[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.27 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk035-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk035-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk035.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.0 = CGATCGGAGGAATCGC-1

using 7751 reads

====================================================================================

graph has 3342 edges initially, 80 edges after simplification

total ucounts = 352
nonsolo ucounts = 159[2^66, 3^27, 4^13, 5^8, 6^6, 7^3, 8, 9, 13^2, 22, 46, 67^2, 96, 112, 119, 150, 167, 175, 186, 198, 199, 201, 205, 211, 226, 234, 240, 244, 247, 265, 279, 280, 297, 301, 324, 328, 378, 403, 437, 448]
surviving nonsolo ucounts = 31[46, 67^2, 96, 112, 119, 150, 167, 175, 186, 198, 199, 201, 205, 211, 226, 234, 240, 244, 247, 265, 279, 280, 297, 301, 324, 328, 378, 403, 437, 448]
ids = [211, 38, 234, 299, 224, 230, 95, 272, 14, 32, ...]

====================================================================================

UMI info for barcode CGATCGGAGGAATCGC-1 contig 1 = ACTTTCTGAG...
umi CAAAGCTCCT = 151 reads: +433 validated
umi CGCCCACCGG = 304 reads: +433 validated
umi TCGCACACCT = 181 reads: +433 validated
umi TTCATTAAGG = 244 reads: +433 validated

UMI info for barcode CGATCGGAGGAATCGC-1 contig 2 = AGCTTCAGCT...
umi AACTTAGGCC = 180 reads: +391 validated
umi ACACGATATG = 182 reads: +391 validated
umi CGTTGCACAC = 194 reads: +391 validated
umi CTGAATCTCG = 273 reads: +391 validated
umi CTGGTATGGG = 440 reads: +391 validated
umi GCCGTACGTG = 44 reads: +322 -49 +20 non-validated
umi GGCCACTGGA = 108 reads: +391 validated
umi GGTCCATCCG = 113 reads: +391 validated
umi GTAGAATTAC = 42 reads: +14 -2X +2 -2X +1 -1 +1 -2X +1 -2XX +1 -12XX +1 -1XX +281 -67 invalidated
umi TATATAGTCA = 232 reads: +391 validated
umi TATCTATCGG = 113 reads: +21 -1X +1 -2XX +1 -2XX +1 -12XX +1 -1XX +348 invalidated
umi TCGTTCGTGT = 94 reads: +391 validated
umi TTCAAGGGCT = 239 reads: +391 validated
umi TTGAGGGCTC = 193 reads: +391 validated
umi TTTAAATAGG = 198 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=539]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=1)
405-468 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=4)
468-539 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 4 umis using 68 reads
cdr3 = CARATTHFDWLSYYYYYMDVW at 374, score = 9 + 7
umis assigned: [95, 148, 295, 337]
of which 4 are surviving nonsolos
reads assigned: 867
start codons at 35, 79, 425
confident = true

TIG 2[bases=600]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
399-437 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
437-600 ==> 0-163 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 13 umis using 360 reads
cdr3 = CAAWDDSLSGSWVF at 367, score = 7 + 8
umis assigned: [14, 32, 160, 177, 181, 211, 224, 230, 234, 266] and 5 others
of which 15 are surviving nonsolos
reads assigned: 2598
start codons at 46, 200, 350, 375, 380
confident = true

REJECT CONTIGS

TIG 1[bases=546]
0-85 ==> 5527-5612 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=3)
36-84 ==> 0-48 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
84-296 ==> 60-272 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=33)
317-377 ==> 0-60 on segment before IGKV1D-42 exon 1 [len=9605] (mis=0)
335-357 ==> 312-334 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0) [SHIFT!]
382-410 ==> 10-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [38, 44, 179, 208, 226, 271]
of which 6 are surviving nonsolos
reads assigned: 1478
start codons at 69, 85, 93, 181, 312, 329, 333, 342, 452
confident = false
see deletion of 12 bases at pos 48 on |273|IGKV2D-28|L-REGION+V-REGION|
did not find CDR3

TIG 2[bases=423]
3-242 ==> 2406-2645 on rc of segment before IGHD1-1 exon 1 [len=2645] (mis=0)
304-352 ==> 15-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
352-423 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [132]
of which 1 are surviving nonsolos
reads assigned: 433
start codons at 309
confident = false
did not find CDR3

TIG 3[bases=582]
5-100 ==> 5518-5613 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=3)
50-259 ==> 0-209 on |271|IGKV2D-26|L-REGION+V-REGION| [len=360] (mis=2)
260-411 ==> 209-360 on |271|IGKV2D-26|L-REGION+V-REGION| [len=360] (mis=1) [SHIFT!]
409-446 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
446-582 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [82, 102, 180, 246, 321]
of which 5 are surviving nonsolos
reads assigned: 1452
start codons at 83, 119, 170, 207, 271, 370, 390, 397, 488
confident = false
did not find CDR3
now this is a cell
paired!

TATTACTGTGCGAGAGCCACTACCCATTTTGACTGGTTATCGTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> CTCCGGTCCGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAGTGGTTCTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.2 = CGATCGGAGGAGTTTA-1

using 239 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[5, 233]
surviving nonsolo ucounts = 1[233]
ids = [1]

====================================================================================

UMI info for barcode CGATCGGAGGAGTTTA-1 contig 1 = GGAATCAGTC...
umi GTACAGCTTG = 218 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=485]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-485 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.10 = CGATCGGAGTAGATGT-1

using 1100 reads

====================================================================================

graph has 294 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[237, 861]
surviving nonsolo ucounts = 2[237, 861]
ids = [1, 3]

====================================================================================

UMI info for barcode CGATCGGAGTAGATGT-1 contig 1 = ATCAGTCCCA...
umi CGGATCCTGC = 218 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=504]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-504 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.12 = CGATCGGAGTCGATAA-1

using 23 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.14 = CGATCGGAGTCTTGCA-1

using 562 reads

====================================================================================

graph has 268 edges initially, 36 edges after simplification

total ucounts = 11
nonsolo ucounts = 9[2, 4, 5^2, 7, 8, 11, 254, 264]
surviving nonsolo ucounts = 2[254, 264]
ids = [7, 3]

====================================================================================

UMI info for barcode CGATCGGAGTCTTGCA-1 contig 1 = AGGAATCAGT...
umi TCCTGCATCC = 255 reads: +22 -1XX +235 -2XX +128 invalidated

UMI info for barcode CGATCGGAGTCTTGCA-1 contig 2 = GAGTCAGACT...
umi GGATCGCTCA = 249 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=493]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=16)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-493 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 27, 33, 102, 238, 457
confident = false

TIG 2[bases=491]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-491 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYNSYPLTF at 352, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 25, 31, 87, 100, 236, 239, 332, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.23 = CGATCGGCACAGACAG-1

using 1767 reads

====================================================================================

graph has 514 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[3, 1756]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=344]
12-59 ==> 3114-3161 on segment before IGLJ5 exon 1 [len=3161] (mis=6)
60-132 ==> 0-72 on |315|IGLJ5|J-REGION| [len=72] (mis=9)
133-344 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [3]
of which 0 are surviving nonsolos
reads assigned: 1730
start codons at 76
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.25 = CGATCGGCACATCTTT-1

using 553 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 3, 544]
surviving nonsolo ucounts = 1[544]
ids = [4]

====================================================================================

UMI info for barcode CGATCGGCACATCTTT-1 contig 1 = GGCTTTCTGA...
umi TTTAGTTCGA = 530 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=568]
15-390 ==> 0-375 on |188|IGHV4-39|L-REGION+V-REGION| [len=375] (mis=33)
415-463 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
463-568 ==> 0-105 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 70 reads
cdr3 = CARSVHFYETVGYFDYW at 381, score = 9 + 6
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 526
start codons at 15, 24, 36, 80, 403
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.34 = CGATCGGCAGATCCAT-1

using 1066 reads

====================================================================================

graph has 322 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[4, 451, 609]
surviving nonsolo ucounts = 2[451, 609]
ids = [1, 2]

====================================================================================

UMI info for barcode CGATCGGCAGATCCAT-1 contig 1 = AGCAGAGCTC...
umi CGACTTCCTC = 448 reads: +394 validated

UMI info for barcode CGATCGGCAGATCCAT-1 contig 2 = CAGTCCCAGT...
umi GATTAACCAC = 621 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=630]
0-25 ==> 35-60 on |373|IGLV4-69|5'UTR| [len=60] (mis=0)
25-384 ==> 0-359 on |374|IGLV4-69|L-REGION+V-REGION| [len=359] (mis=1)
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
419-630 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 93 reads
cdr3 = CQTWGTGIRVF at 358, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 446
start codons at 25, 186, 226, 242, 341
confident = false

TIG 2[bases=545]
0-21 ==> 37-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
21-372 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=18)
370-409 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
409-545 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 103 reads
cdr3 = CQQLKSYPHTF at 348, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 602
start codons at 21, 27, 83, 232, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.37 = CGATCGGCAGTACACT-1

using 770 reads

====================================================================================

graph has 682 edges initially, 6 edges after simplification

total ucounts = 153
nonsolo ucounts = 48[2^14, 3^10, 4^7, 5^5, 6^2, 7, 8^2, 9^2, 10, 14, 21, 172, 284]
surviving nonsolo ucounts = 2[172, 284]
ids = [34, 100]

====================================================================================

UMI info for barcode CGATCGGCAGTACACT-1 contig 1 = GGAGAAGAGC...
umi ATACTAGACT = 157 reads: +385 validated
umi GCGTTCTCGG = 258 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=504]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=8)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
421-504 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 63 reads
cdr3 = CQQYGSSPGTF at 360, score = 9 + 8
umis assigned: [34, 100]
of which 2 are surviving nonsolos
reads assigned: 407
start codons at 36, 244, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.39 = CGATCGGCAGTTCATG-1

using 245 reads

====================================================================================

graph has 104 edges initially, 8 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[60, 183]
surviving nonsolo ucounts = 2[60, 183]
ids = [3, 2]

====================================================================================

UMI info for barcode CGATCGGCAGTTCATG-1 contig 1 = GTGGGTCCAG...
umi TTCATATTAG = 185 reads: +373 validated
umi TTTGGCTAAC = 65 reads: +39 -1XX +1 -6XX +2 -2XX +1 -1XX +1 -5XX +2 -145X +1 -9XX +1 -1XX +155 invalidated

GOOD CONTIGS

TIG 1[bases=619]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=7)
370-408 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
408-619 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 46 reads
cdr3 = CQSPDSQGVF at 350, score = 8 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 241
start codons at 35, 96, 165, 183
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.47 = CGATCGGCATTCACTT-1

using 64 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[64]
surviving nonsolo ucounts = 1[64]
ids = [0]

====================================================================================

UMI info for barcode CGATCGGCATTCACTT-1 contig 1 = ACCGAGGATT...
umi TTCGTATCAT = 62 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=459]
14-367 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
391-438 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
438-459 ==> 0-21 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARDRAATARLGGMDVW at 356, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 61
start codons at 14, 165, 170, 317, 395
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.48 = CGATCGGCATTGGCGC-1

using 264 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 261]
surviving nonsolo ucounts = 1[261]
ids = [0]

====================================================================================

UMI info for barcode CGATCGGCATTGGCGC-1 contig 1 = AGGAGTCAGA...
umi ATGGGTGGCC = 245 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=473]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-473 ==> 0-58 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYNTYIWTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 27, 33, 102, 240, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.50 = CGATCGGGTAAGCACG-1

using 23 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.52 = CGATCGGGTAGGAGTC-1

using 220 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[220]
surviving nonsolo ucounts = 1[220]
ids = [0]

====================================================================================

UMI info for barcode CGATCGGGTAGGAGTC-1 contig 1 = GGGCCTCAGG...
umi TCTGTGACCT = 205 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=540]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-369 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
373-411 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
411-540 ==> 0-129 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQAWDSTEVVF at 350, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 35, 40, 329, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.54 = CGATCGGGTATCAGTC-1

using 325 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[98, 223]
surviving nonsolo ucounts = 2[98, 223]
ids = [2, 1]

====================================================================================

UMI info for barcode CGATCGGGTATCAGTC-1 contig 1 = GCTCTGCTTC...
umi CGCGTCAGTC = 218 reads: +391 validated
umi GATTAAGGTT = 99 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=570]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-391 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
442-570 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 61 reads
cdr3 = CQSYDKSLRGAVF at 375, score = 7 + 8
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 311
start codons at 51, 135, 208, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.56 = CGATCGGGTCAACATC-1

using 660 reads

====================================================================================

graph has 1074 edges initially, 6 edges after simplification

total ucounts = 346
nonsolo ucounts = 129[2^70, 3^21, 4^12, 5^10, 6^5, 7, 8^4, 9^2, 11^2, 16, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.61 = CGATCGGGTGATAAAC-1

using 2666 reads

====================================================================================

graph has 2292 edges initially, 24 edges after simplification

total ucounts = 569
nonsolo ucounts = 204[2^95, 3^46, 4^23, 5^16, 6^7, 7^4, 9, 12, 15, 17, 66, 99, 173, 178, 192, 199, 216, 260, 295]
surviving nonsolo ucounts = 8[66, 99, 173, 178, 192, 216, 260, 295]
ids = [511, 419, 306, 437, 320, 503, 266, 544]

====================================================================================

UMI info for barcode CGATCGGGTGATAAAC-1 contig 1 = GAGAAGAGCT...
umi GATCCATCTT = 3 reads: -368X +3 -6X +1 -2X +1 -1X invalidated
umi TCCTATGCTT = 180 reads: +382 validated
umi TTCCATCTAG = 65 reads: -353 +6 -1X +7 -1X +1 -1X +1 -1X +8 -1X +1 invalidated

UMI info for barcode CGATCGGGTGATAAAC-1 contig 2 = GGGAGCATCA...
umi CGTACTTCTC = 261 reads: +436 validated
umi CTTTCTCGGC = 168 reads: +436 validated
umi TGATTCGGGT = 41 reads: +17 -1XX +5 -1XX +17 -1XX +5 -1X +3 -74 +3 -1XX +5 -1XX +5 -1XX +7 -1XX +1 -5XX +3 -3XX +27 -1XX +15 -1XX +5 -2XX +1 -1XX +4 -70X +2 -1XX +2 -1XX +1 -1XX +1 -1XX +5 -1XX +3 -2XX +10 -1XX +20 -2XX +9 -7XX +1 -1XX +1 -4XX +1 -70X invalidated
umi TTATGCCTGT = 219 reads: +436 validated
umi TTGTTCGGTC = 297 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=553]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
35-94 ==> 0-59 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
94-337 ==> 62-305 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=20)
394-417 ==> 16-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CQHYGVPPLTF at 356, score = 6 + 9
umis assigned: [320, 437, 511]
of which 3 are surviving nonsolos
reads assigned: 241
start codons at 35, 240, 366, 459
confident = true
see deletion of 3 bases at pos 59 on |283|IGKV3-20|L-REGION+V-REGION|
>vscore_35.61_69.3%
ATGGAAACCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGACACCACCGGAATTGTGTTGACGCAGTCTCCAGACACCCTGTCTTTGTCTCCAGGGGAAAGAGCCTCCCTCTCTTGTAGGGCCAGTCAGACTATTAGAAATTCCGCCTTAGCCTGGTACCAGCAGATTCCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCATCCAACAGGGCCACTGGCATCCCCGACAGATTCGGGGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGACTGGAGCCTGACGACTTTGTAATATATTTTTGTCAACATTATGGTGTCCCACCG

TIG 2[bases=602]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=1)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=38)
451-500 ==> 0-49 on |56|IGHJ5|J-REGION| [len=49] (mis=6)
500-602 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 4 umis using 69 reads
cdr3 = CARSPDCTSINCNWGGYFDPW at 406, score = 8 + 6
umis assigned: [266, 306, 468, 503, 544]
of which 4 are surviving nonsolos
reads assigned: 969
start codons at 64, 151, 172, 262, 284, 299, 328, 367, 518, 579
confident = true
now this is a cell
paired!

TATTTCTGTGCGAGATCGCCCGATTGTACCTCAATTAATTGCAATTGGGGGGGGTACTTCGACCCCTGGGGCCAGGGAACCCTGATCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGACGACTTTGTAATATATTTTTGTCAACATTATGGTGTCCCACCGCTCACCTTCGGCGGGGGGACCAAGCTAGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.65 = CGATCGGGTGGAAAGA-1

using 150 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[144]
surviving nonsolo ucounts = 1[144]
ids = [6]

====================================================================================

UMI info for barcode CGATCGGGTGGAAAGA-1 contig 1 = AGTGCTTTCT...
umi TGGACGACGT = 141 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=482]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
420-468 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
junction support: 1 umis using 16 reads
cdr3 = CARGSGILVIAIEDYYFDHW at 377, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 139
start codons at 17, 38, 82, 168, 255
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.69 = CGATCGGGTTAAGTAG-1

using 590 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 3, 14, 565]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.75 = CGATCGGTCAATACCG-1

using 229 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[228]
surviving nonsolo ucounts = 1[228]
ids = [1]

====================================================================================

UMI info for barcode CGATCGGTCAATACCG-1 contig 1 = GTCCAAACAG...
umi TCAATTCAGC = 231 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=640]
41-393 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=22)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
429-640 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CSSWDSSLSAWVF at 362, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 41, 180, 252, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.76 = CGATCGGTCAATCTCT-1

using 299 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 4, 288]
surviving nonsolo ucounts = 1[288]
ids = [1]

====================================================================================

UMI info for barcode CGATCGGTCAATCTCT-1 contig 1 = GGGGAGGAGT...
umi CAGAAACCTC = 269 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=502]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=3)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-502 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYNNLLLTF at 358, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 31, 37, 93, 106, 245, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.90 = CGATCGGTCCACGACG-1

using 531 reads

====================================================================================

graph has 231 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[12, 518]
surviving nonsolo ucounts = 1[518]
ids = [0]

====================================================================================

UMI info for barcode CGATCGGTCCACGACG-1 contig 1 = CTGGGCCTCA...
umi CTATATCGTG = 498 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=580]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-371 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=11)
378-416 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
416-580 ==> 0-164 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 89 reads
cdr3 = CQAWDSTTDWVF at 352, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 488
start codons at 37, 42, 98, 185, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.93 = CGATCGGTCCGAAGAG-1

using 184 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 180]
surviving nonsolo ucounts = 1[180]
ids = [1]

====================================================================================

UMI info for barcode CGATCGGTCCGAAGAG-1 contig 1 = GGGGTCTCAG...
umi CCTCCAATCC = 171 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=521]
0-38 ==> 3-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
38-358 ==> 0-320 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=20)
385-423 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=7)
423-521 ==> 0-98 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CSSDGGPTRIF at 362, score = 7 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 169
start codons at 38, 195, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.95 = CGATCGGTCCGCAGTG-1

using 403 reads

====================================================================================

graph has 164 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 36, 80, 282]
surviving nonsolo ucounts = 2[80, 282]
ids = [6, 1]

====================================================================================

UMI info for barcode CGATCGGTCCGCAGTG-1 contig 1 = GAGTCAGTCC...
umi AATAACATAA = 264 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=473]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
413-473 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CHQYESVPYTF at 352, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 25, 31, 87, 100, 239, 335, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.96 = CGATCGGTCCGGGTGT-1

using 459 reads

====================================================================================

graph has 144 edges initially, 36 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[198, 260]
surviving nonsolo ucounts = 2[198, 260]
ids = [0, 1]

====================================================================================

UMI info for barcode CGATCGGTCCGGGTGT-1 contig 1 = AGTCTCAGTC...
umi GGTTAGCCGT = 188 reads: +388 validated

UMI info for barcode CGATCGGTCCGGGTGT-1 contig 2 = GCAGGAGTCA...
umi TAGACCCTAT = 238 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=493]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
408-493 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQSYSTPRTF at 347, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 20, 26, 82, 95, 231, 450
confident = false

TIG 2[bases=502]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=17)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
417-502 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CLQDYNFPFTF at 356, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 29, 35, 91, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.104 = CGATCGGTCGGTGTCG-1

using 228 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 223]
surviving nonsolo ucounts = 1[223]
ids = [3]

====================================================================================

UMI info for barcode CGATCGGTCGGTGTCG-1 contig 1 = TGGGGAGTCA...
umi GTCCGCCAGG = 222 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
29-382 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=10)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQSYTTLLTF at 356, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 29, 35, 91, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.105 = CGATCGGTCGGTTAAC-1

using 302 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 297]
surviving nonsolo ucounts = 1[297]
ids = [2]

====================================================================================

UMI info for barcode CGATCGGTCGGTTAAC-1 contig 1 = AGTCAGTCTC...
umi TGATATCTCT = 273 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=504]
0-24 ==> 23-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
24-375 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
374-412 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
412-504 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQSYRRPITF at 351, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 24, 30, 86, 99, 235, 334, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.106 = CGATCGGTCTAACTGG-1

using 1136 reads

====================================================================================

graph has 418 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 3, 4, 147, 978]
surviving nonsolo ucounts = 2[147, 978]
ids = [2, 5]

====================================================================================

UMI info for barcode CGATCGGTCTAACTGG-1 contig 1 = GCCCCAGCCC...
umi AGTTAATGAG = 137 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=504]
0-65 ==> 171-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=0)
65-418 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=2)
421-441 ==> 0-20 on |22|IGHD3-9|D-REGION| [len=27] (mis=0)
441-477 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=0)
477-504 ==> 0-27 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARGTYYDILTAW at 407, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 132
start codons at 65, 221, 282, 368, 495
confident = false

REJECT CONTIGS

TIG 1[bases=307]
4-61 ==> 299-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=5)
58-96 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
96-307 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=1)
cdr3 = CYDNSLTGWGF at 35, score = 3 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 958
start codons at 12, 39, 175
confident = false
not full
VJ delta = 16
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 35.108 = CGATCGGTCTCTGCTG-1

using 317 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 308]
surviving nonsolo ucounts = 1[308]
ids = [1]

====================================================================================

UMI info for barcode CGATCGGTCTCTGCTG-1 contig 1 = GGGGTCTCAG...
umi ACATAACCTG = 304 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=553]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-364 ==> 0-326 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
429-553 ==> 0-124 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CCSYAGGNIFHVF at 362, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 298
start codons at 38, 195, 246, 255, 345, 393
confident = false
NOT paired!
sorting bam, mem = 0.04
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk035-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk035-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

5.173 seconds used processing barcodes, peak mem = 0.23
