolo ucounts = 17[2^3, 3^6, 4^2, 5, 6, 7, 10^2, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2632 = CGTGAGCGTTCTGTTT-1

using 83 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[82]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2634 = CGTGAGCTCAACGGGA-1

using 181 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 178]
surviving nonsolo ucounts = 1[178]
ids = [1]

====================================================================================

UMI info for barcode CGTGAGCTCAACGGGA-1 contig 1 = GTCAGTCCCA...
umi TGCCTCTGTG = 171 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=459]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
411-459 ==> 0-48 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CHQYESVPYTF at 350, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 23, 29, 85, 98, 237, 333, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2637 = CGTGAGCTCACCCTCA-1

using 280 reads

====================================================================================

graph has 206 edges initially, 2 edges after simplification

total ucounts = 21
nonsolo ucounts = 14[2^4, 3, 4, 5, 7^2, 8, 9, 11, 42, 169]
surviving nonsolo ucounts = 1[169]
ids = [17]

====================================================================================

UMI info for barcode CGTGAGCTCACCCTCA-1 contig 1 = CTCAGTCAGG...
umi TCGTCCATAC = 167 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=541]
17-370 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
368-405 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
405-541 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQQSYTTLLTF at 344, score = 9 + 9
umis assigned: [17]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 17, 23, 79, 92, 228, 447
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2639 = CGTGAGCTCACGACTA-1

using 135 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[135]
surviving nonsolo ucounts = 1[135]
ids = [0]

====================================================================================

UMI info for barcode CGTGAGCTCACGACTA-1 contig 1 = GGTAGCTCAG...
umi TTGTTGCCCT = 121 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=498]
0-36 ==> 50-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
36-389 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=13)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
427-498 ==> 0-71 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQSYDNSYHGVF at 363, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 121
start codons at 36, 99, 190, 241, 373, 388
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2646 = CGTGAGCTCCTGCTTG-1

using 330 reads

====================================================================================

graph has 214 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[14, 135, 179]
surviving nonsolo ucounts = 2[135, 179]
ids = [2, 0]

====================================================================================

UMI info for barcode CGTGAGCTCCTGCTTG-1 contig 1 = CTGAGAGAGG...
umi ATTACCGGGC = 175 reads: +424 validated
umi GCAGAAGACG = 131 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=625]
0-75 ==> 4-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
75-428 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
452-499 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
499-625 ==> 0-126 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 2 umis using 38 reads
cdr3 = CARDRAATARLGGMDVW at 417, score = 9 + 7
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 300
start codons at 75, 226, 231, 378, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2650 = CGTGAGCTCGCCTGAG-1

using 133 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2^2, 3, 9, 116]
surviving nonsolo ucounts = 1[116]
ids = [5]

====================================================================================

UMI info for barcode CGTGAGCTCGCCTGAG-1 contig 1 = GAGGAGTCAG...
umi TTTCAGCCAA = 109 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=510]
34-282 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
416-510 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CLHYDNRRRTF at 355, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 108
start codons at 34, 90, 103, 242, 365, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2653 = CGTGAGCTCGGAAATA-1

using 349 reads

====================================================================================

graph has 146 edges initially, 14 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[95^2, 158]
surviving nonsolo ucounts = 3[95^2, 158]
ids = [2, 3, 0]

====================================================================================

UMI info for barcode CGTGAGCTCGGAAATA-1 contig 1 = AGCTGTGGGC...
umi GAGTTCCTGT = 89 reads: +385 validated

UMI info for barcode CGTGAGCTCGGAAATA-1 contig 2 = AGTCTGGGCC...
umi AAAGCCTCTT = 154 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=569]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=10)
387-425 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=5)
425-569 ==> 0-144 on |305|IGLC1|C-REGION| [len=317] (mis=5)
junction support: 1 umis using 12 reads
cdr3 = CNSRDSSNNHLGVF at 355, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 89
start codons at 40, 159, 188, 239, 338
confident = false

TIG 2[bases=566]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-385 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=1)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
422-566 ==> 0-144 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 32 reads
cdr3 = CQVWDSSSDHVVF at 355, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 152
start codons at 40, 101, 239, 242, 338, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2656 = CGTGAGCTCTAACTCT-1

using 205 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[203]
surviving nonsolo ucounts = 1[203]
ids = [0]

====================================================================================

UMI info for barcode CGTGAGCTCTAACTCT-1 contig 1 = AGTCCCACTC...
umi CGGTTCGGCT = 184 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=472]
0-20 ==> 7-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=0)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
408-472 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CLQHNSYPLTF at 347, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 180
start codons at 20, 26, 95, 177, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2659 = CGTGAGCTCTCTTGAT-1

using 209 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 203]
surviving nonsolo ucounts = 1[203]
ids = [2]

====================================================================================

UMI info for barcode CGTGAGCTCTCTTGAT-1 contig 1 = CCAGCCCTGA...
umi CCATTGGTTT = 186 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=510]
0-62 ==> 0-62 on |115|IGHV3-20|5'UTR| [len=62] (mis=0)
62-415 ==> 0-353 on |116|IGHV3-20|L-REGION+V-REGION| [len=353] (mis=1)
434-480 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
480-510 ==> 0-30 on |60|IGHM|C-REGION| [len=1358] (mis=1)
junction support: 1 umis using 15 reads
cdr3 = CARDLGGYLGPFGYW at 404, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 182
start codons at 62, 207, 213, 218, 279, 297, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2662 = CGTGAGCTCTGGTATG-1

using 254 reads

====================================================================================

graph has 112 edges initially, 10 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 103, 147]
surviving nonsolo ucounts = 2[103, 147]
ids = [1, 2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2664 = CGTGAGCTCTTGAGAC-1

using 167 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[15, 147]
surviving nonsolo ucounts = 1[147]
ids = [0]

====================================================================================

UMI info for barcode CGTGAGCTCTTGAGAC-1 contig 1 = ATCAGTCCCA...
umi ACTCATGGCT = 126 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=465]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-465 ==> 0-54 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2670 = CGTGTAAAGCACCGTC-1

using 3834 reads

====================================================================================

graph has 3880 edges initially, 80 edges after simplification

total ucounts = 1516
nonsolo ucounts = 732[2^370, 3^199, 4^68, 5^40, 6^21, 7^3, 8^2, 9^4, 19^2, 21, 22, 23, 24, 31^2, 32, 33, 35, 36, 37, 40, 42, 44, 46^2, 49, 54, 61, 65, 72, 79, 81]
surviving nonsolo ucounts = 24[9, 19^2, 21, 22, 23, 24, 31^2, 32, 33, 35, 36, 37, 40, 42, 44, 46^2, 49, 54, 61, 65, 72]
ids = [525, 262, 650, 384, 204, 841, 894, 1427, 1472, 850, ...]

====================================================================================

UMI info for barcode CGTGTAAAGCACCGTC-1 contig 1 = CCTCCAGGCC...
umi ACCTGTACTC = 60 reads: +397 validated
umi ACTTTCTAGG = 23 reads: +3 -16 +281 -1X +53 -1 +16 -1 +13 -1 +11 invalidated
umi AGTCCGAGGG = 19 reads: +328 -21 +1 -2 +10 -1 +8 -1 +1 -2 +1 -1 +1 -2 +17 non-validated
umi CAACATCGGC = 22 reads: +4 -1 +9 -1 +3 -1X +1 -2X +2 -2X +2 -13X +2 -3XX +1 -1XX +349 invalidated
umi CCGCCTTGAC = 8 reads: -34 +14 -1 +41 -127 +5 -1 +5 -2 +1 -1 +3 -1 +3 -2 +112 -1 +20 -12 +11 non-validated
umi CGCGAAACAG = 41 reads: +371 -23 +3 non-validated
umi CTAATCATTA = 34 reads: +343 -1 +39 -1X +13 invalidated
umi CTACAAGTCT = 20 reads: +47 -7 +3 -1X +161 -1 +27 -94 +56 invalidated
umi CTTCGTCCCG = 45 reads: +340 -1 +2 -1 +39 -1 +13 non-validated
umi GCGCTACAGG = 37 reads: -5 +337 -3 +8 -1 +1 -42 non-validated
umi GCGGCACACG = 22 reads: -5 +347 -40 +5 non-validated
umi GCGTTCTCGT = 32 reads: +397 validated
umi GCTTGGGATA = 47 reads: +397 validated
umi GTAGTATGTC = 33 reads: +204 -32 +6 -1 +106 -1 +47 non-validated
umi TAAATTCATA = 54 reads: +355 -1 +41 non-validated
umi TCTACATCTC = 43 reads: +121 -1XX +275 invalidated
umi TGCTTGGTCC = 36 reads: +54 -61 +1 -5X +1 -5XX +270 invalidated
umi TGGTAACCAC = 47 reads: -7 +8 -1 +3 -1 +377 non-validated
umi TTGCATATTA = 33 reads: +4 -1 +127 -1XX +163 -1 +100 invalidated
umi TTTGCCAGAG = 66 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=621]
0-88 ==> 87-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
88-243 ==> 0-155 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
243-440 ==> 158-355 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=8)
447-485 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
485-621 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 13 umis using 76 reads
cdr3 = CQQYYTHVWTF at 424, score = 9 + 8
umis assigned: [144, 204, 262, 384, 525, 589, 648, 650, 724, 839] and 10 others
of which 20 are surviving nonsolos
reads assigned: 707
start codons at 88, 157, 304, 350, 407, 443, 527
confident = true
see deletion of 3 bases at pos 155 on |296|IGKV4-1|L-REGION+V-REGION|

REJECT CONTIGS

TIG 1[bases=355]
0-153 ==> 957-1110 on rc of segment before IGHD3-16 exon 1 [len=1110] (mis=1)
236-284 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
284-355 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [217, 396, 894]
of which 3 are surviving nonsolos
reads assigned: 89
start codons at 4, 63, 180
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2682 = CGTGTAACAAGCCTAT-1

using 58 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 54]
surviving nonsolo ucounts = 1[54]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=361]
0-120 ==> 21-141 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=0)
120-226 ==> 234-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=0)
239-277 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
277-361 ==> 0-84 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CCSYAGSSTFVVF at 210, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 46
start codons at 118, 220
confident = false
not full
VJ delta = 99
delta too large
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2683 = CGTGTAACAAGCGTAG-1

using 485 reads

====================================================================================

graph has 322 edges initially, 4 edges after simplification

total ucounts = 92
nonsolo ucounts = 39[2^11, 3^3, 5, 6, 7^5, 8^2, 9^2, 15^2, 16, 17, 18, 19, 21^3, 22, 23, 28, 31, 54]
surviving nonsolo ucounts = 23[6, 7^4, 8^2, 9^2, 15^2, 16, 17, 18, 19, 21^3, 22, 23, 28, 31, 54]
ids = [33, 11, 15, 44, 48, 20, 62, 43, 63, 14, ...]

====================================================================================

UMI info for barcode CGTGTAACAAGCGTAG-1 contig 1 = GCTCTGCTTC...
umi AATAGTGGCA = 1 reads: -7 +2 -1 +10 -1 +12 -1 +9 -2 +1 -1 +4 -1 +1 -1 +1 -2 +4 -1 +1 -328 non-validated
umi AATGAGCCGG = 18 reads: -20 +273 -30 +30 -1 +37 non-validated
umi ACCATTGTTG = 17 reads: +141 -1 +93 -12 +99 -7 +38 non-validated
umi ACCGGATGGG = 7 reads: +1 -1 +5 -1 +95 -47 +56 -13 +72 -64 +7 -1X +10 -1 +9 -1 +1 -2 +4 invalidated
umi AGACACCCCT = 7 reads: +34 -24 +129 -1 +2 -2 +1 -1 +1 -1 +12 -1 +1 -2 +57 -67 +55 non-validated
umi ATAAACGGAT = 8 reads: +2 -1 +6 -1 +23 -1 +4 -26 +56 -1 +14 -1 +59 -4 +57 -16 +1 -1 +17 -1 +1 -1 +2 -1 +14 -1 +68 -11 non-validated
umi CCAATCTCGT = 6 reads: -59 +124 -33 +56 -63 +56 non-validated
umi GAGCTGTTAA = 17 reads: +247 -1 +38 -1 +27 -1 +1 -31 +44 non-validated
umi GCGTTCAATC = 31 reads: +190 -1 +1 -3 +19 -1 +1 -2 +9 -1 +5 -29 +1 -1 +127 non-validated
umi TCTATAGACG = 17 reads: -11 +29 -1X +26 -12 +312 invalidated
umi TTAATTTCGT = 22 reads: +277 -3 +2 -2X +1 -1 +2 -4X +1 -2 +1 -2 +1 -1 +91 invalidated
umi TTGTGGCTCC = 26 reads: -2 +320 -26 +43 non-validated

GOOD CONTIGS

TIG 1[bases=525]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=15)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
442-525 ==> 0-83 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 14 reads
cdr3 = CQSYDSSLSGAVF at 375, score = 7 + 8
umis assigned: [5, 7, 10, 11, 15, 20, 33, 52, 59, 82] and 2 others
of which 11 are surviving nonsolos
reads assigned: 175
start codons at 51, 208, 259, 358, 385
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2692 = CGTGTAACAGCTGCAC-1

using 17 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 1[17]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2695 = CGTGTAACATACCATG-1

using 2867 reads

====================================================================================

graph has 1110 edges initially, 20 edges after simplification

total ucounts = 130
nonsolo ucounts = 70[2^7, 3, 4^4, 5^2, 9, 10^2, 11, 15, 17, 18, 20^2, 23^3, 25, 26, 27^2, 31^2, 33, 34, 37, 38, 39^3, 40, 43, 44^2, 45^2, 50^2, 51, 55^2, 56, 57^2, 58, 62^2, 63, 65, 66, 68, 73, 75, 78, 79, 93, 100, 113, 115, 127, 150]
surviving nonsolo ucounts = 53[10, 11, 15, 17, 18, 20^2, 23^2, 25, 26, 27^2, 31^2, 33, 34, 37, 38, 39^3, 40, 43, 44^2, 45^2, 50^2, 51, 55^2, 56, 57^2, 58, 62^2, 63, 65, 66, 68, 73, 75, 78, 79, 93, 100, 113, 115, 127, 150]
ids = [24, 75, 44, 123, 4, 18, 125, 113, 115, 102, ...]

====================================================================================

UMI info for barcode CGTGTAACATACCATG-1 contig 1 = GAGCTCACAT...
umi AACGTTTGGC = 29 reads: -439 non-validated
umi AATCTAGATC = 18 reads: -90 +56 -275 +1 -3X +1 -2XX +2 -5XX +1 -2XX +1 invalidated
umi ACCCTAACCT = 56 reads: +415 -24 non-validated
umi ACCTGTCTTT = 41 reads: +383 -30 +26 non-validated
umi AGTACCCTCC = 63 reads: +5 -1 +19 -1 +341 -1 +7 -1XX +48 -15 invalidated
umi ATACACGGCA = 35 reads: +342 -97 non-validated
umi ATGCCACTTC = 74 reads: +439 validated
umi ATTGACTCCT = 30 reads: -2 +345 -27 +2 -1 +12 -1X +47 -2 invalidated
umi CCAGAAGGTA = 15 reads: -28 +222 -1 +29 -26 +56 -22 +21 -1 +33 non-validated
umi CCCACATCTG = 37 reads: +213 -18 +154 -42 +12 non-validated
umi CGTGGCTTGT = 44 reads: +381 -58 non-validated
umi CTAGTCGGAA = 65 reads: +437 -2 non-validated
umi GTCCAATGCT = 66 reads: +439 validated
umi TAGTCAATAG = 43 reads: +311 -2 +120 -6 non-validated
umi TATATATACC = 31 reads: +35 -20 +384 non-validated
umi TCAAGGGGCC = 28 reads: +52 -1X +266 -28 +92 invalidated
umi TCACCGTTTA = 109 reads: +155 -2XX +1 -2XX +1 -1XX +1 -1XX +1 -270XX +1 -2X +1 invalidated
umi TCGGGTCTCA = 32 reads: -439 non-validated
umi TGCATTCTCA = 25 reads: -92 +247 -4X +2 -4X +30 -60 invalidated
umi TGCTGCCGCA = 58 reads: +383 -1 +53 -2 non-validated
umi TGTCTCGTTC = 60 reads: +143 -296 non-validated
umi TTACTGCCAC = 23 reads: +264 -45 +59 -1 +3 -30 +34 -1 +2 non-validated
umi TTATCCGTCC = 23 reads: -16 +202 -3 +12 -1 +110 -1 +1 -1 +11 -1 +5 -1 +1 -1 +3 -1 +6 -1 +5 -14 +42 non-validated
umi TTCCAAGGCC = 37 reads: -8 +3 -1 +1 -1 +1 -1 +9 -1 +355 -1 +33 -24 non-validated
umi TTTACGCCGC = 43 reads: +439 validated
umi TTTTAGCCCG = 18 reads: -30 +6 -1 +255 -21 +56 -1 +2 -1X +3 -6 +9 -1 +1 -1 +1 -1 +1 -1X +2 -1 +10 -1 +6 -1 +18 -2 invalidated
umi TTTTCACTCT = 58 reads: +339 -7X +1 -2 +29 -61 invalidated
umi TTTTCAGCCC = 52 reads: +345 -1XX +59 -1 +22 -11 invalidated

UMI info for barcode CGTGTAACATACCATG-1 contig 2 = GAGGAGTCAG...
umi AGCTTCAGGC = 21 reads: -22 +8 -1 +167 -1 +1 -1 +3 -1 +1 -4 +3 -1 +4 -4 +5 -2X +5 -1 +1 -46 +4 -1 +101 invalidated
umi AGGTCACTGC = 100 reads: -8 +5 -1 +374 non-validated
umi AGTGTACCAT = 66 reads: +379 -9 non-validated
umi ATCCCATCGT = 67 reads: +388 validated
umi CATCAGCTGC = 74 reads: +388 validated
umi CCATGTGGGT = 40 reads: +3 -1 +384 non-validated
umi CCCTCCGCTG = 40 reads: -12 +1 -1 +3 -1 +2 -1 +4 -1 +312 -21 +17 -1 +11 non-validated
umi CGTCGGTTGG = 27 reads: +11 -6 +313 -38 +20 non-validated
umi CGTTCTACCC = 57 reads: +387 -1 non-validated
umi GAATGGTGCG = 55 reads: +388 validated
umi TAGGTCCCCC = 44 reads: +388 validated
umi TCCACCTCAG = 57 reads: +386 -1 +1 non-validated
umi TTATTTAAGG = 63 reads: -1 +387 non-validated
umi TTCCACGCCA = 79 reads: +20 -18 +350 non-validated
umi TTTGCGCGCG = 17 reads: -10 +56 -7 +163 -1 +56 -22 +8 -1 +1 -1 +4 -2 +2 -1 +4 -2 +1 -1 +8 -1 +2 -1 +11 -1 +1 -2 +1 -14 +3 non-validated

GOOD CONTIGS

TIG 1[bases=541]
0-31 ==> 0-31 on |185|IGHV4-34|5'UTR| [len=31] (mis=1)
31-402 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=14)
436-470 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=1)
470-541 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 34 reads
cdr3 = CARGAVRSVILSIDSW at 391, score = 9 + 7
umis assigned: [1, 4, 9, 12, 23, 26, 31, 32, 44, 47] and 18 others
of which 28 are surviving nonsolos
reads assigned: 1191
start codons at 8, 31, 52, 96, 182
confident = true

TIG 2[bases=552]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=14)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 112 reads
cdr3 = CQQTHSTPRTF at 355, score = 9 + 8
umis assigned: [18, 20, 25, 29, 42, 46, 49, 53, 55, 70] and 5 others
of which 15 are surviving nonsolos
reads assigned: 798
start codons at 28, 34, 90, 103, 239, 458
confident = true
now this is a cell
paired!

GCGGACACGGCTGTGTATTACTGTGCGAGGGGGGCTGTCCGGTCTGTCATATTAAGTATTGACTCGTGGGGCCAGGGAACCCTGGTCACCGTCTCGTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGACTCATAGTACCCCTCGAACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2701 = CGTGTAAGTACCGAGA-1

using 120 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[35, 85]
surviving nonsolo ucounts = 2[35, 85]
ids = [1, 0]

====================================================================================

UMI info for barcode CGTGTAAGTACCGAGA-1 contig 1 = TGATCAGCAC...
umi ACATAACAGG = 81 reads: +424 validated
umi CACTATGTAC = 33 reads: +279 -1 +2 -1 +109 -1 +1 -2 +2 -2 +1 -1 +4 -1 +3 -1 +13 non-validated

GOOD CONTIGS

TIG 1[bases=473]
0-29 ==> 50-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
29-382 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
406-453 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
junction support: 2 umis using 18 reads
cdr3 = CARDRAATARLGGMDVW at 371, score = 9 + 7
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 114
start codons at 29, 180, 185, 332, 410
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2702 = CGTGTAAGTACTTAGC-1

using 73 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 71]
surviving nonsolo ucounts = 1[71]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=358]
0-276 ==> 77-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=0)
296-344 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
cdr3 = CARDPPEYSGFPFDYW at 265, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 41
start codons at 79, 121, 187, 220
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2703 = CGTGTAAGTCACCCAG-1

using 137 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[136]
surviving nonsolo ucounts = 1[136]
ids = [0]

====================================================================================

UMI info for barcode CGTGTAAGTCACCCAG-1 contig 1 = GAGGAGTCAG...
umi AGATCCTCCT = 123 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=499]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
381-413 ==> 6-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
413-499 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQQSYSTPQF at 355, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 120
start codons at 28, 34, 90, 103, 239, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2707 = CGTGTAAGTCTACCTC-1

using 37 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[37]
surviving nonsolo ucounts = 1[37]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=391]
0-338 ==> 15-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
335-373 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
cdr3 = CAAWDDSLNGYVF at 306, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 33
start codons at 289, 314, 319, 331, 337
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2712 = CGTGTAAGTTCCATGA-1

using 146 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[146]
surviving nonsolo ucounts = 1[146]
ids = [0]

====================================================================================

UMI info for barcode CGTGTAAGTTCCATGA-1 contig 1 = AGACCCACTC...
umi TTTACATCTC = 146 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 9-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
20-371 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=7)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 25 reads
cdr3 = CLQDDNYPRTF at 347, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 143
start codons at 20, 26, 82, 95, 177, 231, 357
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2737 = CGTGTAATCGTTGCCT-1

using 10394 reads

====================================================================================

graph has 3216 edges initially, 30 edges after simplification

total ucounts = 379
nonsolo ucounts = 258[2^31, 3^6, 4^4, 6^3, 7^2, 8, 9, 11^2, 12, 13^3, 14, 15^3, 16, 18^7, 19^5, 20^2, 21, 22^3, 23, 24, 25^2, 26^5, 28^2, 29^3, 30^2, 31^6, 32^2, 33^3, 34^6, 35, 36^5, 37^4, 38^2, 39^7, 40^4, 41^5, 42^4, 43, 44^6, 45^6, 46^3, 47^4, 48^4, 49^5, 50^3, 51^2, 52^5, 53, 54^4, 55^3, 56^3, 57^6, 58, 59^6, 60, 62^4, 63^3, 64, 65^4, 66, 67^4, 68^3, 69^2, 72^3, 73^3, 75, 76^2, 77, 80^2, 81^3, 82, 84, 86, 88, 94, 97, 100, 101, 106, 107, 112, 113, 124, 131, 132]
surviving nonsolo ucounts = 203[12, 13^3, 15^2, 18^6, 19^4, 20^2, 21, 22^3, 23, 24, 25^2, 26^5, 28^2, 29^3, 30^2, 31^6, 32^2, 33^3, 34^6, 35, 36^5, 37^4, 38^2, 39^7, 40^4, 41^5, 42^4, 43, 44^6, 45^6, 46^3, 47^4, 48^4, 49^5, 50^3, 51^2, 52^5, 53, 54^4, 55^3, 56^3, 57^6, 58, 59^6, 60, 62^4, 63^3, 64, 65^4, 66, 67^4, 68^3, 69^2, 72^3, 73^3, 75, 76^2, 77, 80^2, 81^3, 82, 84, 86, 88, 94, 97, 100, 101, 106, 107, 112, 113, 124, 131, 132]
ids = [353, 31, 253, 283, 163, 360, 47, 68, 82, 301, ...]

====================================================================================

UMI info for barcode CGTGTAATCGTTGCCT-1 contig 1 = AGCCCTCAGA...
umi AAATCGTTGA = 39 reads: +99 -1XX +240 -2 +1 -1 +1 -1 +2 -1 +14 -1 +1 -8 +56 -1 invalidated
umi AACATGTTAC = 35 reads: +219 -1 +72 -2 +136 non-validated
umi AATGGCGGGT = 13 reads: -430 non-validated
umi ACTTGGCTGC = 56 reads: +99 -1XX +140 -1XX +111 -22 +12 -2 +42 invalidated
umi AGAACATGCT = 22 reads: +7 -2 +90 -1XX +315 -15 invalidated
umi AGCGTGATAA = 109 reads: +1 -1XX +6 -1XX +6 -1XX +2 -8XX +1 -378X +1 -3X +1 -7XX +1 -3XX +1 -3XX +2 -1XX +2 invalidated
umi AGGAAGCCCG = 21 reads: -4 +42 -1XX +88 -2 +5 -2 +37 -8X +35 -1XX +119 -12 +57 -1 +3 -13 invalidated
umi ATCTTTACTT = 129 reads: +46 -4XX +2 -1XX +1 -13XX +1 -342X +3 -1XX +3 -1XX +1 -2XX +1 -1XX +1 -4XX +2 invalidated
umi CGACGTGCGT = 36 reads: +430 validated
umi CGGGCACCGT = 15 reads: +163 -21 +67 -1X +23 -1 +4 -2X +6 -1 +3 -1 +1 -1 +4 -1 +33 -1 +22 -41 +33 invalidated
umi GCCATTATGG = 31 reads: +224 -1XX +34 -1 +51 -8 +87 -24 invalidated
umi GCCCGATTAC = 26 reads: +4 -1 +88 -1 +284 -1 +19 -2 +4 -1 +7 -18 non-validated
umi GGTCATCCTG = 32 reads: +224 -1XX +88 -1 +51 -65 invalidated
umi GTCATGCACT = 14 reads: +99 -1XX +27 -45 +30 -1 +25 -12 +4 -1 +2 -1 +2 -1 +2 -1 +3 -1 +57 -115 invalidated
umi TAAAACGCTC = 42 reads: -19 +80 -1XX +217 -113 invalidated
umi TAAAGTTGGC = 35 reads: +290 -5 +1 -1 +10 -1 +112 -10 non-validated
umi TACGCGTTTC = 14 reads: +49 -24 +26 -1XX +116 -28 +58 -1 +17 -11 +56 -43 invalidated
umi TATCACTCCT = 44 reads: +224 -1XX +151 -54 invalidated
umi TCCCCATGTA = 50 reads: +99 -1XX +262 -46 +22 invalidated
umi TCCCTTCTGT = 23 reads: -9 +90 -1XX +115 -11 +5 -1 +114 -15 +54 -1 +1 -13 invalidated
umi TGCACCGCAA = 92 reads: +1 -1X +4 -403X +1 -7X +1 -3X +1 -3X +2 -1X +2 invalidated
umi TTAGCGCCGT = 12 reads: -85 +2 -1 +4 -1 +3 -1 +213 -120 non-validated
umi TTCAGCGTCC = 43 reads: +224 -1XX +60 -1 +3 -1 +8 -1 +11 -24 +94 -2 invalidated

UMI info for barcode CGTGTAATCGTTGCCT-1 contig 2 = TGGGGAGGAG...
umi AAACGCTGGT = 65 reads: +382 validated
umi AACATTGTGC = 25 reads: +43 -9 +16 -1 +210 -1X +102 invalidated
umi AACCAGTCAG = 39 reads: +362 -20 non-validated
umi AACCTGACTG = 55 reads: +382 validated
umi AACGCATCCC = 58 reads: +346 -5 +31 non-validated
umi AACGTAGTTC = 19 reads: -7 +171 -3 +2 -1 +198 non-validated
umi AACGTTTTGG = 42 reads: +367 -15 non-validated
umi AACTTGTTCG = 46 reads: +382 validated
umi AAGACCCCGT = 34 reads: +362 -1 +19 non-validated
umi AATAGCGCGG = 63 reads: +382 validated
umi AATCCATCCG = 87 reads: +382 validated
umi ACAGTCCGGG = 29 reads: +71 -1 +231 -1 +32 -1 +7 -11 +27 non-validated
umi ACCCTATCGT = 71 reads: +382 validated
umi ACCCTCCGCC = 40 reads: +382 validated
umi ACCTCCAGTT = 38 reads: +13 -22 +322 -25 non-validated
umi ACGATCAGAC = 64 reads: +382 validated
umi ACTCTGTGGC = 18 reads: -16 +231 -7 +107 -21 non-validated
umi ACTGTAAGCC = 43 reads: +227 -1 +154 non-validated
umi AGAACCCCGC = 41 reads: +346 -26 +10 non-validated
umi AGACGCGAAC = 38 reads: +5 -1 +376 non-validated
umi AGAGCGTAGG = 47 reads: +382 validated
umi AGCAAGGTGA = 61 reads: +382 validated
umi AGCATATAGC = 44 reads: +367 -15 non-validated
umi AGCCCCAACG = 42 reads: +382 validated
umi AGCTAACACC = 52 reads: +382 validated
umi AGGTCAATTT = 99 reads: +363 -1 +18 non-validated
umi ATACACTCAC = 40 reads: +382 validated
umi ATATATTACC = 51 reads: +382 validated
umi ATATCACATT = 30 reads: +31 -14 +288 -1 +10 -1 +1 -1 +35 non-validated
umi ATCACACTCT = 105 reads: +382 validated
umi ATCGATCGGG = 66 reads: +382 validated
umi ATCGGAAGTT = 18 reads: -59 +2 -1 +320 non-validated
umi ATCTCCATCC = 55 reads: +382 validated
umi ATGAAGCTTC = 31 reads: -14 +29 -1 +338 non-validated
umi ATGATCAGAT = 47 reads: +254 -1 +127 non-validated
umi ATTAACGATG = 48 reads: +371 -11 non-validated
umi ATTCTTACCG = 40 reads: +375 -7 non-validated
umi ATTGCATACG = 62 reads: -4 +378 non-validated
umi ATTGTGCGGC = 83 reads: +382 validated
umi ATTTGGAGCT = 62 reads: +382 validated
umi CAAATTCATT = 39 reads: -2 +5 -1 +12 -1 +2 -2 +25 -1 +7 -5 +319 non-validated
umi CAACAGGACG = 20 reads: -5 +184 -1 +22 -46 +83 -18 +2 -1 +20 non-validated
umi CAATCGCCCC = 26 reads: -22 +360 non-validated
umi CAATCTGCCC = 42 reads: +321 -61 non-validated
umi CACAGCGAGC = 69 reads: +382 validated
umi CACCGAACAT = 99 reads: +382 validated
umi CACGGAGGGC = 50 reads: +11 -14 +357 non-validated
umi CACTCTGAGG = 48 reads: +359 -1 +2 -1X +15 -3 +1 invalidated
umi CAGCAAAGGT = 67 reads: +382 validated
umi CAGCATTGGC = 34 reads: +346 -3 +33 non-validated
umi CAGTACCGCT = 63 reads: -15 +367 non-validated
umi CATCTGCGGT = 46 reads: +382 validated
umi CATTTAGCTG = 32 reads: +72 -6 +4 -2X +180 -18 +100 invalidated
umi CCATGAATCT = 63 reads: +344 -1 +37 non-validated
umi CCCGCCTTTT = 30 reads: +259 -6 +56 -9 +14 -1 +7 -1 +29 non-validated
umi CCCGGGACTA = 47 reads: +244 -1 +1 -9 +1 -1 +1 -2 +3 -1X +20 -1 +3 -1 +4 -1 +88 invalidated
umi CCCGTATCCC = 49 reads: +382 validated
umi CCCGTGGACC = 45 reads: +28 -17 +284 -14 +1 -1 +3 -1 +1 -1 +1 -1 +10 -1 +18 non-validated
umi CCGACTCCTT = 34 reads: +351 -1 +3 -27 non-validated
umi CCTACAACCT = 68 reads: +9 -7 +366 non-validated
umi CCTTGCCTTT = 110 reads: +382 validated
umi CGAATTCCAT = 43 reads: +382 validated
umi CGACTACGTT = 73 reads: +382 validated
umi CGATTAGCTG = 133 reads: +382 validated
umi CGCATGTCGG = 54 reads: +362 -1 +19 non-validated
umi CGCTATCATT = 55 reads: -377 +5 non-validated
umi CGCTCCGTTA = 42 reads: +322 -6X +1 -8X +1 -4 +1 -7 +1 -1 +1 -2 +27 invalidated
umi CGGCTGTTTG = 82 reads: -23X +3 -1XX +355 invalidated
umi CGGGTCCTTT = 19 reads: -11 +39 -1 +78 -7 +1 -2 +8 -1 +5 -1 +228 non-validated
umi CGTGTTCCGA = 37 reads: +360 -1X +2 -1X +1 -6X +1 -4X +1 -1X +2 -2X invalidated
umi CGTTTACCCT = 63 reads: +7 -1 +16 -1 +319 -1 +17 -1 +8 -1 +4 -1 +5 non-validated
umi CTAGCGCACC = 20 reads: -20 +169 -1X +6 -5 +1 -1 +3 -1 +3 -2X +2 -1 +1 -1 +78 -21 +66 invalidated
umi CTCCATTTAG = 30 reads: -22 +317 -1 +2 -1 +3 -15 +21 non-validated
umi CTCCTAGGAC = 59 reads: +320 -16 +8 -1 +37 non-validated
umi CTCGGTACAC = 44 reads: +273 -24 +85 non-validated
umi CTGACCAGCC = 19 reads: -30 +8 -1 +11 -1 +136 -19 +176 non-validated
umi CTGATTTCAG = 83 reads: +352 -1 +29 non-validated
umi CTGCTCAGGT = 49 reads: +382 validated
umi CTGGCGTGGT = 73 reads: +382 validated
umi CTGTTCTCTG = 35 reads: +356 -2 +8 -16 non-validated
umi CTGTTTACGC = 49 reads: +382 validated
umi CTTCTCCCAG = 27 reads: +372 -10 non-validated
umi CTTGCGCTTC = 19 reads: +254 -47 +81 non-validated
umi CTTGGATCGT = 42 reads: +358 -24 non-validated
umi CTTTATTCGG = 53 reads: -5 +377 non-validated
umi CTTTTGCTTC = 43 reads: +341 -8 +33 non-validated
umi GAAAAGCCTC = 77 reads: +382 validated
umi GAAAGGAGGT = 52 reads: +382 validated
umi GAAATGGATC = 51 reads: -41 +341 non-validated
umi GAAGCACCGG = 78 reads: +382 validated
umi GACCTTTTTT = 22 reads: -295 +8 -1 +29 -1 +48 non-validated
umi GACTCCGAAT = 57 reads: +382 validated
umi GATCGGCGGT = 56 reads: +162 -1XX +101 -25 +8 -1 +25 -1 +35 -1 +1 -3 +12 -1 +5 invalidated
umi GCAATAACCA = 33 reads: +110 -1XX +212 -1 +33 -25 invalidated
umi GCACTGTGCC = 41 reads: +382 validated
umi GCCATTTCTC = 59 reads: +382 validated
umi GCCTATCGCA = 35 reads: +286 -1 +2 -1 +3 -3 +2 -2 +4 -1 +3 -2 +2 -1 +13 -1 +3 -1 +2 -1 +1 -1 +3 -1 +3 -1 +3 -1 +2 -1 +21 -7 +1 -2 non-validated
umi GCCTGTAGTT = 31 reads: +382 validated
umi GCGAACTCGG = 84 reads: +382 validated
umi GCGTATGCTA = 44 reads: -7 +335 -1 +1 -1 +1 -1 +3 -1 +4 -1 +1 -1 +5 -9X +1 -4X +1 -1X +3 invalidated
umi GCTCCGTCGG = 22 reads: -10 +338 -34 non-validated
umi GCTGTACACG = 61 reads: +382 validated
umi GCTTCAGTCG = 119 reads: -29X +58 -1XX +45 -1XX +1 -3XX +2 -6XX +1 -61XX +1 -6XX +1 -1XX +2 -8XX +65 -1XX +89 invalidated
umi GGACTACCGT = 48 reads: +327 -1 +16 -1 +18 -1 +18 non-validated
umi GGACTTCCGT = 49 reads: +382 validated
umi GGATCTTTTG = 82 reads: +382 validated
umi GGCGAGAGGC = 63 reads: +362 -20 non-validated
umi GGCTTGTTTC = 70 reads: +382 validated
umi GGGGACCTTC = 56 reads: +336 -1 +2 -1 +4 -1 +5 -1 +4 -1 +3 -1 +20 -2 non-validated
umi GGGTTACTTA = 39 reads: -5 +377 non-validated
umi GGTTACGACG = 52 reads: +332 -2X +10 -1 +9 -1 +1 -1X +1 -1X +23 invalidated
umi GTAGGCCGCA = 37 reads: +87 -1XX +138 -1XX +65 -1XX +35 -54 invalidated
umi GTATCTCTTA = 56 reads: +73 -1X +7 -1X +1 -3X +296 invalidated
umi GTCCGAAGCC = 59 reads: +333 -1 +48 non-validated
umi GTCGCATCTG = 38 reads: +20 -2 +360 non-validated
umi GTCTACGCAC = 70 reads: +382 validated
umi GTCTCAGCTA = 77 reads: +382 validated
umi GTTACTTGCA = 47 reads: +103 -1 +278 non-validated
umi GTTAGTCCGC = 102 reads: +382 validated
umi GTTATCCTCC = 42 reads: +382 validated
umi GTTCCTAAGT = 58 reads: +382 validated
umi GTTGCTGGCA = 58 reads: +382 validated
umi TAAACACTCC = 53 reads: +382 validated
umi TAATAGGCTC = 40 reads: -24 +358 non-validated
umi TAATCCGTCA = 26 reads: +223 -8 +3 -1 +75 -12 +18 -1XX +41 invalidated
umi TAATTTCGCT = 32 reads: +350 -32 non-validated
umi TACGTTTCCC = 35 reads: +382 validated
umi TACTAACCAG = 40 reads: +382 validated
umi TAGCTATCTG = 33 reads: +319 -4 +4 -1 +5 -1 +25 -1 +19 -3 non-validated
umi TAGTGCCGTA = 29 reads: -5 +1 -1 +278 -6 +91 non-validated
umi TATAGGTATA = 59 reads: +382 validated
umi TATTTACATT = 83 reads: +382 validated
umi TCAATACACT = 46 reads: -13 +23 -1 +345 non-validated
umi TCACAACAGG = 17 reads: -16 +34 -1 +21 -6 +14 -1 +184 -32 +73 non-validated
umi TCAGCACAGG = 74 reads: +382 validated
umi TCAGCTTGGA = 56 reads: +382 validated
umi TCAGTATCTT = 52 reads: +382 validated
umi TCAGTATTTG = 132 reads: +382 validated
umi TCAGTTTTCT = 25 reads: -3 +343 -19 +17 non-validated
umi TCATAAGCGG = 55 reads: +382 validated
umi TCCATGTGGA = 38 reads: +382 validated
umi TCCCTCCCAA = 38 reads: +335 -27 +20 non-validated
umi TCCCTCGGCC = 57 reads: +382 validated
umi TCCGTTCGTA = 67 reads: +382 validated
umi TCCTTATACC = 39 reads: +34 -3 +345 non-validated
umi TCCTTTGGGT = 38 reads: +35 -8 +1 -1 +4 -1X +1 -2 +2 -1 +326 invalidated
umi TCGACCTAGC = 68 reads: +333 -1 +48 non-validated
umi TCGATACTAA = 54 reads: +357 -1X +1 -1 +2 -1 +12 -7 invalidated
umi TCGCAGTTGT = 64 reads: +382 validated
umi TCGGATATTG = 75 reads: +362 -1 +18 -1 non-validated
umi TCGGCGTGCA = 67 reads: -365 +17 non-validated
umi TCGTCCCCCT = 41 reads: +357 -1 +1 -1 +22 non-validated
umi TCGTTCGTCT = 50 reads: +357 -25 non-validated
umi TCTCACACCT = 90 reads: +382 validated
umi TCTCTACAAG = 31 reads: -22 +148 -1 +211 non-validated
umi TCTCTGTCAT = 46 reads: +339 -1XX +42 invalidated
umi TCTGATCATT = 35 reads: +123 -1 +258 non-validated
umi TGAATAACTC = 49 reads: +382 validated
umi TGCCGAGCTG = 18 reads: -6 +136 -1 +151 -7 +81 non-validated
umi TGCCGGTTGC = 24 reads: -7 +375 non-validated
umi TGCCGTGACC = 23 reads: +329 -1 +3 -1 +8 -1 +39 non-validated
umi TGCTCCTTAG = 31 reads: -9 +321 -30 +22 non-validated
umi TGGAGATACG = 52 reads: +382 validated
umi TGTCCCGCCT = 72 reads: +87 -1XX +138 -1XX +65 -1XX +89 invalidated
umi TTAACGCCTC = 69 reads: +382 validated
umi TTACCAGCAT = 59 reads: +382 validated
umi TTACTTTGAC = 59 reads: +382 validated
umi TTATTGTCTT = 60 reads: +344 -38 non-validated
umi TTCACATTCC = 33 reads: +283 -3 +56 -12 +5 -1 +1 -3 +1 -1 +2 -1 +3 -1 +9 non-validated
umi TTCCAGGGGC = 15 reads: -1 +9 -1 +8 -3 +1 -1 +2 -1 +214 -26 +59 -1 +6 -1 +48 non-validated
umi TTCCTTTCGG = 35 reads: -5 +159 -1X +1 -1 +2 -1 +1 -3X +27 -1 +152 -28 invalidated
umi TTGATATGGA = 45 reads: +379 -1 +2 non-validated
umi TTGGGCCGGA = 18 reads: +63 -22 +216 -1 +42 -1 +37 non-validated
umi TTGGGGGCTT = 26 reads: -1 +381 non-validated
umi TTTCAACCTA = 76 reads: +382 validated
umi TTTCTATACT = 84 reads: -5 +335 -1 +4 -1 +36 non-validated
umi TTTTAACCCT = 42 reads: +367 -1 +14 non-validated

GOOD CONTIGS

TIG 1[bases=669]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=2)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=33)
463-509 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
509-669 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 12 reads
cdr3 = CARESYVGLSSSTSYPDYW at 421, score = 8 + 7
umis assigned: [7, 9, 31, 51, 53, 64, 68, 85, 149, 163] and 13 others
of which 23 are surviving nonsolos
reads assigned: 893
start codons at 79, 228, 235, 314, 356, 382, 437, 563
confident = true

TIG 2[bases=556]
38-286 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
382-420 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 116 umis using 1067 reads
cdr3 = CLHYDNRRRTF at 359, score = 8 + 8
umis assigned: [2, 10, 12, 14, 15, 16, 17, 19, 20, 27] and 167 others
of which 177 are surviving nonsolos
reads assigned: 8801
start codons at 38, 94, 107, 246, 369, 462
confident = true
now this is a cell
paired!

GCTGTGTATTACTGTGCGAGAGAATCTTATGTCGGGCTCTCTTCTTCAACCAGTTATCCCGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GTCTCCAGCCGGCAACCTGAAGATTTTGCCACCTATTATTGTCTACACTATGATAATCGCCGTCGCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2738 = CGTGTAATCGTTTGCC-1

using 45 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[45]
surviving nonsolo ucounts = 1[45]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2747 = CGTGTAATCTTACCTA-1

using 38 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[38]
surviving nonsolo ucounts = 1[38]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2766 = CGTGTCTAGGCCCGTT-1

using 76 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 9[2, 3^2, 4^4, 7, 41]
surviving nonsolo ucounts = 1[41]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2767 = CGTGTCTAGGCTAGAC-1

using 66 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[3, 6, 57]
surviving nonsolo ucounts = 1[57]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2769 = CGTGTCTAGGTGGGTT-1

using 113 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 12[2^4, 3^5, 5, 7, 70]
surviving nonsolo ucounts = 1[70]
ids = [11]

====================================================================================

REJECT CONTIGS

TIG 1[bases=393]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-35 ==> 5965-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 61
start codons at 35, 243, 369, 386
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2771 = CGTGTCTAGGTGTTAA-1

using 41 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 37]
surviving nonsolo ucounts = 1[37]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2774 = CGTGTCTAGTCAAGCG-1

using 91 reads

====================================================================================

graph has 56 edges initially, 4 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[43, 47]
surviving nonsolo ucounts = 2[43, 47]
ids = [0, 2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2776 = CGTGTCTAGTCATCCA-1

using 57 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[57]
surviving nonsolo ucounts = 1[57]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=420]
0-27 ==> 24-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
27-383 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
383-420 ==> 0-37 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 351, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 49
start codons at 27, 181, 184, 235, 334, 361, 385
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2777 = CGTGTCTAGTGCCAGA-1

using 250 reads

====================================================================================

graph has 72 edges initially, 4 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[119, 131]
surviving nonsolo ucounts = 2[119, 131]
ids = [0, 1]

====================================================================================

UMI info for barcode CGTGTCTAGTGCCAGA-1 contig 1 = ACAGCATGGA...
umi TGGTATTCAC = 124 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=438]
5-356 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=4)
356-393 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
393-438 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CQQYNSYPLTF at 332, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 124
start codons at 5, 11, 67, 80, 312
confident = false

REJECT CONTIGS

TIG 1[bases=430]
0-266 ==> 2170-2436 on rc of segment before IGHD2-2 exon 1 [len=2436] (mis=0)
309-359 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
359-430 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 118
start codons at 21, 27, 68, 308, 311, 340
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2778 = CGTGTCTAGTGCCATT-1

using 59 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[8, 50]
surviving nonsolo ucounts = 1[50]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2781 = CGTGTCTAGTGTTGAA-1

using 89 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[87]
surviving nonsolo ucounts = 1[87]
ids = [0]

====================================================================================

UMI info for barcode CGTGTCTAGTGTTGAA-1 contig 1 = CTCAGCCATG...
umi GCAGAAGGGT = 86 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=511]
7-343 ==> 0-336 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
345-383 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
383-511 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CQAWDSSLVVF at 322, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 85
start codons at 7, 12, 68, 155, 301, 305
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2784 = CGTGTCTAGTTGTCGT-1

using 49 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 43]
surviving nonsolo ucounts = 1[43]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=335]
0-278 ==> 73-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
277-315 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
315-335 ==> 0-20 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYDSFSWTF at 254, score = 8 + 8
umis assigned: [3, 4]
of which 1 are surviving nonsolos
reads assigned: 33
start codons at 2, 138, 141, 234, 264
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2786 = CGTGTCTCAACTGCTA-1

using 1520 reads

====================================================================================

graph has 672 edges initially, 6 edges after simplification

total ucounts = 145
nonsolo ucounts = 55[2^17, 3^6, 4^2, 5, 6^2, 8, 9, 18, 19, 20, 24, 28, 31, 38, 39, 41^2, 47, 48, 50, 59, 61, 63, 69, 72^3, 75, 82, 83, 90, 94]
surviving nonsolo ucounts = 25[6, 18, 19, 20, 24, 28, 31, 38, 39, 41^2, 47, 48, 50, 59, 63, 69, 72^3, 75, 82, 83, 90, 94]
ids = [1, 54, 12, 129, 18, 55, 9, 25, 43, 39, ...]

====================================================================================

UMI info for barcode CGTGTCTCAACTGCTA-1 contig 1 = TGAGTCTCCC...
umi AAACTCACGA = 6 reads: +42 -16 +66 -1 +2 -1 +6 -1 +3 -2 +5 -1 +2 -55 +106 -130 non-validated
umi AGGAATCTCC = 25 reads: +24 -20 +280 -115 non-validated
umi ATCTTTCCGT = 38 reads: +346 -37 +56 non-validated
umi CACTCTGATC = 37 reads: -5 +429 -5 non-validated
umi CATCATACCG = 38 reads: +274 -50 +22 -1 +56 -36 non-validated
umi CATTATGTCC = 46 reads: +311 -1 +58 -1 +4 -1 +63 non-validated
umi CCCTTGCTTT = 18 reads: -75 +143 -11 +126 -1 +1 -1 +17 -1 +5 -1 +3 -54 non-validated
umi CCGCTTCTAT = 28 reads: +391 -48 non-validated
umi GTCGCTCCTT = 41 reads: +439 validated
umi TTATGGATCT = 18 reads: +103 -1 +4 -2 +214 -115 non-validated

UMI info for barcode CGTGTCTCAACTGCTA-1 contig 2 = GGGGAGGAAC...
umi AAACCCTCTG = 46 reads: +327 -1 +54 non-validated
umi AAACTCTACT = 28 reads: -325X +1 -5XX +1 -9XX +1 -1XX +39 invalidated
umi ACCAGCGCAG = 31 reads: +3 -1 +1 -1 +3 -9 +250 -19 +95 non-validated
umi ACCTGTCCGT = 18 reads: +70 -1 +1 -1 +2 -1 +254 -52 non-validated
umi AGAGACACCA = 60 reads: -25 +357 non-validated
umi ATCCTGTGTA = 85 reads: +382 validated
umi ATGCCTTTTC = 71 reads: +382 validated
umi ATGTGAGGTG = 91 reads: +382 validated
umi ATTAGGTTCG = 70 reads: -2 +380 non-validated
umi ATTGAAGCCT = 68 reads: +382 validated
umi CTACCGCTTA = 71 reads: +382 validated
umi GGTCCGCCTT = 65 reads: -52 +5 -1 +324 non-validated
umi TAAATTGCTA = 74 reads: +350 -24 +8 non-validated
umi TCCGTTTCAA = 51 reads: +295 -50 +1 -1 +35 non-validated
umi TCGAGACTAT = 96 reads: +354 -1 +27 non-validated
umi TCGAGTGGCG = 85 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=600]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=2)
448-498 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
498-600 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 4 reads
cdr3 = CAKPSGVMRVGGSYRVDAFDIW at 401, score = 8 + 8
umis assigned: [1, 18, 25, 39, 43, 46, 54, 55, 91, 129]
of which 10 are surviving nonsolos
reads assigned: 294
start codons at 59, 233, 257, 392, 422, 450, 479, 516, 577
confident = true

TIG 2[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=2)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 122 reads
cdr3 = CQQYNNWRWTF at 357, score = 9 + 8
umis assigned: [0, 2, 9, 12, 15, 23, 26, 28, 29, 31] and 6 others
of which 15 are surviving nonsolos
reads assigned: 989
start codons at 36, 105, 241, 460
confident = true
now this is a cell
paired!

TACTGTGCGAAACCCTCTGGAGTAATGAGAGTCGGTGGGAGCTACCGCGTTGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> ATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCGGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2787 = CGTGTCTCAAGAAGAG-1

using 334 reads

====================================================================================

graph has 126 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 9[2^2, 3^2, 4, 5, 6, 72, 234]
surviving nonsolo ucounts = 2[72, 234]
ids = [3, 9]

====================================================================================

UMI info for barcode CGTGTCTCAAGAAGAG-1 contig 1 = GAATCAGTCC...
umi ATATCTCGGC = 66 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=413]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 13 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 65
start codons at 25, 31, 100, 236
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2797 = CGTGTCTCACCAGTTA-1

using 96 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 92]
surviving nonsolo ucounts = 1[92]
ids = [2]

====================================================================================

UMI info for barcode CGTGTCTCACCAGTTA-1 contig 1 = AGTGACTCCT...
umi GCTTAAGTCA = 92 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=561]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=8)
411-459 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
459-561 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 8 reads
cdr3 = CAHRRFEWLPKGVAGGYFDYW at 365, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 91
start codons at 20, 64, 243, 246, 326, 335, 477, 538
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2798 = CGTGTCTCACGCATCG-1

using 2191 reads

====================================================================================

graph has 1065 edges initially, 36 edges after simplification

total ucounts = 165
nonsolo ucounts = 67[2^22, 3^7, 4^7, 5, 6, 8, 10, 12, 18, 20, 27, 37, 38, 47, 49, 50^2, 51^2, 53, 55, 62, 67^2, 72, 73, 91, 95, 116, 120, 135, 150, 167, 198]
surviving nonsolo ucounts = 25[18, 27, 37, 38, 47, 49, 50^2, 51^2, 53, 55, 62, 67^2, 72, 73, 91, 95, 116, 120, 135, 150, 167, 198]
ids = [67, 153, 60, 36, 159, 164, 45, 76, 130, 161, ...]

====================================================================================

UMI info for barcode CGTGTCTCACGCATCG-1 contig 1 = GAAGAGCTGC...
umi CACGGTTCGT = 73 reads: +357 -25 non-validated
umi CCCTTGTATA = 73 reads: +382 validated
umi CGTTCTTGGG = 50 reads: +382 validated
umi GACACTTGCT = 121 reads: +382 validated
umi GAGGCCTTGG = 92 reads: +380 -2 non-validated
umi GGGTAAATGC = 65 reads: +11 -2 +369 non-validated
umi GTATTGTCAC = 54 reads: +382 validated
umi GTTACGGCTG = 55 reads: +382 validated
umi TCCCAAAGGC = 55 reads: +382 validated
umi TCTACCGATA = 143 reads: -348X +2 -1XX +6 -3XX +7 -1XX +6 -1XX +3 -1XX +3 invalidated
umi TTCGTATTGG = 94 reads: +382 validated
umi TTGTCTACCT = 46 reads: +340 -1 +1 -38 +2 non-validated
umi TTTTTTCTAA = 49 reads: +382 validated

UMI info for barcode CGTGTCTCACGCATCG-1 contig 2 = GGACTCCTGT...
umi ATATGTTCTA = 2 reads: -430 non-validated
umi ATTATATCCA = 50 reads: +400 -1 +8 -1 +18 -1 +1 non-validated
umi CAGCTGAGGG = 61 reads: +415 -1 +14 non-validated
umi CCACGTTTGT = 35 reads: -419X +2 -1X +1 -6X +1 invalidated
umi CCCCCATCAC = 26 reads: -395X +1 -1X +3 -1XX +2 -8XX +1 -2XX +1 -3XX +1 -5XX +1 -2XX +1 -1XX +1 invalidated
umi CCCTGCAGTC = 18 reads: +28 -20 +64 -11 +260 -28 +19 non-validated
umi CTATCGTGAA = 178 reads: -397X +1 -5X +1 -2XX +1 -12XX +1 -2XX +1 -2XX +1 -2XX +2 invalidated
umi CTTCGTTACT = 198 reads: -397X +1 -5XX +1 -2XX +1 -12XX +1 -2XX +1 -2XX +1 -2XX +2 invalidated
umi TACTGGCTTT = 70 reads: -396X +6 -1XX +1 -1XX +2 -3XX +1 -2XX +15 -1XX +1 invalidated
umi TTAGCACGCT = 27 reads: +349 -81 non-validated
umi TTTACGGTTA = 51 reads: +406 -24 non-validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-363 ==> 0-330 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=15)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 9 umis using 98 reads
cdr3 = CQFHGNLQTF at 357, score = 9 + 8
umis assigned: [51, 68, 76, 85, 90, 102, 109, 116, 130, 139] and 3 others
of which 13 are surviving nonsolos
reads assigned: 953
start codons at 33, 367, 457
confident = true

TIG 2[bases=630]
18-376 ==> 0-358 on |96|IGHV2-26|L-REGION+V-REGION| [len=358] (mis=17)
428-448 ==> 32-52 on |49|IGHJ1|J-REGION| [len=52] (mis=1)
448-630 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 2 umis using 12 reads
cdr3 = CARISRKWLRGFSASDYW at 363, score = 8 + 6
umis assigned: [36, 45, 54, 60, 64, 67, 77, 81, 124, 153] and 1 others
of which 11 are surviving nonsolos
reads assigned: 568
start codons at 18, 166, 174, 241, 324, 342
confident = true
now this is a cell
paired!

ACAGCCACATATTACTGTGCACGGATATCCCGGAAGTGGCTACGAGGTTTTAGCGCATCTGACTATTGGGGCCAGGGAGTCCTGGTCACCGTCTCCTCCG <==> ACCATCAGCAGACTGGAGCCTGAAGATTTCGCAGTGTATTTCTGTCAGTTTCATGGTAACTTACAGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2805 = CGTGTCTCAGGCGATA-1

using 59 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[59]
surviving nonsolo ucounts = 1[59]
ids = [0]

====================================================================================

UMI info for barcode CGTGTCTCAGGCGATA-1 contig 1 = GGGCCTCAGG...
umi AACCGCGTGC = 50 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=512]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-369 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
373-411 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
411-512 ==> 0-101 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CQAWDSTEVVF at 350, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 49
start codons at 35, 40, 329, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2807 = CGTGTCTCAGTATGCT-1

using 277 reads

====================================================================================

graph has 489 edges initially, 2 edges after simplification

total ucounts = 184
nonsolo ucounts = 53[2^37, 3^7, 4, 5^4, 6, 7^3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2812 = CGTGTCTCATCTCCCA-1

using 163 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 160]
surviving nonsolo ucounts = 1[160]
ids = [1]

====================================================================================

UMI info for barcode CGTGTCTCATCTCCCA-1 contig 1 = GCTCCAAACA...
umi TCGATTCGCT = 154 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
42-394 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=19)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
430-554 ==> 0-124 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CSAWDSSLNVWVF at 363, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 151
start codons at 42, 181, 371, 388
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2824 = CGTGTCTTCAAAGTAG-1

using 471 reads

====================================================================================

graph has 180 edges initially, 14 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[97, 101, 106, 166]
surviving nonsolo ucounts = 4[97, 101, 106, 166]
ids = [2, 3, 1, 0]

====================================================================================

UMI info for barcode CGTGTCTTCAAAGTAG-1 contig 1 = GAGTGCTTTC...
umi GCCGTCATCG = 98 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=475]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=7)
406-454 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
454-475 ==> 0-21 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARAHGDYYTLLDCW at 378, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 96
start codons at 18, 39, 83, 169, 369
confident = true

REJECT CONTIGS

TIG 1[bases=462]
0-341 ==> 17-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=20)
371-419 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
419-462 ==> 0-43 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CAHIVGFYFPNSGYYYFDSW at 328, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 96
start codons at 27, 206, 209, 298
confident = false
VJ delta = 10
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2825 = CGTGTCTTCAACCAAC-1

using 67 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[67]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2827 = CGTGTCTTCAAGGTAA-1

using 62 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[59]
surviving nonsolo ucounts = 1[59]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=386]
0-349 ==> 2-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
348-386 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
cdr3 = CLQYSSSPWTF at 325, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 55
start codons at 4, 73, 209
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2829 = CGTGTCTTCACTATTC-1

using 897 reads

====================================================================================

graph has 1334 edges initially, 6 edges after simplification

total ucounts = 576
nonsolo ucounts = 165[2^103, 3^29, 4^10, 5^14, 6^2, 7^2, 9^2, 11, 12, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2845 = CGTGTCTTCGTTGCCT-1

using 163 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[163]
surviving nonsolo ucounts = 1[163]
ids = [0]

====================================================================================

UMI info for barcode CGTGTCTTCGTTGCCT-1 contig 1 = GAGAAGAGCT...
umi TCATGAATCC = 147 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=491]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=9)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
420-491 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQQYGSSPGTF at 359, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 145
start codons at 35, 243, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2847 = CGTGTCTTCTCCTATA-1

using 95 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[95]
surviving nonsolo ucounts = 1[95]
ids = [0]

====================================================================================

UMI info for barcode CGTGTCTTCTCCTATA-1 contig 1 = GGGGTCACAA...
umi TGTTGGTGCG = 93 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=516]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=23)
395-423 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
423-516 ==> 0-93 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 15 reads
cdr3 = CFSYGSSGRTF at 362, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 91
start codons at 38, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2850 = CGTGTCTTCTTACCTA-1

using 44 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[39]
surviving nonsolo ucounts = 1[39]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2871 = CGTTAGAAGCGATCCC-1

using 209 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[209]
surviving nonsolo ucounts = 1[209]
ids = [0]

====================================================================================

UMI info for barcode CGTTAGAAGCGATCCC-1 contig 1 = CTCAGGACAC...
umi CGTAAGCCGC = 196 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=492]
13-364 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
363-401 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
401-492 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLQYSSSPWTF at 340, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 13, 19, 88, 224, 443
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2874 = CGTTAGAAGGCTAGGT-1

using 592 reads

====================================================================================

graph has 514 edges initially, 4 edges after simplification

total ucounts = 146
nonsolo ucounts = 42[2^13, 3^9, 4^4, 5^5, 6^2, 7^2, 9^2, 11, 13^2, 14, 299]
surviving nonsolo ucounts = 1[299]
ids = [71]

====================================================================================

UMI info for barcode CGTTAGAAGGCTAGGT-1 contig 1 = GAAGAGCTGC...
umi CTCACCCGCG = 280 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=511]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
383-421 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
421-511 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYGSSPPVTF at 357, score = 9 + 8
umis assigned: [71]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 33, 241, 367, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2877 = CGTTAGAAGGTAGCTG-1

using 318 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 21, 292]
surviving nonsolo ucounts = 1[292]
ids = [5]

====================================================================================

UMI info for barcode CGTTAGAAGGTAGCTG-1 contig 1 = AGTCCCAGTC...
umi TTTCTTTTCG = 264 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=498]
0-20 ==> 38-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
20-352 ==> 0-332 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=24)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
408-498 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQHLVTHPISF at 347, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 20, 26, 231, 234, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2878 = CGTTAGAAGTAAGTAC-1

using 352 reads

====================================================================================

graph has 146 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 4, 11, 41, 290]
surviving nonsolo ucounts = 3[4, 41, 290]
ids = [4, 1, 2]

====================================================================================

UMI info for barcode CGTTAGAAGTAAGTAC-1 contig 1 = TGGGGAGGAA...
umi CATATCACCA = 43 reads: -356 +2 -2X +14 -1XX +1 -2XX +4 invalidated
umi CTGCAGCGAT = 289 reads: +382 validated
umi GCAACAATAA = 5 reads: -353 +29 non-validated

GOOD CONTIGS

TIG 1[bases=555]
0-37 ==> 60-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
37-382 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=11)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=7)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CHQYNNWPYTF at 358, score = 9 + 7
umis assigned: [1, 2, 4]
of which 3 are surviving nonsolos
reads assigned: 332
start codons at 37, 100, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2880 = CGTTAGAAGTCGCCGT-1

using 197 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[192]
surviving nonsolo ucounts = 1[192]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=468]
1-80 ==> 5529-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
396-434 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
434-468 ==> 0-34 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWDLLLHANSTNSSITF at 355, score = 4 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 35, 68, 104, 192, 354, 374
confident = false
not full
frameshifted full length transcript of length 468
VJ delta = 30
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2881 = CGTTAGAAGTCTCCTC-1

using 153 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 3, 147]
surviving nonsolo ucounts = 1[147]
ids = [3]

====================================================================================

UMI info for barcode CGTTAGAAGTCTCCTC-1 contig 1 = GAATCAGTCC...
umi TGTCGGGACC = 134 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=481]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-481 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 130
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2882 = CGTTAGAAGTCTTGCA-1

using 2927 reads

====================================================================================

graph has 1748 edges initially, 44 edges after simplification

total ucounts = 284
nonsolo ucounts = 144[2^52, 3^36, 4^15, 5^8, 6^8, 7^2, 8^3, 9^3, 10, 11^3, 12, 13, 14, 44, 123, 230, 234, 245, 265, 266, 287, 288, 298]
surviving nonsolo ucounts = 10[44, 123, 230, 234, 245, 265, 266, 287, 288, 298]
ids = [37, 24, 203, 155, 18, 82, 38, 210, 224, 262]

====================================================================================

UMI info for barcode CGTTAGAAGTCTTGCA-1 contig 1 = TGGGGGATCA...
umi ACATACCTAT = 247 reads: +400 validated
umi ACGGGTTTTA = 121 reads: +400 validated
umi GCCTACCTGA = 233 reads: +400 validated
umi TAGGAGCCTG = 232 reads: +400 validated
umi TCAATCATTA = 290 reads: +400 validated
umi TTCAAACGTC = 300 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=571]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=8)
397-435 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 6 umis using 205 reads
cdr3 = CMQALQIPPFTF at 371, score = 9 + 8
umis assigned: [18, 24, 155, 203, 210, 262]
of which 6 are surviving nonsolos
reads assigned: 1400
start codons at 35, 68, 104, 186, 192, 354, 374, 477
confident = true

REJECT CONTIGS

TIG 1[bases=585]
5-80 ==> 5533-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=3)
421-449 ==> 9-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
449-585 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CIQPLQAPPF at 371, score = 9 + 6
umis assigned: [37, 38, 82, 224]
of which 4 are surviving nonsolos
reads assigned: 854
start codons at 35, 68, 104, 192, 354, 491
confident = false
not full
frameshifted full length transcript of length 585
VJ delta = -7
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2883 = CGTTAGAAGTGAACAT-1

using 296 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[293]
surviving nonsolo ucounts = 1[293]
ids = [1]

====================================================================================

UMI info for barcode CGTTAGAAGTGAACAT-1 contig 1 = GGGGAGGAAC...
umi TACTGCCATT = 271 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=495]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-495 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQRSNWPLTF at 357, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 36, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2888 = CGTTAGAAGTTGTCGT-1

using 298 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[295]
surviving nonsolo ucounts = 1[295]
ids = [2]

====================================================================================

UMI info for barcode CGTTAGAAGTTGTCGT-1 contig 1 = GAGCTGCTCA...
umi TTCCGGACTA = 296 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=557]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=8)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQFYGRSPGMYTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 292
start codons at 30, 238, 364, 381, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2894 = CGTTAGACAATAGCGG-1

using 3358 reads

====================================================================================

graph has 1414 edges initially, 20 edges after simplification

total ucounts = 166
nonsolo ucounts = 63[2^26, 3^11, 4^7, 6^2, 7, 8^2, 9, 10, 12, 80, 147, 151, 212, 213, 221, 223, 235, 248, 279, 1067]
surviving nonsolo ucounts = 11[80, 147, 151, 212, 213, 221, 223, 235, 248, 279, 1067]
ids = [64, 34, 14, 155, 132, 57, 21, 156, 45, 2, ...]

====================================================================================

UMI info for barcode CGTTAGACAATAGCGG-1 contig 1 = AGCTCTCAGA...
umi AACCAGTCCG = 282 reads: +420 -1 non-validated
umi ACAAGCCTAT = 142 reads: +391 -1X +1 -2X +2 -1 +1 -1X +2 -19 invalidated
umi ATATCAGGAC = 148 reads: +421 validated
umi CACAGAAGGT = 248 reads: -5 +416 non-validated
umi CCATCGTTCC = 216 reads: +421 validated
umi TAGTCGAGCC = 208 reads: +421 validated
umi TGTAATGCCC = 215 reads: +414 -7 non-validated

GOOD CONTIGS

TIG 1[bases=571]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=10)
452-500 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
500-571 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 4 umis using 70 reads
cdr3 = CARGGQGATVTGFGYW at 421, score = 8 + 7
umis assigned: [2, 14, 34, 45, 57, 132, 155]
of which 7 are surviving nonsolos
reads assigned: 1423
start codons at 79, 235, 356, 382
confident = true

REJECT CONTIGS

TIG 1[bases=561]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-36 ==> 5964-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
387-425 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [21, 156]
of which 2 are surviving nonsolos
reads assigned: 452
start codons at 36, 244, 370, 467
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2895 = CGTTAGACACATTTCT-1

using 47 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 40]
surviving nonsolo ucounts = 1[40]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2910 = CGTTAGACATAACCTG-1

using 231 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 222]
surviving nonsolo ucounts = 1[222]
ids = [8]

====================================================================================

UMI info for barcode CGTTAGACATAACCTG-1 contig 1 = GCTTCAGCTG...
umi TTTATAGGCC = 217 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=591]
0-46 ==> 5-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
46-402 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
402-440 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
440-591 ==> 0-151 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQSYDSSLSGLYVF at 370, score = 7 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 46, 200, 203, 254, 353, 380, 404, 572
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2917 = CGTTAGACATGAGCGA-1

using 309 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 10, 295]
surviving nonsolo ucounts = 1[295]
ids = [1]

====================================================================================

UMI info for barcode CGTTAGACATGAGCGA-1 contig 1 = GAGGAACTGC...
umi CTCAATGCGC = 295 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
380-418 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYNNWPSITF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 33, 102, 238, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2923 = CGTTAGAGTACCGCTG-1

using 172 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[5, 162]
surviving nonsolo ucounts = 1[162]
ids = [6]

====================================================================================

UMI info for barcode CGTTAGAGTACCGCTG-1 contig 1 = GAGCATCACC...
umi TTCCGGTATA = 156 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=539]
0-62 ==> 2-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
62-415 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=14)
443-489 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
489-539 ==> 0-50 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARAPYSSGYYSRFGDYW at 404, score = 8 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 155
start codons at 62, 170, 260, 265, 297, 326, 359
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2924 = CGTTAGAGTACCGGCT-1

using 178 reads

====================================================================================

graph has 226 edges initially, 10 edges after simplification

total ucounts = 44
nonsolo ucounts = 32[2^12, 3^5, 4^3, 6^4, 7, 9^2, 10, 12, 13, 15, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2931 = CGTTAGAGTCCAAGTT-1

using 61 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[7, 54]
surviving nonsolo ucounts = 1[54]
ids = [0]

====================================================================================

UMI info for barcode CGTTAGAGTCCAAGTT-1 contig 1 = TCTCGGGACG...
umi CGGCGTTTCG = 50 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=470]
18-311 ==> 0-293 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=22)
371-409 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=7)
409-470 ==> 0-61 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CSSYAGRTTFDVF at 342, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 50
start codons at 18, 154, 157, 172, 175, 352
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2933 = CGTTAGAGTCTCACCT-1

using 608 reads

====================================================================================

graph has 192 edges initially, 6 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[15, 287, 306]
surviving nonsolo ucounts = 2[287, 306]
ids = [2, 1]

====================================================================================

UMI info for barcode CGTTAGAGTCTCACCT-1 contig 1 = AGGAACTGCT...
umi TTGTTTTCCG = 252 reads: +385 validated

UMI info for barcode CGTTAGAGTCTCACCT-1 contig 2 = GAGGAATCAG...
umi CGATCGATTC = 278 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=508]
0-32 ==> 65-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
32-377 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
417-508 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYNNWPPWTF at 353, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 32, 101, 237, 459
confident = false

TIG 2[bases=507]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-507 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2940 = CGTTAGAGTTCAGCGC-1

using 358 reads

====================================================================================

graph has 162 edges initially, 16 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[5, 77, 274]
surviving nonsolo ucounts = 2[77, 274]
ids = [4, 1]

====================================================================================

UMI info for barcode CGTTAGAGTTCAGCGC-1 contig 1 = AGCTCTGAGA...
umi CAACTCTTCC = 261 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=603]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-603 ==> 0-100 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 79, 230, 235, 382, 460
confident = false

REJECT CONTIGS

TIG 1[bases=468]
0-79 ==> 1-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
0-79 ==> 7067-7146 on rc of segment before IGHVII-30-1 exon 1 [len=7146] (mis=0)
0-79 ==> 7061-7140 on rc of segment before IGHVII-33-1 exon 1 [len=7140] (mis=0)
48-115 ==> 6507-6574 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=2)
79-368 ==> 0-289 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=22)
449-468 ==> 13-32 on |52|IGHJ3|J-REGION| [len=49] (mis=0)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 71
start codons at 79, 230, 235, 288, 296, 305, 314, 382, 439, 446
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2941 = CGTTAGAGTTCCCTTG-1

using 236 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[236]
surviving nonsolo ucounts = 1[236]
ids = [0]

====================================================================================

UMI info for barcode CGTTAGAGTTCCCTTG-1 contig 1 = GAGCTACAAC...
umi CGTCCTACCT = 224 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=512]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-512 ==> 0-82 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 27, 30, 85, 99, 352, 382, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2945 = CGTTAGAGTTGGACCC-1

using 24 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[24]
surviving nonsolo ucounts = 1[24]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2947 = CGTTAGATCAACACGT-1

using 507 reads

====================================================================================

graph has 782 edges initially, 2 edges after simplification

total ucounts = 219
nonsolo ucounts = 101[2^44, 3^24, 4^15, 5^3, 6^5, 7, 8^2, 9, 10, 11, 13^2, 18, 27]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2948 = CGTTAGATCAACGGGA-1

using 459 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 5, 449]
surviving nonsolo ucounts = 1[449]
ids = [0]

====================================================================================

UMI info for barcode CGTTAGATCAACGGGA-1 contig 1 = GAGTCAGTCT...
umi AATCAAACCG = 447 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=0)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 68 reads
cdr3 = CQQSYSTPPTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 443
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2949 = CGTTAGATCACATAGC-1

using 229 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2^3, 3, 213]
surviving nonsolo ucounts = 1[213]
ids = [5]

====================================================================================

UMI info for barcode CGTTAGATCACATAGC-1 contig 1 = AGTCAGTCCC...
umi CTAATCGTCA = 201 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=459]
0-24 ==> 7-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
24-375 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
373-412 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
412-459 ==> 0-47 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CHQYESVPYTF at 351, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 24, 30, 86, 99, 238, 334, 361, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2959 = CGTTAGATCCAGTATG-1

using 182 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 174]
surviving nonsolo ucounts = 1[174]
ids = [2]

====================================================================================

UMI info for barcode CGTTAGATCCAGTATG-1 contig 1 = CTCCCTCACT...
umi ATGGTGCTTT = 175 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=549]
0-54 ==> 5-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=1)
428-478 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
478-549 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARHLILGMGADAFDIW at 396, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 172
start codons at 54, 228, 252, 387, 420, 430, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2960 = CGTTAGATCCCGGATG-1

using 10020 reads

====================================================================================

graph has 3844 edges initially, 40 edges after simplification

total ucounts = 461
nonsolo ucounts = 210[2^79, 3^33, 4^23, 5^8, 6^6, 7^6, 8^7, 9, 10, 11, 12, 15, 16, 23, 24, 44, 90, 91, 98, 109, 113, 134, 142, 151, 152, 156, 161, 164, 165, 176, 179, 198, 212, 213^2, 227, 228, 246, 259^2, 260, 261, 278, 281, 284, 289, 295, 309, 318, 324, 342, 358, 410, 429, 507]
surviving nonsolo ucounts = 39[90, 91, 98, 109, 113, 134, 142, 151, 152, 156, 161, 164, 165, 176, 179, 198, 212, 213^2, 227, 228, 246, 259^2, 260, 261, 278, 281, 284, 289, 295, 309, 318, 324, 342, 358, 410, 429, 507]
ids = [206, 260, 143, 333, 326, 265, 287, 148, 386, 274, ...]

====================================================================================

UMI info for barcode CGTTAGATCCCGGATG-1 contig 1 = GAGCTCTGGG...
umi ACATTACGGC = 184 reads: -359 +1 -6XX +1 -2XX +1 -7XX +1 -10XX +3 -2XX +37 invalidated
umi ACGGGTTGTG = 412 reads: -145 +1 -1XX +283 invalidated
umi ACGTAGGGGT = 162 reads: +415 -1 +14 non-validated
umi ACTTGAGGCT = 205 reads: +415 -15 non-validated
umi CACATTTCGT = 175 reads: +415 -1X +1 -1X +1 -1X +2 -8X invalidated
umi CATTAGCTCT = 98 reads: +430 validated
umi CATTTCATAC = 151 reads: +430 validated
umi CTAATGATGC = 89 reads: +381 -49 non-validated
umi CTAATGCGCA = 264 reads: +430 validated
umi CTTGCAGTTC = 387 reads: -377X +1 -10XX +3 -2XX +37 invalidated
umi GCTGGGTTTC = 96 reads: +395 -1 +3 -1 +2 -1 +7 -1 +3 -2 +3 -1 +2 -2 +6 non-validated
umi GGAAGAAACA = 124 reads: -411 +19 non-validated
umi TAGGTTCCAG = 117 reads: +430 validated
umi TATACTGGTA = 106 reads: +391 -1 +2 -1 +35 non-validated
umi TTTACCTGCA = 219 reads: +157 -1XX +272 invalidated

UMI info for barcode CGTTAGATCCCGGATG-1 contig 2 = GGGGAGGAAC...
umi AATTGTTCGT = 164 reads: +379 validated
umi ACACCGTTCG = 276 reads: +379 validated
umi ACAGAGAGTC = 259 reads: +379 validated
umi ACCCTCCGTC = 321 reads: +379 validated
umi ACCGCCCGGA = 364 reads: +379 validated
umi ATAGAGTCTT = 229 reads: +379 validated
umi ATATAATTTA = 163 reads: +379 validated
umi ATTATCCTAA = 212 reads: +379 validated
umi ATTGAATCAT = 305 reads: +379 validated
umi CAAATACTCC = 290 reads: +379 validated
umi CCCGGGTTAG = 317 reads: +379 validated
umi CGGAAGTCCC = 246 reads: +379 validated
umi GCACAGCCGT = 260 reads: +379 validated
umi GCGTCTTCGC = 299 reads: +379 validated
umi GGGCATTGGT = 159 reads: +379 validated
umi GTCCGATTGC = 140 reads: +379 validated
umi GTTGTGTACT = 228 reads: +379 validated
umi TCATCTATTG = 262 reads: +379 validated
umi TCTGCGTTTA = 148 reads: +379 validated
umi TTCTTTGTGC = 281 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=581]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=0)
436-457 ==> 0-21 on |33|IGHD6-19|D-REGION| [len=21] (mis=1)
462-510 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
510-581 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 10 umis using 248 reads
cdr3 = CARDPGIAVAGTRDYFDYW at 422, score = 9 + 7
umis assigned: [35, 45, 46, 52, 125, 143, 148, 206, 207, 224] and 5 others
of which 15 are surviving nonsolos
reads assigned: 2735
start codons at 80, 231, 236, 289, 294, 297, 315, 383
confident = true

TIG 2[bases=551]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 20 umis using 765 reads
cdr3 = CQQRSNWITF at 357, score = 9 + 8
umis assigned: [23, 28, 31, 38, 39, 79, 80, 98, 104, 113] and 10 others
of which 20 are surviving nonsolos
reads assigned: 4845
start codons at 36, 241, 244, 457
confident = true

REJECT CONTIGS

TIG 1[bases=494]
1-343 ==> 10-352 on rc of segment before IGHJ4 exon 1 [len=352] (mis=5)
341-392 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=0)
392-494 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [44, 149]
of which 2 are surviving nonsolos
reads assigned: 544
start codons at 114, 162, 234, 336, 410, 471
confident = false
did not find CDR3
now this is a cell
paired!

GCTGTGTATTACTGTGCGAGAGATCCCGGTATAGCAGTGGCTGGTACCAGGGACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ACCATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGATCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2961 = CGTTAGATCCCTAATT-1

using 761 reads

====================================================================================

graph has 198 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[109, 650]
surviving nonsolo ucounts = 2[109, 650]
ids = [3, 2]

====================================================================================

UMI info for barcode CGTTAGATCCCTAATT-1 contig 1 = AGTCTCAGTC...
umi TTGAGGCAAC = 102 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=483]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
408-483 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQQSYSTLWTF at 347, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 99
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2966 = CGTTAGATCGCATGAT-1

using 1034 reads

====================================================================================

graph has 1634 edges initially, 8 edges after simplification

total ucounts = 527
nonsolo ucounts = 215[2^97, 3^59, 4^18, 5^16, 6^8, 7^7, 8^3, 9^4, 10, 14, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2972 = CGTTAGATCGTCCGTT-1

using 241 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[239]
surviving nonsolo ucounts = 1[239]
ids = [0]

====================================================================================

UMI info for barcode CGTTAGATCGTCCGTT-1 contig 1 = ATCACATAAC...
umi CCCCACATCT = 237 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=550]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=0)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
479-550 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CAREPSYDRDLYFDYW at 400, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 58, 209, 256, 355, 419
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2979 = CGTTAGATCTGTGCAA-1

using 268 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[266]
surviving nonsolo ucounts = 1[266]
ids = [0]

====================================================================================

UMI info for barcode CGTTAGATCTGTGCAA-1 contig 1 = GTCAGACCCA...
umi CAAACTGCCT = 250 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=487]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
408-487 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYNSYSSF at 350, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 23, 29, 85, 98, 330, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2980 = CGTTAGATCTTACCTA-1

using 513 reads

====================================================================================

graph has 250 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 245, 262]
surviving nonsolo ucounts = 2[245, 262]
ids = [0, 2]

====================================================================================

UMI info for barcode CGTTAGATCTTACCTA-1 contig 1 = AGCTCTGAGA...
umi CGTAGCCCTC = 264 reads: +424 validated

UMI info for barcode CGTTAGATCTTACCTA-1 contig 2 = AGCTTCAGCT...
umi ACATCCCACC = 242 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=597]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-597 ==> 0-94 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 79, 230, 235, 382, 460
confident = false

TIG 2[bases=566]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-566 ==> 0-131 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2983 = CGTTAGATCTTGCATT-1

using 240 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 9, 228]
surviving nonsolo ucounts = 1[228]
ids = [2]

====================================================================================

UMI info for barcode CGTTAGATCTTGCATT-1 contig 1 = AGGAGTCAGA...
umi TATCTGTATG = 227 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYNGQSRAF at 354, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 27, 33, 102, 238, 241, 334, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2986 = CGTTCTGAGAACTCGG-1

using 153 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 9[2^5, 3, 5^2, 128]
surviving nonsolo ucounts = 1[128]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2988 = CGTTCTGAGAATTGTG-1

using 221 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 8[2^3, 3^2, 4, 6, 197]
surviving nonsolo ucounts = 1[197]
ids = [9]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.2999 = CGTTCTGAGATGCCTT-1

using 1239 reads

====================================================================================

graph has 410 edges initially, 4 edges after simplification

total ucounts = 23
nonsolo ucounts = 12[2^3, 3^3, 4, 5^3, 553, 641]
surviving nonsolo ucounts = 2[553, 641]
ids = [10, 3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.3006 = CGTTCTGAGCCAGTAG-1

using 143 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[143]
surviving nonsolo ucounts = 1[143]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.3009 = CGTTCTGAGCGTAGTG-1

using 323 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[322]
surviving nonsolo ucounts = 1[322]
ids = [1]

====================================================================================

UMI info for barcode CGTTCTGAGCGTAGTG-1 contig 1 = ACTTTCTGAG...
umi CAATCGCGGA = 274 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=482]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=0)
411-453 ==> 19-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
453-482 ==> 0-29 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARDGGSGSYYSLDVW at 374, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 35, 79, 384
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.3013 = CGTTCTGAGGACAGAA-1

using 212 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2^2, 203]
surviving nonsolo ucounts = 1[203]
ids = [7]

====================================================================================

UMI info for barcode CGTTCTGAGGACAGAA-1 contig 1 = GCTCTGCTTC...
umi TTAGGGTCCA = 201 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=607]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-607 ==> 0-162 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.3019 = CGTTCTGAGTAGCGGT-1

using 20100 reads

====================================================================================

graph has 6053 edges initially, 42 edges after simplification

total ucounts = 810
nonsolo ucounts = 374[2^133, 3^58, 4^37, 5^18, 6^10, 7^7, 8^3, 9, 10, 15, 16^2, 19, 22, 31, 43, 51, 59, 62, 72, 76, 101, 107, 108, 111, 114, 117, 119^2, 128, 131, 134^2, 137, 143^2, 145^2, 147, 150^2, 153, 155, 157, 158^3, 160, 163^2, 168, 170^2, 171, 173^2, 174, 178, 179, 180, 182^2, 183^2, 185, 186^2, 187^2, 188, 190, 191^3, 194, 196^3, 197, 198, 200, 203, 204, 205, 206^2, 207, 209, 211^2, 212, 216, 218^2, 219, 221, 222, 228^2, 230, 231, 233, 238, 239, 244, 246, 253, 256, 269, 274, 289, 293, 387, 439, 653]
surviving nonsolo ucounts = 98[43, 51, 72, 76, 101, 107, 108, 111, 114, 117, 119^2, 128, 131, 134^2, 137, 143^2, 145^2, 147, 150^2, 153, 155, 157, 158^3, 160, 163^2, 168, 170^2, 171, 173^2, 174, 178, 179, 180, 182^2, 183^2, 185, 186^2, 187^2, 188, 190, 191^3, 194, 196^3, 197, 198, 200, 203, 204, 205, 206^2, 207, 209, 211^2, 212, 216, 218^2, 219, 221, 222, 228^2, 230, 231, 233, 238, 239, 244, 246, 253, 256, 269, 274, 289, 293, 387, 439, 653]
ids = [683, 106, 245, 439, 495, 237, 374, 314, 47, 355, ...]

====================================================================================

UMI info for barcode CGTTCTGAGTAGCGGT-1 contig 1 = ACTGCGGGGG...
umi AAATGGGACT = 296 reads: -74X +1 -2XX +326 invalidated
umi AACCGTATCA = 182 reads: +403 validated
umi AATCCTTCCC = 184 reads: +403 validated
umi ACGTCAGCAA = 229 reads: +403 validated
umi AGAGTACCTC = 389 reads: +403 validated
umi AGCATATTAT = 206 reads: +403 validated
umi AGGCCCCGCA = 193 reads: +403 validated
umi AGTCGTTTGG = 130 reads: +403 validated
umi ATAACTTTAT = 168 reads: +403 validated
umi ATCACTCGGC = 215 reads: +403 validated
umi CAATTCTATA = 257 reads: +403 validated
umi CACCACGCCT = 166 reads: +403 validated
umi CACCCCGGGC = 187 reads: +403 validated
umi CAGAAAGTGC = 107 reads: +403 validated
umi CAGTGGTGGG = 206 reads: +403 validated
umi CCCCCGTCGC = 191 reads: +403 validated
umi CCTGGGCCTA = 218 reads: +403 validated
umi CGCCGAATTG = 175 reads: +403 validated
umi CGTCGTACAC = 652 reads: -319 +84 non-validated
umi CTAATAAACA = 190 reads: +403 validated
umi GCAGGGCTTC = 201 reads: +210 -1XX +192 invalidated
umi GGTCACATTA = 168 reads: +403 validated
umi GTGTTAACTG = 248 reads: +403 validated
umi GTTATCTCCT = 135 reads: +403 validated
umi TACATATGAT = 190 reads: +232 -1XX +170 invalidated
umi TAGCATAGGT = 214 reads: +1 -1XX +401 invalidated
umi TCGAAACTGG = 196 reads: +403 validated
umi TCGTACGATT = 210 reads: +403 validated
umi TCGTCTTTTT = 189 reads: +403 validated
umi TGACTCGCGG = 187 reads: +403 validated
umi TGCAAATTCT = 243 reads: +142 -3XX +1 -1XX +256 invalidated
umi TGCACACTAG = 439 reads: +403 validated
umi TGCCTTGCAT = 198 reads: +403 validated
umi TGCTCACGAT = 208 reads: +403 validated
umi TGTGGGTCTA = 145 reads: +403 validated
umi TTAGTATACA = 142 reads: +403 validated
umi TTATTTTCTT = 235 reads: +403 validated

UMI info for barcode CGTTCTGAGTAGCGGT-1 contig 2 = ATACTTTCTG...
umi AAGGCCGCCT = 100 reads: +412 validated
umi ACCGGAAGTT = 208 reads: +412 validated
umi AGTAACTCGT = 3 reads: -349X +1 -1X +2 -1X +1 -1X +1 -1X +1 -8X +2 -3X +1 -1X +1 -3X +1 -4X +20 -1 +8 invalidated
umi CAGCCACCTG = 134 reads: +324 -1 +87 non-validated
umi CAGTGGCTCT = 65 reads: +398 -14 non-validated
umi CGATTCTCAG = 1 reads: -367X +2 -3X +1 -1X +1 -3X +1 -4X +25 -1X +3 invalidated
umi CTAACCAGGC = 33 reads: -349X +1 -1X +2 -1X +1 -1X +1 -1X +1 -8XX +2 -3XX +1 -1XX +1 -3XX +1 -4XX +29 invalidated
umi GATATTCTGT = 76 reads: +399 -13 non-validated
umi GTTTTCAGGA = 152 reads: +412 validated
umi TAAGGAACCC = 208 reads: +412 validated
umi TAATTAGGCC = 290 reads: +412 validated
umi TCTTGGGAAC = 16 reads: -153X +1 -5XX +1 -11XX +1 -1XX +8 -7XX +49 -46 +56 -73 invalidated
umi TGTCTTCCAT = 157 reads: +412 validated
umi TTAAACCTCT = 208 reads: +412 validated
umi TTGCATTGAG = 177 reads: -389X +1 -1X +4 -3X +2 -4X +1 -5X +2 invalidated
umi TTTTATCACG = 189 reads: +412 validated

UMI info for barcode CGTTCTGAGTAGCGGT-1 contig 3 = GCTGGGGTCT...
umi AAAGCTGTCG = 229 reads: +388 validated
umi AAGAGATAGT = 189 reads: +388 validated
umi ACAAGCCCGG = 195 reads: +388 validated
umi ACCTACGGCA = 169 reads: +388 validated
umi ACCTCTGCGG = 228 reads: +388 validated
umi ACGTATGGTT = 122 reads: +388 validated
umi ATACTCGATT = 154 reads: +388 validated
umi ATCTGCATGC = 145 reads: +388 validated
umi ATTAGTATGG = 178 reads: +388 validated
umi ATTTAACTTC = 237 reads: +388 validated
umi ATTTTTAACG = 200 reads: +388 validated
umi CAATGCCTCG = 248 reads: +388 validated
umi CACCTATTCG = 219 reads: +388 validated
umi CCCATTTCGG = 180 reads: +388 validated
umi CCGCAATATA = 254 reads: +388 validated
umi CCTACCATCG = 154 reads: +388 validated
umi CGAACCTCTT = 185 reads: +388 validated
umi CGGTTTGCTC = 204 reads: +388 validated
umi CTATGCATAG = 119 reads: +214 -6XX +1 -3XX +1 -1XX +1 -50XX +3 -2XX +1 -3XX +2 -10XX +90 invalidated
umi CTCAGTAGGG = 168 reads: +388 validated
umi CTGACCTTGG = 107 reads: +388 validated
umi CTTACTCAGC = 184 reads: +388 validated
umi CTTAGCTGAG = 219 reads: +388 validated
umi CTTATTGGCT = 150 reads: +388 validated
umi CTTGTGACAC = 156 reads: +388 validated
umi GAAATTCATA = 158 reads: +388 validated
umi GCAGGGTCGG = 160 reads: +365 -1 +22 non-validated
umi GCCCCCCCAG = 220 reads: +388 validated
umi GCGATGTCAG = 130 reads: +388 validated
umi GCGATTCGGA = 196 reads: +388 validated
umi GCGGAGTGTA = 239 reads: +388 validated
umi GGAACTACGG = 97 reads: +388 validated
umi GGAACTGTTG = 141 reads: +173 -6XX +2 -2XX +1 -2XX +202 invalidated
umi GTCACTTAAC = 174 reads: +388 validated
umi GTCTGGCCGT = 184 reads: +388 validated
umi GTGTGTTACC = 196 reads: +388 validated
umi TATTAGGGTA = 152 reads: +388 validated
umi TCCCTTTCTT = 158 reads: +388 validated
umi TCGTTTTTCA = 209 reads: +388 validated
umi TGGGGTCCTC = 191 reads: +388 validated
umi TGTCTTGGCC = 174 reads: +388 validated
umi TTCCACCGGC = 274 reads: +388 validated
umi TTGTTCCACT = 169 reads: +388 validated
umi TTTTATATAA = 219 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=642]
0-28 ==> 0-28 on |380|IGLV5-45|5'UTR| [len=28] (mis=0)
28-397 ==> 0-369 on |381|IGLV5-45|L-REGION+V-REGION| [len=369] (mis=3)
393-431 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
431-642 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 36 umis using 1199 reads
cdr3 = CMIWHSSAWVF at 370, score = 8 + 8
umis assigned: [17, 26, 53, 92, 113, 120, 128, 142, 149, 169] and 27 others
of which 37 are surviving nonsolos
reads assigned: 7951
start codons at 28, 170, 302, 314, 353, 373
confident = true

TIG 2[bases=520]
0-37 ==> 27-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
37-390 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=1)
401-449 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
449-520 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 9 umis using 129 reads
cdr3 = CARGLWAYYFDYW at 379, score = 9 + 7
umis assigned: [47, 81, 134, 239, 245, 314, 344, 439, 571, 584] and 6 others
of which 16 are surviving nonsolos
reads assigned: 1993
start codons at 16, 37, 81
confident = true

TIG 3[bases=640]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-393 ==> 0-352 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
429-640 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 43 umis using 1196 reads
cdr3 = CSSYTSSSTRVF at 365, score = 8 + 8
umis assigned: [14, 39, 61, 84, 87, 90, 153, 175, 187, 201] and 34 others
of which 44 are surviving nonsolos
reads assigned: 7897
start codons at 41, 198, 242, 249
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.3021 = CGTTCTGAGTCCGGTC-1

using 25 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2, 3^2, 4, 6]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.3032 = CGTTCTGCAAGTTAAG-1

using 93 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 89]
surviving nonsolo ucounts = 1[89]
ids = [0]

====================================================================================

UMI info for barcode CGTTCTGCAAGTTAAG-1 contig 1 = GGGACGTCTC...
umi CCGAGTAGTC = 83 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=446]
14-337 ==> 0-323 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=7)
364-402 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
402-446 ==> 0-44 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CGSYTTTNTWMF at 338, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 81
start codons at 14, 171, 215, 222, 225, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 40.3035 = CGTTCTGCACAACGCC-1

using 337 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2^2, 327]
surviving nonsolo ucounts = 1[327]
ids = [8]

====================================================================================

UMI info for barcode CGTTCTGCACAACGCC-1 contig 1 = GAGGAACTGC...
umi TTTATGTCCA = 326 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=8)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQRGNWPPTF at 354, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 33, 238, 241, 457
confident = false
NOT paired!
sorting bam, mem = 0.11
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk040-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk040-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

122.894 seconds used processing barcodes, peak mem = 0.25
