[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.25 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk037-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk037-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk037.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.1 = CGATGTAAGTTACCCA-1

using 229 reads

====================================================================================

graph has 93 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 222]
surviving nonsolo ucounts = 1[222]
ids = [3]

====================================================================================

UMI info for barcode CGATGTAAGTTACCCA-1 contig 1 = GGGGGGATCT...
umi CTTCTTGTTA = 221 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=512]
23-371 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=17)
404-441 ==> 26-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
441-512 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CASGGRRYFALGVW at 368, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 11, 23, 67
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.5 = CGATGTACAACTTGAC-1

using 73 reads

====================================================================================

graph has 68 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 8[3, 4, 8^2, 9, 12, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.7 = CGATGTACAAGCGTAG-1

using 189 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 6, 8, 171]
surviving nonsolo ucounts = 1[171]
ids = [0]

====================================================================================

UMI info for barcode CGATGTACAAGCGTAG-1 contig 1 = GGGGTCTCAG...
umi ACATCAAGGG = 166 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
426-555 ==> 0-129 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CSSHAGSTRVLF at 362, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 165
start codons at 38, 195, 246, 345, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.10 = CGATGTACAATAAGCA-1

using 243 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 10[2^3, 3^2, 4, 5^2, 7, 207]
surviving nonsolo ucounts = 1[207]
ids = [7]

====================================================================================

UMI info for barcode CGATGTACAATAAGCA-1 contig 1 = GGATCACCCA...
umi TATTATACCC = 196 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=495]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=2)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
461-495 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 401, score = 7 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 59, 257, 262, 279, 323, 356
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.11 = CGATGTACAATCAGAA-1

using 4833 reads

====================================================================================

graph has 2646 edges initially, 36 edges after simplification

total ucounts = 493
nonsolo ucounts = 242[2^72, 3^44, 4^36, 5^13, 6^20, 7^8, 8^9, 9^3, 10^2, 11^2, 12^3, 13^4, 15^2, 16, 17^2, 18^2, 25, 59, 74, 88, 90, 92, 131, 152, 158, 164, 178, 202, 205, 242, 251, 283^2, 311, 588]
surviving nonsolo ucounts = 20[18, 25, 59, 74, 88, 90, 92, 131, 152, 158, 164, 178, 202, 205, 242, 251, 283^2, 311, 588]
ids = [87, 396, 112, 272, 314, 127, 16, 122, 397, 472, ...]

====================================================================================

UMI info for barcode CGATGTACAATCAGAA-1 contig 1 = TCACATGGGA...
umi ACGTCTTTTG = 91 reads: +465 -10 non-validated
umi AGGCACCTTT = 283 reads: +475 validated
umi CATCGAAAGC = 194 reads: +56 -6X +2 -1XX +1 -1XX +389 -19 invalidated
umi CATCGCGGCT = 18 reads: +275 -200 non-validated
umi CCCAGTTGGA = 58 reads: +339 -4X +2 -4XX +6 -1 +2 -1 +6 -2 +108 invalidated
umi CCCGTCGCCG = 130 reads: +460 -1 +3 -11 non-validated
umi CCCTTTACTT = 89 reads: +463 -7 +5 non-validated
umi CTACGACGGA = 181 reads: +475 validated
umi CTTGCATTAC = 174 reads: +475 validated
umi GCAGCTATGT = 66 reads: +2 -1 +1 -1 +449 -21 non-validated
umi GTATACATCC = 90 reads: +458 -17 non-validated
umi TACTTCCCGA = 206 reads: +475 validated
umi TATTGGGCCT = 154 reads: +452 -23 non-validated
umi TTTAGTGTTA = 147 reads: +475 validated
umi TTTCTCCCTA = 311 reads: +475 validated

UMI info for barcode CGATGTACAATCAGAA-1 contig 2 = AGGAATCAGA...
umi CTCCTTAATA = 229 reads: +388 validated
umi GCATAATCTG = 261 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=604]
0-27 ==> 4-31 on |185|IGHV4-34|5'UTR| [len=31] (mis=0)
27-398 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
410-441 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=2)
439-502 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=4)
502-604 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 7 umis using 104 reads
cdr3 = CARGRRDLGYCSGGSCYLVYYYYYMDVW at 387, score = 9 + 7
umis assigned: [16, 29, 86, 87, 112, 122, 127, 197, 244, 272] and 5 others
of which 15 are surviving nonsolos
reads assigned: 2156
start codons at 4, 27, 48, 92, 178, 459, 520, 581
confident = true

TIG 2[bases=500]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=0)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
415-500 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 79 reads
cdr3 = CQQYNSYPWTF at 354, score = 9 + 8
umis assigned: [219, 273]
of which 2 are surviving nonsolos
reads assigned: 485
start codons at 27, 33, 89, 102, 238, 457
confident = true
now this is a cell
paired!

CGCGATCTAGGATATTGTAGTGGTGGTAGCTGCTACTTGGTCTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTACCCTTGGACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.13 = CGATGTACACACAGAG-1

using 32 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2^2, 4, 5, 6, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.20 = CGATGTACACGAAACG-1

using 264 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 256]
surviving nonsolo ucounts = 1[256]
ids = [0]

====================================================================================

UMI info for barcode CGATGTACACGAAACG-1 contig 1 = ACCCAAAAAC...
umi AAAGTCCCAC = 243 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=536]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-536 ==> 0-46 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.26 = CGATGTACAGATCTGT-1

using 64 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[4^2, 48]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.29 = CGATGTACAGCTATTG-1

using 221 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 10, 203]
surviving nonsolo ucounts = 1[203]
ids = [6]

====================================================================================

UMI info for barcode CGATGTACAGCTATTG-1 contig 1 = GGGGTCTCAG...
umi TACTAGGAGT = 193 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=534]
0-38 ==> 4-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
38-386 ==> 0-348 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=6)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
426-534 ==> 0-108 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CCSYAGSYSVVF at 362, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 38, 177, 195, 239, 246, 249, 345, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.30 = CGATGTACAGCTCGAC-1

using 234 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 7, 220]
surviving nonsolo ucounts = 1[220]
ids = [4]

====================================================================================

UMI info for barcode CGATGTACAGCTCGAC-1 contig 1 = ATTTCCTTAA...
umi GGCGCAGGCG = 1 reads: -208 +2 -2 +1 -4X +2 -1 +8 -3 +3 -1 +6 -1 +5 -1 +3 -4 +1 -2X +1 -1 +2 -1 +1 -202 invalidated
umi GGGGGAGGCG = 204 reads: +466 validated

GOOD CONTIGS

TIG 1[bases=545]
0-50 ==> 0-50 on |189|IGHV4-39|5'UTR| [len=50] (mis=0)
50-427 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=3)
427-448 ==> 0-21 on |21|IGHD3-3|D-REGION| [len=31] (mis=0)
453-516 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
516-545 ==> 0-29 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARGYYDFWSGLGIYYYYGMDVW at 416, score = 9 + 7
umis assigned: [2, 4]
of which 1 are surviving nonsolos
reads assigned: 202
start codons at 34, 50, 59, 71, 115, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.31 = CGATGTACAGCTCGCA-1

using 263 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 3, 258]
surviving nonsolo ucounts = 1[258]
ids = [1]

====================================================================================

UMI info for barcode CGATGTACAGCTCGCA-1 contig 1 = GGGAATCAGT...
umi CCCGACATTC = 239 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=501]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-501 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.36 = CGATGTACAGTATCTG-1

using 211 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[211]
surviving nonsolo ucounts = 1[211]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=462]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
0-54 ==> 11310-11364 on rc of segment before IGHV3-19 exon 1 [len=11364] (mis=0)
40-72 ==> 10108-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=23)
412-462 ==> 0-50 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
cdr3 = CARGSTSWYDYW at 396, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 54, 205, 252, 257, 289, 351
confident = false
VJ delta = 11
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.37 = CGATGTACAGTCAGCC-1

using 254 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[253]
surviving nonsolo ucounts = 1[253]
ids = [0]

====================================================================================

UMI info for barcode CGATGTACAGTCAGCC-1 contig 1 = GGGGGCGCCA...
umi GATCGCTTGT = 234 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=572]
0-34 ==> 0-34 on |385|IGLV7-43|5'UTR| [len=34] (mis=3)
34-385 ==> 0-351 on |386|IGLV7-43|L-REGION+V-REGION| [len=351] (mis=0)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-572 ==> 0-150 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLLYYGGAQVVF at 358, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 34, 371
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.48 = CGATGTACATTCCTCG-1

using 2987 reads

====================================================================================

graph has 3934 edges initially, 30 edges after simplification

total ucounts = 1250
nonsolo ucounts = 572[2^240, 3^112, 4^70, 5^34, 6^33, 7^25, 8^9, 9^6, 10^13, 11^9, 12^4, 13^3, 14^5, 15^4, 16, 17^3, 31]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.52 = CGATGTAGTACACCGC-1

using 31 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[31]
surviving nonsolo ucounts = 1[31]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.57 = CGATGTAGTAGCGCTC-1

using 72 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[72]
surviving nonsolo ucounts = 1[72]
ids = [0]

====================================================================================

UMI info for barcode CGATGTAGTAGCGCTC-1 contig 1 = GGAGGAACTG...
umi GGTTAGTCTA = 59 reads: +349 -3 +7 -2X +18 -1 +2 invalidated

GOOD CONTIGS

TIG 1[bases=416]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CQQRSNWPITF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 58
start codons at 34, 239, 242
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.65 = CGATGTAGTCGGCATC-1

using 150 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[150]
surviving nonsolo ucounts = 1[150]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.67 = CGATGTAGTCTCACCT-1

using 136 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[135]
surviving nonsolo ucounts = 1[135]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=401]
0-350 ==> 1-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
349-387 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
cdr3 = CQQYNGQSRAF at 326, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 119
start codons at 5, 74, 210, 213, 306, 339
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.79 = CGATGTAGTTACGCGC-1

using 112 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 8[2^4, 3, 4, 7, 85]
surviving nonsolo ucounts = 1[85]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.82 = CGATGTAGTTATTCTC-1

using 8857 reads

====================================================================================

graph has 6545 edges initially, 140 edges after simplification

total ucounts = 1434
nonsolo ucounts = 1056[2^202, 3^176, 4^116, 5^111, 6^112, 7^81, 8^69, 9^54, 10^34, 11^18, 12^17, 13^11, 14^15, 15^9, 16^8, 17^2, 18, 19, 20^2, 23^2, 60, 114, 122, 161, 165, 170, 171, 176, 209, 216, 226^2, 232, 236, 252]
surviving nonsolo ucounts = 15[60, 114, 122, 161, 165, 170, 171, 176, 209, 216, 226^2, 232, 236, 252]
ids = [1237, 283, 530, 205, 904, 1154, 1041, 1254, 506, 1186, ...]

====================================================================================

UMI info for barcode CGATGTAGTTATTCTC-1 contig 1 = GAGGAGTCAG...
umi AGACGCCGCG = 113 reads: +394 validated
umi CAATCGCCGG = 230 reads: +394 validated
umi CCAGGATCCA = 207 reads: +394 validated
umi CGCACGTGGA = 228 reads: +394 validated
umi CTTCTTATGG = 252 reads: +394 validated
umi GGATTAATTG = 165 reads: +394 validated
umi TACGTGCGCT = 225 reads: +394 validated
umi TATAGCCTAT = 170 reads: +394 validated
umi TCCGATAGTA = 214 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=558]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
384-422 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 9 umis using 240 reads
cdr3 = CQQSYSTLRPWTF at 355, score = 9 + 8
umis assigned: [283, 442, 506, 557, 658, 904, 1117, 1154, 1186]
of which 9 are surviving nonsolos
reads assigned: 1782
start codons at 28, 34, 90, 103, 239, 464
confident = true

REJECT CONTIGS

TIG 1[bases=589]
0-98 ==> 5512-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=3)
51-411 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=2)
415-453 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
453-589 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWGLLLHARYTLAPIFTF at 371, score = 3 + 8
umis assigned: [205, 628, 1041, 1254]
of which 4 are surviving nonsolos
reads assigned: 736
start codons at 51, 84, 112, 120, 208, 370, 390, 495
confident = false
not full
frameshifted full length transcript of length 589
VJ delta = 30
not full

TIG 2[bases=475]
0-58 ==> 3-61 on |84|IGHV1-69|5'UTR| [len=61] (mis=0)
0-58 ==> 8395-8453 on rc of segment before IGHV2-70D exon 2 [len=8453] (mis=0)
29-76 ==> 10093-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=4)
58-411 ==> 0-353 on |85|IGHV1-69|L-REGION+V-REGION| [len=353] (mis=5)
431-475 ==> 0-44 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
cdr3 = CAVRVSGITGTLLDYW at 400, score = 9 + 7
umis assigned: [530]
of which 1 are surviving nonsolos
reads assigned: 103
start codons at 58, 209, 256, 355
confident = false
VJ delta = 8
not full
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.83 = CGATGTAGTTCACCTC-1

using 264 reads

====================================================================================

graph has 118 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 108, 150]
surviving nonsolo ucounts = 2[108, 150]
ids = [2, 0]

====================================================================================

UMI info for barcode CGATGTAGTTCACCTC-1 contig 1 = CCTCAGTTCA...
umi AATCGGGGCC = 145 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=468]
0-20 ==> 10-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
20-380 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=0)
385-423 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
423-468 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CMQGTHWPPKWTF at 356, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 143
start codons at 20, 53, 81, 89, 177, 339, 359
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.85 = CGATGTAGTTCCCTTG-1

using 77 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[7, 70]
surviving nonsolo ucounts = 1[70]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=422]
0-337 ==> 16-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=23)
342-393 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
393-422 ==> 0-29 on |40|IGHG1|C-REGION| [len=884] (mis=0)
cdr3 = CARGSTSWYDYW at 326, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 63
start codons at 135, 182, 187, 219, 281
confident = false
VJ delta = 11
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.92 = CGATGTAGTTTGTGTG-1

using 3275 reads

====================================================================================

graph has 2178 edges initially, 22 edges after simplification

total ucounts = 568
nonsolo ucounts = 191[2^91, 3^40, 4^20, 5^8, 6^3, 7^3, 8, 12, 19, 32, 36, 46, 53, 55, 61, 66, 73, 75, 77, 92, 99, 116, 118, 124, 141, 142, 143, 155, 162, 173, 175, 184]
surviving nonsolo ucounts = 24[19, 32, 36, 46, 53, 55, 61, 66, 73, 75, 77, 92, 99, 116, 118, 124, 141, 142, 143, 155, 162, 173, 175, 184]
ids = [104, 514, 136, 393, 215, 157, 422, 93, 151, 175, ...]

====================================================================================

UMI info for barcode CGATGTAGTTTGTGTG-1 contig 1 = ACATGGAAAA...
umi CACGTTCGGC = 34 reads: +108 -1 +301 -10 +4 -1 +5 -1 +6 -1 +1 non-validated
umi CGTCGGCGGA = 97 reads: +439 validated
umi CTGTACCGGG = 139 reads: +439 validated
umi GTTCCGACGG = 118 reads: +439 validated
umi TACAGCGAGA = 46 reads: +371 -1 +10 -24 +33 non-validated
umi TATTTCTCAT = 139 reads: +439 validated
umi TCAGAGTGGT = 62 reads: +439 validated

UMI info for barcode CGATGTAGTTTGTGTG-1 contig 2 = GCTGTGCTGT...
umi AATGTTTGGA = 176 reads: +370 validated
umi ATACAGGTAG = 183 reads: +370 validated
umi ATCATAGAAC = 65 reads: +370 validated
umi CAAGAGTTCG = 91 reads: +370 validated
umi CATAATTCCT = 117 reads: +370 validated
umi CATTCATTAG = 55 reads: +370 validated
umi CCCGACCTGT = 78 reads: +370 validated
umi GCACCGTACA = 77 reads: +370 validated
umi GCCTAGCGGA = 153 reads: +370 validated
umi GTCCCCTTCG = 175 reads: +370 validated
umi TAACTCACCT = 114 reads: +370 validated
umi TCTAACATCG = 164 reads: +370 validated
umi TTGAAGCGTT = 148 reads: +370 validated

GOOD CONTIGS

TIG 1[bases=591]
0-46 ==> 55-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=1)
46-402 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=38)
433-485 ==> 0-52 on |49|IGHJ1|J-REGION| [len=52] (mis=4)
485-591 ==> 0-106 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 5 umis using 74 reads
cdr3 = CVRGPHCSRLGCYGGEYFQHW at 391, score = 7 + 7
umis assigned: [136, 220, 241, 369, 393, 415, 422]
of which 7 are surviving nonsolos
reads assigned: 623
start codons at 2, 46, 90, 194, 259, 335, 382, 428
confident = true

TIG 2[bases=624]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-301 ==> 0-258 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=19)
301-371 ==> 267-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=4)
375-413 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
413-624 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 13 umis using 265 reads
cdr3 = CQSADNNAAWVF at 349, score = 8 + 8
umis assigned: [24, 83, 93, 130, 141, 157, 175, 294, 305, 354] and 3 others
of which 13 are surviving nonsolos
reads assigned: 1569
start codons at 43, 104, 191, 238, 368
confident = true
see deletion of 9 bases at pos 258 on |363|IGLV3-25|L-REGION+V-REGION|
now this is a cell
paired!

TATTACTGTGTGAGAGGGCCCCATTGTAGTCGTCTTGGCTGCTATGGGGGCGAATACTTCCAGCATTGGGGCCAGGGCACCCTGGTCACCGTCTCCCCAG <==> AGTGGGGTCCAGGCAGAAGACGAGGCTGACTATTATTGTCAATCAGCAGACAACAATGCTGCTTGGGTGTTCGGCGGAGGGACCAAACTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.95 = CGATGTATCACTATTC-1

using 29 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 24]
surviving nonsolo ucounts = 1[24]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.97 = CGATGTATCAGCTGGC-1

using 171 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 165]
surviving nonsolo ucounts = 1[165]
ids = [0]

====================================================================================

UMI info for barcode CGATGTATCAGCTGGC-1 contig 1 = GAATCAGTCC...
umi AAGCTGAATA = 143 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=480]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-480 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 138
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.98 = CGATGTATCAGTTTGG-1

using 198 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 192]
surviving nonsolo ucounts = 1[192]
ids = [2]

====================================================================================

UMI info for barcode CGATGTATCAGTTTGG-1 contig 1 = GCTGGGGTCT...
umi GGTTATGAGT = 185 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=527]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-356 ==> 0-315 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=12)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
429-527 ==> 0-98 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CTSYAGGSNVVF at 365, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 41, 249, 348, 375, 390
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.104 = CGATGTATCCAGATCA-1

using 8018 reads

====================================================================================

graph has 4025 edges initially, 60 edges after simplification

total ucounts = 558
nonsolo ucounts = 227[2^93, 3^34, 4^28, 5^12, 6^8, 7^2, 8^3, 9^4, 10^3, 13^3, 27, 28, 40, 56, 65, 90, 95, 127, 133, 141, 145, 159, 161, 166, 169, 182, 192, 194, 198, 202, 210, 220, 223, 234, 236^2, 240, 242, 249, 258, 259, 277, 283, 286, 298^2, 417]
surviving nonsolo ucounts = 35[40, 56, 65, 90, 95, 127, 133, 141, 145, 159, 161, 166, 169, 182, 192, 194, 198, 202, 210, 220, 223, 234, 236^2, 240, 242, 249, 258, 259, 277, 283, 286, 298^2, 417]
ids = [23, 260, 254, 208, 282, 51, 330, 358, 412, 137, ...]

====================================================================================

UMI info for barcode CGATGTATCCAGATCA-1 contig 1 = AGCTCTCAGA...
umi AACTAACTCC = 218 reads: +412 validated
umi AAGACTTGGT = 41 reads: +21 -3 +284 -9 +84 -1 +2 -8 non-validated
umi ACATGGTCGT = 166 reads: +397 -1 +14 non-validated
umi ACATTTACTC = 113 reads: +412 validated
umi ACGTACCTGC = 153 reads: +412 validated
umi ATAATACGCT = 192 reads: +412 validated
umi ATATGATCCA = 375 reads: +412 validated
umi ATTCCTTTAA = 290 reads: +395 -17 non-validated
umi ATTGGGGTTA = 279 reads: +412 validated
umi CCTACAGGCA = 242 reads: +412 validated
umi CGGTCCGCGG = 62 reads: -412 non-validated
umi CGTGCTTACG = 57 reads: +384 -1 +27 non-validated
umi GCCAGTCCAA = 131 reads: +408 -4 non-validated
umi GGGCGCTTTT = 10 reads: -333X +1 -1X +2 -5XX +2 -1XX +1 -4XX +1 -1XX +1 -1XX +1 -4XX +1 -3XX +2 -2XX +45 invalidated
umi TACTCAGCAT = 144 reads: +412 validated
umi TCCGAGCGTT = 202 reads: +412 validated

UMI info for barcode CGATGTATCCAGATCA-1 contig 2 = TGGGGAGGAA...
umi AACACTGAGC = 183 reads: +388 validated
umi CCAATGGCAT = 298 reads: +388 validated
umi CCCAGCCGCA = 232 reads: +388 validated
umi CCGAACTAGG = 299 reads: +388 validated
umi GTTTTGTCCA = 225 reads: +388 validated
umi TCCTCGGACT = 287 reads: +388 validated
umi TCTCATAGTC = 232 reads: +388 validated
umi TGCGCACCCT = 198 reads: +388 validated
umi TGCTGCCCTC = 258 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=562]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=10)
442-491 ==> 0-49 on |56|IGHJ5|J-REGION| [len=49] (mis=4)
491-562 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 11 umis using 166 reads
cdr3 = CARVAKIGGFDPW at 421, score = 8 + 7
umis assigned: [19, 23, 50, 51, 63, 86, 98, 131, 136, 223] and 6 others
of which 16 are surviving nonsolos
reads assigned: 2617
start codons at 79, 235, 356, 382
confident = true

TIG 2[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=1)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 9 umis using 364 reads
cdr3 = CLQHNSYPCSF at 359, score = 9 + 7
umis assigned: [9, 192, 202, 211, 395, 448, 467, 490, 494]
of which 9 are surviving nonsolos
reads assigned: 2170
start codons at 32, 38, 107, 189, 243, 462
confident = true
now this is a cell
paired!

CTGAGAGACGAGGACACGGCTGTGTATTACTGTGCGAGAGTTGCTAAGATAGGGGGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCTACAGCATAATAGTTACCCGTGCAGTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.116 = CGATGTATCGTCACGG-1

using 1644 reads

====================================================================================

graph has 2491 edges initially, 10 edges after simplification

total ucounts = 861
nonsolo ucounts = 336[2^162, 3^74, 4^39, 5^27, 6^9, 7^12, 8^3, 9^3, 10^2, 11, 14^3, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.118 = CGATGTATCTAGAGTC-1

using 459 reads

====================================================================================

graph has 128 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[155, 300]
surviving nonsolo ucounts = 2[155, 300]
ids = [0, 2]

====================================================================================

UMI info for barcode CGATGTATCTAGAGTC-1 contig 1 = AACAACCACA...
umi ATACGCGCCC = 153 reads: +418 validated

UMI info for barcode CGATGTATCTAGAGTC-1 contig 2 = GAGTCAGACT...
umi CAGTCATGCG = 275 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=491]
0-51 ==> 253-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
51-404 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=41)
423-469 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
469-491 ==> 0-22 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CALVSTLSALPFDFW at 393, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 152
start codons at 51, 249, 255, 348
confident = false

TIG 2[bases=481]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
413-481 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQYNGQSRAF at 352, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 25, 31, 100, 236, 239, 332, 365, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.120 = CGATGTATCTCGATGA-1

using 326 reads

====================================================================================

graph has 120 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 20, 301]
surviving nonsolo ucounts = 2[20, 301]
ids = [3, 1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=565]
0-75 ==> 5533-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=3)
391-429 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWDLLLHASSTNSSITF at 350, score = 4 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 30, 63, 99, 187, 349, 369, 471
confident = false
not full
frameshifted full length transcript of length 565
VJ delta = 30
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.132 = CGATTGAAGAATGTTG-1

using 308 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[6, 297]
surviving nonsolo ucounts = 1[297]
ids = [1]

====================================================================================

UMI info for barcode CGATTGAAGAATGTTG-1 contig 1 = AGTGCTTTCT...
umi AGCCTCCTCT = 288 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=543]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=6)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
453-543 ==> 0-90 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CARAHGDYYTLLDYW at 377, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 285
start codons at 17, 38, 82, 168, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.133 = CGATTGAAGACCTAGG-1

using 236 reads

====================================================================================

graph has 74 edges initially, 6 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[6, 228]
surviving nonsolo ucounts = 2[6, 228]
ids = [2, 3]

====================================================================================

UMI info for barcode CGATTGAAGACCTAGG-1 contig 1 = GGGAATCAGT...
umi AGTGAAATCG = 2 reads: -69 +4 -1X +21 -2X +1 -1X +9 -3X +9 -1 +3 -264X invalidated
umi TTTACGCCAA = 225 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 225
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 37.135 = CGATTGAAGATAGGAG-1

using 445 reads

====================================================================================

graph has 180 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 5[2, 5, 9, 69, 360]
surviving nonsolo ucounts = 2[69, 360]
ids = [1, 3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=456]
0-280 ==> 65-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
282-320 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
320-456 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYNNWPPRAF at 256, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 354
start codons at 4, 140, 362
confident = false
not full
VJ delta = 14
not full
NOT paired!
sorting bam, mem = 0.06
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk037-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk037-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

6.647 seconds used processing barcodes, peak mem = 0.23
