[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.27 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk033-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk033-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk033.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.0 = CCTAGCTAGACTAGAT-1

using 258 reads

====================================================================================

graph has 170 edges initially, 4 edges after simplification

total ucounts = 17
nonsolo ucounts = 9[2^3, 3^2, 6, 7, 80, 145]
surviving nonsolo ucounts = 2[80, 145]
ids = [7, 9]

====================================================================================

UMI info for barcode CCTAGCTAGACTAGAT-1 contig 1 = GTGGGCTCAG...
umi CTATAGCGTA = 139 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=513]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=16)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
420-513 ==> 0-93 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CYSTDNSGRHSGMF at 350, score = 6 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 136
start codons at 35, 96, 183, 230, 234, 333, 386
confident = false

REJECT CONTIGS

TIG 1[bases=471]
0-225 ==> 0-225 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=7)
258-404 ==> 225-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=10)
441-471 ==> 12-42 on |54|IGHJ4|J-REGION| [len=46] (mis=2)
cdr3 = CARVFAEDVSGGYFPYW at 393, score = 8 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 69
start codons at 0, 21, 65, 151, 363, 415
confident = false
VJ delta = -27
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.4 = CCTAGCTAGCCACCTG-1

using 276 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 6, 265]
surviving nonsolo ucounts = 1[265]
ids = [4]

====================================================================================

UMI info for barcode CCTAGCTAGCCACCTG-1 contig 1 = AGGAGTCAGA...
umi TAGTCTGTCA = 249 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=479]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
415-479 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYNGQSRAF at 354, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 27, 33, 102, 238, 241, 334, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.5 = CCTAGCTAGCCGGTAA-1

using 322 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 9[3^4, 4, 6, 7, 15, 275]
surviving nonsolo ucounts = 1[275]
ids = [8]

====================================================================================

UMI info for barcode CCTAGCTAGCCGGTAA-1 contig 1 = AGCTGTGGGC...
umi TCTTAGCTCT = 269 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=521]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=2)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
425-521 ==> 0-96 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CNSRDSSGNYLRIF at 355, score = 8 + 9
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 40, 159, 188, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.6 = CCTAGCTAGCGCCTTG-1

using 222 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3^2, 210]
surviving nonsolo ucounts = 1[210]
ids = [8]

====================================================================================

UMI info for barcode CCTAGCTAGCGCCTTG-1 contig 1 = GGGTGACTCC...
umi TGTATCCCTA = 180 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=512]
21-371 ==> 0-350 on |94|IGHV2-26|L-REGION+V-REGION| [len=357] (mis=24)
388-439 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
439-512 ==> 0-73 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CASAAAPGDWFDPW at 366, score = 7 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 21, 177, 244, 336, 493
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.12 = CCTAGCTAGGAGTAGA-1

using 267 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 262]
surviving nonsolo ucounts = 1[262]
ids = [3]

====================================================================================

UMI info for barcode CCTAGCTAGGAGTAGA-1 contig 1 = ATCCAACAAC...
umi GGGCGAAGGG = 251 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=565]
0-55 ==> 249-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
55-408 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
437-485 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
485-565 ==> 0-80 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 397, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 55, 211, 253, 319, 352, 442, 539
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.15 = CCTAGCTAGGGATGGG-1

using 246 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 5, 231]
surviving nonsolo ucounts = 1[231]
ids = [0]

====================================================================================

UMI info for barcode CCTAGCTAGGGATGGG-1 contig 1 = ATCCAACAAC...
umi AAACCTTCTC = 227 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=589]
0-55 ==> 249-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
55-408 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
437-485 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
485-589 ==> 0-104 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 397, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 55, 211, 253, 319, 352, 442, 539
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.16 = CCTAGCTAGGGCTTCC-1

using 162 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 3, 4, 147]
surviving nonsolo ucounts = 1[147]
ids = [4]

====================================================================================

UMI info for barcode CCTAGCTAGGGCTTCC-1 contig 1 = TCAGTCCCAC...
umi GACAAGGTGA = 133 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=487]
0-22 ==> 5-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
22-373 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
372-410 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
410-487 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CLQYSSSPWTF at 349, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 129
start codons at 22, 28, 97, 233, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.40 = CCTAGCTCAATGAAAC-1

using 217 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 5, 204]
surviving nonsolo ucounts = 1[204]
ids = [1]

====================================================================================

UMI info for barcode CCTAGCTCAATGAAAC-1 contig 1 = GCTCTGCTTC...
umi ACGAAAAATT = 191 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=496]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
423-442 ==> 19-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
442-496 ==> 0-54 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 27 reads
cdr3 = CQSYDSSLSGYVF at 375, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 189
start codons at 51, 205, 259, 358, 385, 406
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.45 = CCTAGCTCACACTGCG-1

using 14639 reads

====================================================================================

graph has 6728 edges initially, 70 edges after simplification

total ucounts = 1159
nonsolo ucounts = 503[2^178, 3^108, 4^59, 5^44, 6^29, 7^19, 8^13, 9^7, 10^4, 11^2, 12^2, 13^2, 14, 16, 30, 75, 92, 93, 159, 176, 204, 210, 213, 237^2, 238, 239, 244, 269, 273, 278, 296, 307, 376, 411, 472, 473, 477, 479, 492, 505, 556^2, 604, 619, 626, 801, 913]
surviving nonsolo ucounts = 33[30, 75, 92, 93, 159, 176, 204, 210, 213, 237, 238, 239, 244, 269, 273, 278, 296, 307, 376, 411, 472, 473, 477, 479, 492, 505, 556^2, 604, 619, 626, 801, 913]
ids = [953, 883, 472, 774, 822, 209, 389, 153, 1097, 15, ...]

====================================================================================

UMI info for barcode CCTAGCTCACACTGCG-1 contig 1 = GGGGTCACAA...
umi ACCACCTCTT = 306 reads: +388 validated
umi ATAACGTCCA = 179 reads: +388 validated
umi CCGAATGAAT = 275 reads: +388 validated
umi CCTTAGGTAC = 240 reads: +388 validated
umi CGCGTCTACG = 2 reads: -346X +1 -3X +1 -3X +1 -2X +2 -1X +2 -2X +1 -1 +3 -1X +5 -1XX +1 -1XX +1 -2XX +7 invalidated
umi CTCAAGGGCT = 266 reads: +388 validated
umi GGTCGTGATG = 240 reads: +388 validated
umi GTTGAGATAT = 275 reads: +388 validated
umi TAAGATAAAG = 99 reads: +20 -3X +2 -6XX +2 -1XX +1 -1XX +1 -6XX +273 -35 +8 -1 +2 -2X +3 -2X +2 -1 +14 -1 +1 invalidated
umi TCCACTCCAT = 511 reads: -126X +262 invalidated
umi TCGTCACTTC = 30 reads: -2 +386 non-validated
umi TGAGATCCGT = 241 reads: +388 validated
umi TTCTATCACT = 214 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=637]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=13)
388-426 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
426-637 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 11 umis using 513 reads
cdr3 = CCSYTGSSTYVF at 362, score = 8 + 7
umis assigned: [100, 209, 385, 420, 447, 507, 722, 800, 822, 918] and 3 others
of which 12 are surviving nonsolos
reads assigned: 2831
start codons at 38, 177, 246, 390, 417, 558
confident = true

REJECT CONTIGS

TIG 1[bases=638]
0-240 ==> 5760-6000 on rc of segment after IGKV1-37 exon 1 [len=6000] (mis=0)
0-240 ==> 5760-6000 on segment before IGKV1D-37 exon 1 [len=6000] (mis=0)
240-292 ==> 0-52 on |229|IGKV1-37|L-REGION+V-REGION| [len=351] (mis=0)
243-419 ==> 0-176 on segment before IGKV1D-37 exon 2 [len=176] (mis=4)
406-429 ==> 111-134 on rc of segment before IGKV1-32 exon 1 [len=134] (mis=2)
416-503 ==> 52-139 on |229|IGKV1-37|L-REGION+V-REGION| [len=351] (mis=2) [SHIFT!]
502-638 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [153, 309, 354, 364, 386, 472, 535, 583, 621, 818] and 5 others
of which 15 are surviving nonsolos
reads assigned: 7608
start codons at 26, 99, 151, 240, 246, 375, 378, 387, 391, 426, 544
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.53 = CCTAGCTCACCGTTGG-1

using 359 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[359]
surviving nonsolo ucounts = 1[359]
ids = [0]

====================================================================================

UMI info for barcode CCTAGCTCACCGTTGG-1 contig 1 = GAAGAGCTGC...
umi CAGGAAGGGT = 353 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=5)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYGSSPCSF at 357, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 349
start codons at 33, 343, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.64 = CCTAGCTCAGCCTGTG-1

using 360 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[357]
surviving nonsolo ucounts = 1[357]
ids = [2]

====================================================================================

UMI info for barcode CCTAGCTCAGCCTGTG-1 contig 1 = GGAGGAACTG...
umi GTTCGAAGGA = 338 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=21)
383-422 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
422-490 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CQQRYNWPREYTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 332
start codons at 34, 239, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.74 = CCTAGCTCATACTCTT-1

using 584 reads

====================================================================================

graph has 224 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 3, 186, 387]
surviving nonsolo ucounts = 2[186, 387]
ids = [1, 3]

====================================================================================

UMI info for barcode CCTAGCTCATACTCTT-1 contig 1 = CTCAGCTTCA...
umi ACATTCTCAC = 182 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=479]
0-50 ==> 64-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
50-403 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
400-438 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
438-479 ==> 0-41 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CASWDDSLRGRVF at 371, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 50, 204, 354, 379, 384
confident = false

REJECT CONTIGS

TIG 1[bases=456]
0-63 ==> 0-63 on |297|IGKV5-2|5'UTR| [len=63] (mis=0)
63-321 ==> 0-258 on |298|IGKV5-2|L-REGION+V-REGION| [len=345] (mis=0)
320-456 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 384
start codons at 63, 153, 211, 214, 219, 362
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.75 = CCTAGCTCATATACCG-1

using 13823 reads

====================================================================================

graph has 5732 edges initially, 108 edges after simplification

total ucounts = 781
nonsolo ucounts = 402[2^113, 3^85, 4^56, 5^27, 6^27, 7^21, 8^12, 9^10, 10^3, 11, 12^2, 15, 17, 18, 22, 29, 44, 55, 70, 105, 111, 119, 155, 173, 219, 226, 230, 252, 253, 259, 264^2, 265, 274^2, 275, 276, 282, 294, 304, 306, 314, 321, 322, 327, 337, 345, 379, 385, 389, 399, 458, 491, 551, 558, 1018]
surviving nonsolo ucounts = 41[22, 29, 44, 55, 70, 105, 111, 155, 173, 219, 226, 230, 252, 253, 259, 264^2, 265, 274^2, 275, 276, 282, 294, 304, 306, 314, 321, 322, 327, 337, 345, 379, 385, 389, 399, 458, 491, 551, 558, 1018]
ids = [715, 188, 734, 624, 185, 20, 550, 173, 379, 496, ...]

====================================================================================

UMI info for barcode CCTAGCTCATATACCG-1 contig 1 = ATACTTTCTG...
umi AGCTTCCGCC = 461 reads: +427 validated
umi CACGCATCGA = 29 reads: -40 +387 non-validated
umi CTATCTCTTG = 225 reads: +427 validated
umi GACGTGATCA = 323 reads: +427 validated
umi GACTAATGCC = 232 reads: +427 validated
umi GCGACATCCG = 275 reads: +427 validated
umi TCACATTCTA = 271 reads: +427 validated
umi TCCCCGGTGA = 54 reads: +376 -51 non-validated
umi TCCGTCCGGT = 261 reads: +427 validated
umi TTCCTATCAC = 35 reads: -398 +2 -9X +2 -2X +1 -2X +2 -2X +7 invalidated

UMI info for barcode CCTAGCTCATATACCG-1 contig 2 = AGGAGTCAGA...
umi AATTCTTAGC = 103 reads: +388 validated
umi ACGTACTAAT = 230 reads: +388 validated
umi AGGCCCTTCG = 314 reads: +388 validated
umi ATCCCTTCAT = 264 reads: +388 validated
umi ATTTAGTTAG = 255 reads: +388 validated
umi CAAGATCTCT = 331 reads: +388 validated
umi CAAGCTCTCG = 307 reads: +388 validated
umi CATCGACTAC = 317 reads: +388 validated
umi CATCTCAGCC = 270 reads: +388 validated
umi CCACTCCTAG = 339 reads: +388 validated
umi CCTGTAGGCA = 279 reads: +388 validated
umi GCCCTTGTGT = 273 reads: +388 validated
umi GTACTACGAC = 219 reads: +388 validated
umi GTGTCCACTC = 382 reads: +388 validated
umi TAATACTGGG = 111 reads: +388 validated
umi TCCATCCTTC = 339 reads: +388 validated
umi TGGATTGTCT = 265 reads: +388 validated
umi TTCTCTCTGT = 277 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=535]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
37-387 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=3)
392-415 ==> 0-23 on |28|IGHD5-12|D-REGION| [len=23] (mis=3)
416-464 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
464-535 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 185 reads
cdr3 = CAREGRGYSGYDPPSFDYW at 376, score = 9 + 7
umis assigned: [96, 188, 349, 416, 417, 456, 601, 624, 630, 734]
of which 10 are surviving nonsolos
reads assigned: 2144
start codons at 37, 81
confident = true

TIG 2[bases=551]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=4)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 18 umis using 708 reads
cdr3 = CQQASSFPITF at 354, score = 9 + 8
umis assigned: [20, 60, 100, 135, 159, 169, 171, 217, 218, 237] and 8 others
of which 18 are surviving nonsolos
reads assigned: 4808
start codons at 27, 33, 89, 102, 238, 457
confident = true

REJECT CONTIGS

TIG 1[bases=562]
0-77 ==> 5533-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=1)
395-426 ==> 7-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWGLLLHARYTLASGF at 350, score = 3 + 7
umis assigned: [173, 381, 704]
of which 3 are surviving nonsolos
reads assigned: 984
start codons at 30, 63, 91, 99, 187, 349, 369, 468
confident = false
not full
frameshifted full length transcript of length 562
VJ delta = 30
not full

TIG 2[bases=500]
1-250 ==> 1854-2103 on segment after IGLV3-12 exon 2 [len=6000] (mis=9)
251-289 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
289-500 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [58, 204, 225, 229]
of which 4 are surviving nonsolos
reads assigned: 2156
start codons at 97, 137, 175, 203
confident = false
did not find CDR3

TIG 3[bases=633]
0-38 ==> 5-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
10-85 ==> 11269-11344 on segment before IGLV3-6 exon 1 [len=11502] (mis=3)
38-375 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=6)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
422-633 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [53, 379, 678]
of which 3 are surviving nonsolos
reads assigned: 972
start codons at 38, 99, 168, 186
confident = false
did not find CDR3
now this is a cell
paired!

GCCGTGTATTACTGTGCGAGAGAAGGCCGTGGATATAGTGGCTACGATCCACCGTCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTACTATTGTCAACAGGCTAGCAGTTTCCCGATCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.76 = CCTAGCTCATCCGCGA-1

using 275 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 5, 262]
surviving nonsolo ucounts = 1[262]
ids = [0]

====================================================================================

UMI info for barcode CCTAGCTCATCCGCGA-1 contig 1 = AGTCTGGGCC...
umi AAACTATCCA = 253 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=585]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-374 ==> 0-334 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=21)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
422-585 ==> 0-163 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQVWDSTTDHVVF at 355, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 40, 101, 242, 338, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.77 = CCTAGCTCATCCTTGC-1

using 185 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2^2, 176]
surviving nonsolo ucounts = 1[176]
ids = [7]

====================================================================================

REJECT CONTIGS

TIG 1[bases=533]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
0-54 ==> 11310-11364 on rc of segment before IGHV3-19 exon 1 [len=11364] (mis=1)
40-72 ==> 10108-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
54-204 ==> 0-150 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=5)
205-408 ==> 150-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=17) [SHIFT!]
457-491 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
491-533 ==> 0-42 on |1|IGHA1|C-REGION| [len=1058] (mis=1)
cdr3 = CARDKHFRDPYYHYSGALDHW at 397, score = 7 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 171
start codons at 54, 253, 258, 275, 319, 352
confident = false
frameshifted full length stopped transcript of length 533
VJ delta = 5
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.81 = CCTAGCTCATGGGACA-1

using 224 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[224]
surviving nonsolo ucounts = 1[224]
ids = [0]

====================================================================================

UMI info for barcode CCTAGCTCATGGGACA-1 contig 1 = GCTGTGCTGT...
umi GAATCCTTTA = 220 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=547]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=1)
387-425 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
425-547 ==> 0-122 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQSADSSGTYWVF at 358, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 43, 104, 173, 191
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.84 = CCTAGCTCATGTTCCC-1

using 37 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[37]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.97 = CCTAGCTGTAGGGACT-1

using 250 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[247]
surviving nonsolo ucounts = 1[247]
ids = [0]

====================================================================================

UMI info for barcode CCTAGCTGTAGGGACT-1 contig 1 = GAGGAACTGC...
umi AACATGCTGA = 239 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=491]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-491 ==> 0-76 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQRSNWPYTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 33, 238, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.104 = CCTAGCTGTCCGCTGA-1

using 117 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 7, 102]
surviving nonsolo ucounts = 2[7, 102]
ids = [2, 3]

====================================================================================

UMI info for barcode CCTAGCTGTCCGCTGA-1 contig 1 = GGAGGAATCA...
umi CGGGATTGCT = 7 reads: -145 +1 -1 +18 -1 +10 -1 +102 -53 +56 non-validated
umi GTCACTTTGT = 81 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=512]
29-380 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-512 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CLQYSSSPWTF at 356, score = 9 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 87
start codons at 29, 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.120 = CCTAGCTGTGGTACAG-1

using 337 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[330]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=515]
4-335 ==> 2319-2650 on rc of segment before IGHD1-14 exon 1 [len=2650] (mis=0)
362-413 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=1)
413-515 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [4]
of which 0 are surviving nonsolos
reads assigned: 327
start codons at 111, 236, 431, 492
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.124 = CCTAGCTGTGTGGCTC-1

using 685 reads

====================================================================================

graph has 278 edges initially, 6 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[278, 399]
surviving nonsolo ucounts = 2[278, 399]
ids = [4, 6]

====================================================================================

UMI info for barcode CCTAGCTGTGTGGCTC-1 contig 1 = GATCAGGACT...
umi CTTGCACCCT = 287 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=560]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=3)
386-424 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CMQALQTRGF at 366, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 30, 63, 99, 187, 349, 369, 466
confident = false

REJECT CONTIGS

TIG 1[bases=494]
3-78 ==> 5665-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
27-80 ==> 0-53 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
80-321 ==> 110-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=11)
319-358 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
358-494 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYNGYPSTF at 297, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 397
start codons at 27, 33, 277, 310, 400
confident = false
not full
full length transcript of length 494
VJ delta = 72
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.132 = CCTAGCTGTTCGGGCT-1

using 35 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^2, 3, 4, 8, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.146 = CCTAGCTTCACTATTC-1

using 1428 reads

====================================================================================

graph has 2198 edges initially, 14 edges after simplification

total ucounts = 569
nonsolo ucounts = 315[2^118, 3^73, 4^41, 5^27, 6^19, 7^18, 8^11, 9^3, 10, 11^2, 12, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.169 = CCTAGCTTCCTTGACC-1

using 187 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[187]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.181 = CCTAGCTTCTCAAACG-1

using 25 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 3, 4^2, 6]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.186 = CCTAGCTTCTCGATGA-1

using 189 reads

====================================================================================

graph has 206 edges initially, 4 edges after simplification

total ucounts = 37
nonsolo ucounts = 29[2^3, 3^5, 4^3, 5^2, 6^5, 7^2, 8^3, 9, 11^2, 12, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.189 = CCTAGCTTCTGAGTGT-1

using 1630 reads

====================================================================================

graph has 2084 edges initially, 32 edges after simplification

total ucounts = 673
nonsolo ucounts = 328[2^115, 3^80, 4^43, 5^33, 6^16, 7^17, 8^10, 9^3, 10^4, 11^2, 12^2, 13, 14, 43]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.196 = CCTAGCTTCTTGTATC-1

using 285 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[285]
surviving nonsolo ucounts = 1[285]
ids = [0]

====================================================================================

UMI info for barcode CCTAGCTTCTTGTATC-1 contig 1 = GAGAAGAGCT...
umi GCTCTACAGT = 286 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=562]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=10)
389-426 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYGSPPSPLTF at 359, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 35, 243, 369, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.197 = CCTATTAAGAAACGAG-1

using 394 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[3^2, 7, 8, 372]
surviving nonsolo ucounts = 1[372]
ids = [4]

====================================================================================

UMI info for barcode CCTATTAAGAAACGAG-1 contig 1 = GGAGAAGAGC...
umi GTTAGCGGGT = 372 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=560]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYGSSPLYTF at 360, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 366
start codons at 36, 244, 370, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.201 = CCTATTAAGACTCGGA-1

using 897 reads

====================================================================================

graph has 1290 edges initially, 10 edges after simplification

total ucounts = 270
nonsolo ucounts = 165[2^50, 3^22, 4^22, 5^20, 6^17, 7^9, 8^3, 9^9, 10^3, 11^2, 13^2, 14^3, 16^3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.203 = CCTATTAAGATCTGCT-1

using 339 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 3, 333]
surviving nonsolo ucounts = 1[333]
ids = [2]

====================================================================================

UMI info for barcode CCTATTAAGATCTGCT-1 contig 1 = TGATCAGGAC...
umi GCATTCTGCT = 323 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=514]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-357 ==> 0-326 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=11)
390-428 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
428-514 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CMNTLPGGFTF at 367, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 314
start codons at 31, 64, 100, 188, 350, 370, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.205 = CCTATTAAGCCTTGAT-1

using 445 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 438]
surviving nonsolo ucounts = 1[438]
ids = [2]

====================================================================================

UMI info for barcode CCTATTAAGCCTTGAT-1 contig 1 = GAGTCAGACT...
umi CATAAAGTTC = 438 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CQQYDSFSWTF at 352, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 433
start codons at 25, 31, 87, 100, 236, 239, 332, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.207 = CCTATTAAGCGATCCC-1

using 249 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[5, 242]
surviving nonsolo ucounts = 1[242]
ids = [2]

====================================================================================

UMI info for barcode CCTATTAAGCGATCCC-1 contig 1 = TGGGAGGAAT...
umi GAACAGCCGG = 234 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=469]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-469 ==> 0-50 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.208 = CCTATTAAGCGGATCA-1

using 311 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 3, 302]
surviving nonsolo ucounts = 1[302]
ids = [5]

====================================================================================

UMI info for barcode CCTATTAAGCGGATCA-1 contig 1 = GGGAGGAACT...
umi TTGAGCCTGT = 282 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=500]
0-35 ==> 62-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
35-380 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=15)
384-423 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
423-500 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYNLWPPMCSF at 356, score = 9 + 6
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 35, 104, 177, 240, 383, 416, 465
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.223 = CCTATTAAGGCTAGGT-1

using 1806 reads

====================================================================================

graph has 2238 edges initially, 12 edges after simplification

total ucounts = 603
nonsolo ucounts = 302[2^115, 3^57, 4^39, 5^36, 6^12, 7^10, 8^4, 9^11, 10^6, 11^3, 12^5, 13, 14, 15, 300]
surviving nonsolo ucounts = 1[300]
ids = [552]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.230 = CCTATTAAGTCCTCCT-1

using 717 reads

====================================================================================

graph has 286 edges initially, 24 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[4, 276, 432]
surviving nonsolo ucounts = 2[276, 432]
ids = [0, 4]

====================================================================================

UMI info for barcode CCTATTAAGTCCTCCT-1 contig 1 = GAGTCAGTCT...
umi CTGATTCGGT = 276 reads: +388 validated

UMI info for barcode CCTATTAAGTCCTCCT-1 contig 2 = GGAGGAGTCA...
umi GCTTAATTTC = 434 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQSYSTPWTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 25, 31, 87, 100, 236, 455
confident = false

TIG 2[bases=482]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=1)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
junction support: 1 umis using 65 reads
cdr3 = CLQDYTYPFSF at 356, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 428
start codons at 29, 35, 91, 104, 186, 189
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.238 = CCTATTACAAACAACA-1

using 713 reads

====================================================================================

graph has 254 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[4, 5, 327, 371]
surviving nonsolo ucounts = 2[327, 371]
ids = [8, 2]

====================================================================================

UMI info for barcode CCTATTACAAACAACA-1 contig 1 = GAGGAATCAG...
umi TTGCGGCGGT = 314 reads: +388 validated

UMI info for barcode CCTATTACAAACAACA-1 contig 2 = AGCTCTGGGA...
umi CTTTTTGTAA = 318 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=505]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-505 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 28, 34, 103, 239, 458
confident = false

TIG 2[bases=521]
0-80 ==> 40-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=0)
80-433 ==> 0-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=11)
446-492 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
492-521 ==> 0-29 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CVIAAAGRIIDYW at 422, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 80, 236, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.253 = CCTATTACACATGTGT-1

using 441 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[441]
surviving nonsolo ucounts = 1[441]
ids = [0]

====================================================================================

UMI info for barcode CCTATTACACATGTGT-1 contig 1 = TGGGGAGGAA...
umi GTCCAATTCT = 442 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=558]
0-37 ==> 10-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
37-382 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
385-422 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 68 reads
cdr3 = CQQRSNWPRGTF at 358, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 438
start codons at 37, 242, 245, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.262 = CCTATTACAGATCTGT-1

using 195 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[189]
surviving nonsolo ucounts = 1[189]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=476]
0-303 ==> 50-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=1)
300-338 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
338-476 ==> 0-138 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CAAWDDSLNGPEF at 271, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 158
start codons at 254, 279, 284, 296
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.272 = CCTATTACATAAGACA-1

using 259 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 4, 253]
surviving nonsolo ucounts = 2[4, 253]
ids = [0, 2]

====================================================================================

UMI info for barcode CCTATTACATAAGACA-1 contig 1 = GAGGAATCAG...
umi CCCATCCGTT = 4 reads: -103 +94 -110 +81 non-validated
umi TCTATTCGCT = 252 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 252
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.277 = CCTATTACATCGATTG-1

using 200 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 6, 187]
surviving nonsolo ucounts = 1[187]
ids = [4]

====================================================================================

UMI info for barcode CCTATTACATCGATTG-1 contig 1 = CGAGCCCAGC...
umi GTTGTACCTT = 180 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=517]
0-67 ==> 0-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
67-420 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=0)
443-506 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
junction support: 1 umis using 14 reads
cdr3 = CARDSEPEGHLISYYYYGMDVW at 409, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 179
start codons at 67, 218, 223, 281, 284, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.281 = CCTATTACATGCTGGC-1

using 269 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 260]
surviving nonsolo ucounts = 1[260]
ids = [0]

====================================================================================

UMI info for barcode CCTATTACATGCTGGC-1 contig 1 = GGAGGAATCA...
umi AAACGTACCA = 238 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
29-380 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-490 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQYSSSPWTF at 356, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 29, 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.289 = CCTATTAGTAGGCTGA-1

using 249 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3^2, 12, 229]
surviving nonsolo ucounts = 1[229]
ids = [1]

====================================================================================

UMI info for barcode CCTATTAGTAGGCTGA-1 contig 1 = GAGCTACAAC...
umi ATTTAGCATA = 229 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=15)
392-430 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYYTTPVTF at 369, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 30, 172, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.294 = CCTATTAGTCCATGAT-1

using 874 reads

====================================================================================

graph has 312 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 3, 6, 249, 608]
surviving nonsolo ucounts = 2[249, 608]
ids = [6, 3]

====================================================================================

UMI info for barcode CCTATTAGTCCATGAT-1 contig 1 = GGTGGTAGCT...
umi GTAGAGCAAT = 241 reads: +391 validated

UMI info for barcode CCTATTAGTCCATGAT-1 contig 2 = GGGAATCAGT...
umi CCACTCTGCT = 607 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=558]
0-39 ==> 47-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
39-392 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=10)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
430-558 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 40 reads
cdr3 = CQSYDSSNQAVF at 366, score = 6 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 39, 102, 193, 376
confident = false

TIG 2[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 97 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 597
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.302 = CCTATTAGTGCACGAA-1

using 525 reads

====================================================================================

graph has 228 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 518]
surviving nonsolo ucounts = 1[518]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=423]
0-250 ==> 101-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=18)
249-287 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
287-423 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 226, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 513
start codons at 110, 329
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.304 = CCTATTAGTGCTTCTC-1

using 324 reads

====================================================================================

graph has 206 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[2, 3^2, 5^2, 6, 294]
surviving nonsolo ucounts = 1[294]
ids = [0]

====================================================================================

UMI info for barcode CCTATTAGTGCTTCTC-1 contig 1 = CTCACTCTGC...
umi AAACCTGGCA = 290 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=555]
0-109 ==> 127-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=0)
109-462 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=4)
459-490 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=7)
493-539 ==> 17-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARSYDFWSGYLMWGMDVW at 451, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 285
start codons at 109, 265, 326, 412, 487, 496
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.305 = CCTATTAGTGGGTCAA-1

using 510 reads

====================================================================================

graph has 330 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[510]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.307 = CCTATTAGTGGTTTCA-1

using 323 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 9[2^5, 3, 4, 6, 296]
surviving nonsolo ucounts = 1[296]
ids = [9]

====================================================================================

UMI info for barcode CCTATTAGTGGTTTCA-1 contig 1 = AGACCCTGTC...
umi GCATTTACTA = 292 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=544]
0-26 ==> 27-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
26-371 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=2)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYYSYTWTF at 347, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.308 = CCTATTAGTGTCAATC-1

using 198 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 194]
surviving nonsolo ucounts = 1[194]
ids = [1]

====================================================================================

UMI info for barcode CCTATTAGTGTCAATC-1 contig 1 = AGGAATCAGT...
umi ATGGTTCTTG = 193 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.315 = CCTATTAGTTGAGTTC-1

using 5685 reads

====================================================================================

graph has 3245 edges initially, 30 edges after simplification

total ucounts = 855
nonsolo ucounts = 353[2^152, 3^65, 4^51, 5^24, 6^16, 7^15, 8^7, 9^4, 10^2, 11, 12^3, 13, 33, 215, 224, 225, 232, 234, 332, 401, 403, 474, 542, 672]
surviving nonsolo ucounts = 9[225, 232, 234, 332, 401, 403, 474, 542, 672]
ids = [111, 334, 476, 239, 518, 333, 183, 813, 68]

====================================================================================

UMI info for barcode CCTATTAGTTGAGTTC-1 contig 1 = GTCAGACTCA...
umi ACTAGGTCAT = 223 reads: +388 validated
umi ATCACCGGCA = 182 reads: -346 +1 -1XX +1 -5XX +1 -2XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi CAACATCGCT = 332 reads: +388 validated
umi CCCATAATCA = 35 reads: -240 +3 -3XX +8 -1XX +8 -1XX +11 -1XX +23 -1XX +8 -1XX +9 -1XX +10 -1X +2 -16 +1 -2X +1 -1XX +2 -1XX +3 -1XX +3 -3XX +9 -1XX +7 -1XX +4 invalidated
umi CGATCTCATA = 229 reads: +388 validated
umi GCCCCACGGC = 234 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=21)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 4 umis using 164 reads
cdr3 = CQQYYTFSHSF at 350, score = 7 + 7
umis assigned: [111, 183, 239, 293, 334, 476]
of which 5 are surviving nonsolos
reads assigned: 1220
start codons at 23, 29, 85, 98, 181, 234, 237, 330, 453
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.316 = CCTATTAGTTGTACAC-1

using 5051 reads

====================================================================================

graph has 5305 edges initially, 84 edges after simplification

total ucounts = 1388
nonsolo ucounts = 682[2^236, 3^160, 4^93, 5^68, 6^48, 7^20, 8^14, 9^12, 10^6, 11^5, 12, 13^4, 14, 15^2, 16, 23, 32, 42, 51, 144, 154, 183, 236, 262, 302, 362]
surviving nonsolo ucounts = 8[2, 4, 42, 183, 236, 262, 302, 362]
ids = [912, 1070, 807, 843, 645, 525, 35, 1034]

====================================================================================

UMI info for barcode CCTATTAGTTGTACAC-1 contig 1 = AGCATCATCC...
umi GGAATTCGAT = 41 reads: +306 -2 +119 non-validated
umi GGTCCCCCGG = 182 reads: +422 -5 non-validated

UMI info for barcode CCTATTAGTTGTACAC-1 contig 2 = GGAGTCAGTC...
umi AACCCGTATA = 301 reads: +388 validated
umi CCTTTCTATT = 263 reads: +388 validated
umi CTGGAGCGCA = 234 reads: +388 validated
umi TATCGGACCA = 365 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=488]
0-61 ==> 243-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
61-414 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=22)
442-488 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
junction support: 1 umis using 4 reads
cdr3 = CARGNEVLTGYWGACQYW at 403, score = 8 + 7
umis assigned: [807, 843]
of which 2 are surviving nonsolos
reads assigned: 220
start codons at 61, 148, 217, 259, 281, 325
confident = true

TIG 2[bases=550]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-367 ==> 0-341 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=16)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 4 umis using 184 reads
cdr3 = CEQSYRRPYSF at 353, score = 10 + 7
umis assigned: [35, 525, 645, 1034]
of which 4 are surviving nonsolos
reads assigned: 1149
start codons at 26, 32, 101, 233, 255, 456
confident = true
now this is a cell
paired!

ACGGCCGTGTATTACTGTGCGAGAGGCAACGAAGTTTTGACTGGTTATTGGGGGGCCTGTCAGTACTGGGGCCAGGGAACCCAGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTCTGCAACTTACTACTGTGAACAGAGTTATCGCAGGCCGTACAGTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.340 = CCTATTATCGCCATAA-1

using 229 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[3^3, 214]
surviving nonsolo ucounts = 1[214]
ids = [9]

====================================================================================

UMI info for barcode CCTATTATCGCCATAA-1 contig 1 = GTCAGTCTCA...
umi TTCACACATC = 214 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQSYTTLLTF at 350, score = 9 + 9
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.345 = CCTATTATCTCAAACG-1

using 392 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 9[2^5, 3^2, 4, 370]
surviving nonsolo ucounts = 1[370]
ids = [0]

====================================================================================

UMI info for barcode CCTATTATCTCAAACG-1 contig 1 = GGACTGATCA...
umi AAGAGCGGTT = 369 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=568]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
395-432 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CMQALQTPPTF at 371, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 363
start codons at 35, 68, 104, 192, 354, 374, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.350 = CCTATTATCTTACCGC-1

using 124 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 116]
surviving nonsolo ucounts = 1[116]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.368 = CCTCAGTAGCCTTGAT-1

using 246 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[6, 238]
surviving nonsolo ucounts = 1[238]
ids = [1]

====================================================================================

UMI info for barcode CCTCAGTAGCCTTGAT-1 contig 1 = CTCTGGGAGA...
umi CTTATGGCCT = 237 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=522]
0-78 ==> 2-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=0)
78-433 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=13)
429-446 ==> 0-17 on |9|IGHD1-20|D-REGION| [len=17] (mis=1)
471-496 ==> 24-49 on |52|IGHJ3|J-REGION| [len=49] (mis=0)
496-522 ==> 0-26 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARGITGTTGVFTIW at 420, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 78, 223, 234, 295, 381, 477
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.369 = CCTCAGTAGCGAAGGG-1

using 492 reads

====================================================================================

graph has 170 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 224, 261]
surviving nonsolo ucounts = 2[224, 261]
ids = [4, 0]

====================================================================================

UMI info for barcode CCTCAGTAGCGAAGGG-1 contig 1 = AGAAGAGCTG...
umi AATTCTTTGG = 244 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=481]
0-34 ==> 18-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
34-382 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
419-481 ==> 0-62 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYGSSPRTF at 358, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 34, 242, 368, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.370 = CCTCAGTAGCGTTGCC-1

using 321 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 315]
surviving nonsolo ucounts = 1[315]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=368]
0-192 ==> 153-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=5)
194-232 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
232-368 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
cdr3 = CQQYNSWPPITF at 168, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 52, 274
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.385 = CCTCAGTAGTATGACA-1

using 507 reads

====================================================================================

graph has 258 edges initially, 6 edges after simplification

total ucounts = 18
nonsolo ucounts = 7[2, 3^4, 225, 257]
surviving nonsolo ucounts = 2[225, 257]
ids = [3, 15]

====================================================================================

UMI info for barcode CCTCAGTAGTATGACA-1 contig 1 = AGGAGTCAGA...
umi CACCTTAGGC = 231 reads: +388 validated

UMI info for barcode CCTCAGTAGTATGACA-1 contig 2 = TGATCAGGAC...
umi TCTCAGCATC = 257 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false

TIG 2[bases=564]
31-391 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=8)
390-428 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CMQGTHWPWTF at 367, score = 8 + 8
umis assigned: [15]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 31, 64, 92, 100, 188, 350, 370, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.387 = CCTCAGTAGTTAACGA-1

using 364 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 3[2, 3, 350]
surviving nonsolo ucounts = 1[350]
ids = [6]

====================================================================================

UMI info for barcode CCTCAGTAGTTAACGA-1 contig 1 = AGTCTCAGTC...
umi CCTTCCTCGC = 351 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
370-408 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQSYSTPITF at 347, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 344
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.391 = CCTCAGTCAAATTGCC-1

using 67 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 8[2^2, 3, 4, 8, 11, 15, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.393 = CCTCAGTCAAGCCTAT-1

using 298 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 6[2, 3, 4, 6, 12, 263]
surviving nonsolo ucounts = 1[263]
ids = [0]

====================================================================================

UMI info for barcode CCTCAGTCAAGCCTAT-1 contig 1 = GGCTGGGGTC...
umi AAATACACAA = 253 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=592]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-386 ==> 0-344 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=20)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
430-592 ==> 0-162 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CCSHAGSYIWVF at 366, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 42, 178, 181, 199, 253, 349, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.404 = CCTCAGTCACAGATTC-1

using 118 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[113]
surviving nonsolo ucounts = 1[113]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.416 = CCTCAGTCAGCTGCAC-1

using 289 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 3, 283]
surviving nonsolo ucounts = 1[283]
ids = [3]

====================================================================================

UMI info for barcode CCTCAGTCAGCTGCAC-1 contig 1 = GTCAGTCTCA...
umi GGATCCCTGC = 257 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=484]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-484 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQSYTTLLTF at 350, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.423 = CCTCAGTCAGTCGATT-1

using 287 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2^4, 6, 266]
surviving nonsolo ucounts = 1[266]
ids = [11]

====================================================================================

UMI info for barcode CCTCAGTCAGTCGATT-1 contig 1 = AGTCTCAGTC...
umi TCTCTCCGCC = 246 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
370-408 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
408-505 ==> 0-97 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQSYSTPFTF at 347, score = 9 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.429 = CCTCAGTCATCAGTCA-1

using 816 reads

====================================================================================

graph has 260 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 4, 258, 549]
surviving nonsolo ucounts = 2[258, 549]
ids = [0, 2]

====================================================================================

UMI info for barcode CCTCAGTCATCAGTCA-1 contig 1 = AGTCTGGGCC...
umi AAGTCCCCAT = 264 reads: +382 validated
umi CAGCTAACTA = 547 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=633]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-373 ==> 0-333 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=29)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-633 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 139 reads
cdr3 = CQVWDSDGHYVVF at 355, score = 8 + 8
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 796
start codons at 40, 101, 170, 338, 374, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.431 = CCTCAGTCATCGACGC-1

using 290 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 4, 276]
surviving nonsolo ucounts = 1[276]
ids = [3]

====================================================================================

UMI info for barcode CCTCAGTCATCGACGC-1 contig 1 = GACTGATCAG...
umi ATGCTTATCG = 260 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=491]
0-34 ==> 2-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
34-394 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=8)
395-434 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
434-491 ==> 0-57 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CMQALQILGYTF at 370, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 34, 67, 103, 191, 353, 373, 476
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.433 = CCTCAGTCATCTCCCA-1

using 312 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 12, 295]
surviving nonsolo ucounts = 1[295]
ids = [3]

====================================================================================

UMI info for barcode CCTCAGTCATCTCCCA-1 contig 1 = GGAGTCAGAC...
umi CTCCGCCTGT = 276 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=509]
0-32 ==> 21-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
32-377 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
386-414 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
414-509 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYYSYPRTF at 353, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.434 = CCTCAGTCATGAAGTA-1

using 152 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 7[2^2, 3^2, 4^2, 126]
surviving nonsolo ucounts = 1[126]
ids = [5]

====================================================================================

UMI info for barcode CCTCAGTCATGAAGTA-1 contig 1 = GCTACAACAG...
umi CGTCTCCTTC = 118 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=439]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=7)
390-428 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
junction support: 1 umis using 13 reads
cdr3 = CQQYYNAPRTF at 367, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 116
start codons at 28, 97, 350, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.436 = CCTCAGTCATTACCTT-1

using 84 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[6, 75]
surviving nonsolo ucounts = 1[75]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.438 = CCTCAGTCATTGTGCA-1

using 321 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^2, 3, 4, 6, 298]
surviving nonsolo ucounts = 1[298]
ids = [5]

====================================================================================

UMI info for barcode CCTCAGTCATTGTGCA-1 contig 1 = AATCAGTCCC...
umi GGAAACTACT = 272 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=452]
0-24 ==> 3-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
24-375 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-452 ==> 0-40 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CLQYSSSPWTF at 351, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 24, 30, 99, 235
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.440 = CCTCAGTGTAAACACA-1

using 265 reads

====================================================================================

graph has 176 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 259]
surviving nonsolo ucounts = 1[259]
ids = [2]

====================================================================================

UMI info for barcode CCTCAGTGTAAACACA-1 contig 1 = GAGAGAGGAG...
umi CGCCCTGGAA = 260 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=534]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-534 ==> 0-37 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.446 = CCTCAGTGTAGAGTGC-1

using 43 reads

====================================================================================

graph has 34 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 35]
surviving nonsolo ucounts = 1[35]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.455 = CCTCAGTGTCACACGC-1

using 396 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[2^4, 4, 5, 373]
surviving nonsolo ucounts = 2[4, 373]
ids = [11, 3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=507]
0-44 ==> 53-97 on |284|IGKV3-7|5'UTR| [len=97] (mis=0)
0-44 ==> 5956-6000 on rc of segment after IGKV3-7 exon 1 [len=6000] (mis=0)
17-69 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=4)
44-93 ==> 0-49 on |285|IGKV3-7|L-REGION+V-REGION| [len=348] (mis=0)
89-335 ==> 102-348 on |285|IGKV3-7|L-REGION+V-REGION| [len=348] (mis=2)
332-371 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
371-507 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [3, 11]
of which 2 are surviving nonsolos
reads assigned: 372
start codons at 44, 195, 413
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.469 = CCTCAGTGTGCCTGCA-1

using 218 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 6[2^3, 3, 5, 196]
surviving nonsolo ucounts = 1[196]
ids = [4]

====================================================================================

UMI info for barcode CCTCAGTGTGCCTGCA-1 contig 1 = GAGCTCTGGG...
umi CTGCCGGCTT = 199 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=555]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=14)
468-516 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
516-555 ==> 0-39 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARESFAYCSADCHKYYFDYW at 422, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 80, 236, 287, 297, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.471 = CCTCAGTGTGCGATAG-1

using 255 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^2, 5, 6, 7, 227]
surviving nonsolo ucounts = 1[227]
ids = [5]

====================================================================================

UMI info for barcode CCTCAGTGTGCGATAG-1 contig 1 = ATCACATAAC...
umi TCCCACACTA = 221 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=546]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=12)
412-430 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=1)
431-494 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
494-546 ==> 0-52 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARVGYSSSSSYHYYYAMDVW at 400, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 58, 209, 256, 355, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.495 = CCTCAGTTCATACGGT-1

using 16 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.496 = CCTCAGTTCATATCGG-1

using 18 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.501 = CCTCAGTTCCACGAAT-1

using 1082 reads

====================================================================================

graph has 338 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2^3, 4, 6, 22, 1041]
surviving nonsolo ucounts = 2[22, 1041]
ids = [4, 8]

====================================================================================

REJECT CONTIGS

TIG 1[bases=316]
3-70 ==> 286-353 on |319|IGLV1-36|L-REGION+V-REGION| [len=353] (mis=5)
67-105 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
105-316 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CASWDDSLRGRVF at 38, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 1031
start codons at 21, 46, 51
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.502 = CCTCAGTTCCACGTGG-1

using 119 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[5^2, 105]
surviving nonsolo ucounts = 1[105]
ids = [6]

====================================================================================

UMI info for barcode CCTCAGTTCCACGTGG-1 contig 1 = GGACACAGCA...
umi TCCCCACCAG = 95 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=432]
9-360 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
359-397 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
397-432 ==> 0-35 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CQQYDSFSWTF at 336, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 95
start codons at 9, 15, 71, 84, 220, 223, 316, 346
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.507 = CCTCAGTTCCCTTGTG-1

using 763 reads

====================================================================================

graph has 207 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^2, 8^2, 58, 680]
surviving nonsolo ucounts = 2[58, 680]
ids = [5, 3]

====================================================================================

UMI info for barcode CCTCAGTTCCCTTGTG-1 contig 1 = GGGAGGAATC...
umi CCGGATATGG = 679 reads: +388 validated
umi CTTTTCGAAC = 55 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
30-381 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 119 reads
cdr3 = CLQYSSSPWTF at 357, score = 9 + 8
umis assigned: [3, 5]
of which 2 are surviving nonsolos
reads assigned: 729
start codons at 30, 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.508 = CCTCAGTTCCGCGTTT-1

using 265 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 9, 250]
surviving nonsolo ucounts = 1[250]
ids = [4]

====================================================================================

UMI info for barcode CCTCAGTTCCGCGTTT-1 contig 1 = GAGTCAGTCC...
umi TGCTCTCGTA = 237 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=488]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-488 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYDNLSLTF at 352, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 25, 31, 87, 100, 239, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.510 = CCTCAGTTCCGTACAA-1

using 320 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 10, 302]
surviving nonsolo ucounts = 1[302]
ids = [7]

====================================================================================

UMI info for barcode CCTCAGTTCCGTACAA-1 contig 1 = AGAGCTGCTC...
umi TTTATCCCCT = 302 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=552]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYGSSPVTF at 355, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 31, 239, 242, 365, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.512 = CCTCAGTTCCTACAGA-1

using 604 reads

====================================================================================

graph has 218 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 6, 131, 459]
surviving nonsolo ucounts = 2[131, 459]
ids = [3, 6]

====================================================================================

UMI info for barcode CCTCAGTTCCTACAGA-1 contig 1 = GATCAGGACT...
umi CCTTTTCGGT = 134 reads: +397 validated

UMI info for barcode CCTCAGTTCCTACAGA-1 contig 2 = AGTGCTTTCT...
umi GTTACACTTA = 460 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 131
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false

TIG 2[bases=527]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=23)
410-456 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=7)
456-527 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CARGIYRSDTIIIDSW at 377, score = 9 + 6
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 451
start codons at 17, 38, 82, 168, 434
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.519 = CCTCAGTTCGGAGGTA-1

using 282 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 5, 269]
surviving nonsolo ucounts = 1[269]
ids = [0]

====================================================================================

UMI info for barcode CCTCAGTTCGGAGGTA-1 contig 1 = GGAACTGCTC...
umi AATAACCCCG = 274 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=552]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=6)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQYNNWPPITF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 31, 100, 236, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.524 = CCTCAGTTCTCTAAGG-1

using 99 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 22
nonsolo ucounts = 14[2, 3^3, 4^2, 5^2, 7, 9, 10, 11, 12, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.530 = CCTCAGTTCTGTCTCG-1

using 539 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 5, 527]
surviving nonsolo ucounts = 1[527]
ids = [5]

====================================================================================

UMI info for barcode CCTCAGTTCTGTCTCG-1 contig 1 = GGGAGGAGTC...
umi CTAAGAGTAC = 531 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
30-383 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQSYSTPRTF at 357, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 520
start codons at 30, 36, 92, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.542 = CCTCTGAAGAGTGAGA-1

using 282 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 3^2, 5, 264]
surviving nonsolo ucounts = 1[264]
ids = [7]

====================================================================================

UMI info for barcode CCTCTGAAGAGTGAGA-1 contig 1 = GATCAGGACT...
umi TCAATATATA = 263 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.550 = CCTCTGAAGCTAGCCC-1

using 254 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 244]
surviving nonsolo ucounts = 1[244]
ids = [2]

====================================================================================

UMI info for barcode CCTCTGAAGCTAGCCC-1 contig 1 = GGAATCAGTC...
umi CCCTATACCA = 245 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.553 = CCTCTGAAGCTGTTCA-1

using 665 reads

====================================================================================

graph has 267 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[320, 342]
surviving nonsolo ucounts = 2[320, 342]
ids = [2, 3]

====================================================================================

UMI info for barcode CCTCTGAAGCTGTTCA-1 contig 1 = GAGAAGAGCT...
umi GCGCTATGCT = 343 reads: +385 validated

UMI info for barcode CCTCTGAAGCTGTTCA-1 contig 2 = GAGGAATCAG...
umi GAGTTGCTCT = 319 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYGSSPGTF at 359, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 336
start codons at 35, 243, 369, 462
confident = false

TIG 2[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 315
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.555 = CCTCTGAAGGACTGGT-1

using 144 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[144]
surviving nonsolo ucounts = 1[144]
ids = [0]

====================================================================================

UMI info for barcode CCTCTGAAGGACTGGT-1 contig 1 = AGTGCTTTCT...
umi TCATATAGAC = 135 reads: +420 -1 +9 non-validated

GOOD CONTIGS

TIG 1[bases=515]
38-175 ==> 0-137 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=25)
175-301 ==> 140-266 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=30)
422-468 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=12)
468-515 ==> 0-47 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARGPLVRGILGKGYYLDLW at 377, score = 8 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 135
start codons at 38, 82, 347
confident = false
see deletion of 3 bases at pos 137 on |197|IGHV4/OR15-8|L-REGION+V-REGION|
>vscore_33.555_77.1%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGCGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.558 = CCTCTGAAGGATGGAA-1

using 170 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 3, 158]
surviving nonsolo ucounts = 1[158]
ids = [2]

====================================================================================

UMI info for barcode CCTCTGAAGGATGGAA-1 contig 1 = ACCTTCTCAC...
umi CTTGGACTCG = 147 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=441]
11-371 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
373-411 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
411-441 ==> 0-30 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CMQALQTPLFTF at 347, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 147
start codons at 11, 44, 80, 168, 330, 350
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.563 = CCTCTGAAGGGTCTCC-1

using 316 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[5, 308]
surviving nonsolo ucounts = 1[308]
ids = [4]

====================================================================================

UMI info for barcode CCTCTGAAGGGTCTCC-1 contig 1 = GATCAGGACT...
umi TATGTAGGTG = 299 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=524]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-524 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 294
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.566 = CCTCTGAAGGTGACCA-1

using 271 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3^2, 261]
surviving nonsolo ucounts = 2[3, 261]
ids = [1, 2]

====================================================================================

UMI info for barcode CCTCTGAAGGTGACCA-1 contig 1 = AAAAACCACA...
umi CACACTCCAG = 3 reads: -137 +56 -16 +27 -1 +15 -1 +12 -2 +6 -1 +2 -1 +7 -1 +11 -1 +1 -1 +1 -1 +19 -1 +1 -114 non-validated
umi CGTCTTCCCA = 250 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=534]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-534 ==> 0-48 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 248
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.568 = CCTCTGAAGTAGCCGA-1

using 197 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 4, 187]
surviving nonsolo ucounts = 1[187]
ids = [4]

====================================================================================

UMI info for barcode CCTCTGAAGTAGCCGA-1 contig 1 = CTGGGCCTAA...
umi TAACTGCGCT = 186 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=636]
0-37 ==> 214-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
37-367 ==> 0-330 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=26)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
425-636 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQVWDGDIYHPDVSF at 352, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 182
start codons at 37, 98, 335, 360, 365, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.569 = CCTCTGAAGTCATCCA-1

using 41 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 6[2^3, 4, 8, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.574 = CCTCTGAAGTTATCGC-1

using 16 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.580 = CCTCTGACAAGCGAGT-1

using 194 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 4, 184]
surviving nonsolo ucounts = 1[184]
ids = [1]

====================================================================================

UMI info for barcode CCTCTGACAAGCGAGT-1 contig 1 = GCTGCGGGTA...
umi CTAAAATTAC = 176 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=537]
0-40 ==> 0-40 on |318|IGLV1-36|5'UTR| [len=40] (mis=0)
40-393 ==> 0-353 on |319|IGLV1-36|L-REGION+V-REGION| [len=353] (mis=3)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
428-537 ==> 0-109 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CAAWDDSLSGPVF at 361, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 40, 191, 248, 251, 344, 369, 374
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.583 = CCTCTGACAATAGAGT-1

using 251 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 9[3^4, 4, 5, 10, 17, 195]
surviving nonsolo ucounts = 1[195]
ids = [5]

====================================================================================

UMI info for barcode CCTCTGACAATAGAGT-1 contig 1 = TGATCAGGAC...
umi CCCTATTCCT = 190 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=477]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
387-425 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
425-477 ==> 0-52 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CMQALQTPTF at 367, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 31, 64, 100, 188, 350, 370, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.584 = CCTCTGACACAACGCC-1

using 273 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^2, 3, 6, 258]
surviving nonsolo ucounts = 1[258]
ids = [5]

====================================================================================

UMI info for barcode CCTCTGACACAACGCC-1 contig 1 = GTCAGTCCCA...
umi GGCCCACATT = 238 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=458]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=3)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
411-458 ==> 0-47 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYDNLMCSF at 350, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 23, 29, 85, 98, 237, 360, 371, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.585 = CCTCTGACACAACTGT-1

using 336 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^3, 326]
surviving nonsolo ucounts = 1[326]
ids = [7]

====================================================================================

UMI info for barcode CCTCTGACACAACTGT-1 contig 1 = AGGAATCAGT...
umi TCCTTGCGCG = 328 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=557]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=2)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CLHHNSYPATWTF at 354, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 27, 33, 102, 184, 238, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.587 = CCTCTGACACAGATTC-1

using 418 reads

====================================================================================

graph has 194 edges initially, 6 edges after simplification

total ucounts = 16
nonsolo ucounts = 13[2^3, 3, 6, 7^3, 10, 11, 12, 16, 330]
surviving nonsolo ucounts = 1[330]
ids = [11]

====================================================================================

UMI info for barcode CCTCTGACACAGATTC-1 contig 1 = GAAGAGCTGC...
umi ACGTTTTTGT = 5 reads: -15 +31 -1X +5 -1XX +2 -2XX +8 -1XX +3 -1XX +15 -1X +6 -1X +3 -1X +3 -1XX +9 -1XX +1 -1XX +37 -1XX +3 -1XX +2 -8X +1 -3X +1 -215X invalidated
umi TAACTAGCTA = 336 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYGSSPRTF at 357, score = 9 + 8
umis assigned: [3, 11]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.596 = CCTCTGACACCGTTGG-1

using 887 reads

====================================================================================

graph has 246 edges initially, 18 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 71, 211, 288, 311]
surviving nonsolo ucounts = 3[71, 211, 311]
ids = [0, 3, 7]

====================================================================================

UMI info for barcode CCTCTGACACCGTTGG-1 contig 1 = AGAAGAGCTG...
umi ACATGGCCAG = 71 reads: +10 -1 +374 non-validated
umi GTGTTATGGT = 279 reads: +6 -1XX +7 -1XX +59 -1XX +10 -1XX +67 -2XX +2 -8XX +1 -1XX +1 -1X +1 -1XX +2 -1XX +2 -1XX +34 -1XX +8 -1XX +20 -2XX +50 -1XX +2 -1XX +13 -1XX +6 -1XX +11 -8 +1 -1X +1 -2X +1 -2X +2 -3XX +2 -1XX +3 -1XX +3 -3XX +9 -1XX +12 invalidated
umi TTCTTATGTA = 310 reads: +385 validated

UMI info for barcode CCTCTGACACCGTTGG-1 contig 2 = ATACTTTCTG...
umi GTCTCTCTCG = 206 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=555]
0-34 ==> 18-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
34-382 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=5)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 52 reads
cdr3 = CQQYGSSPCSF at 358, score = 9 + 7
umis assigned: [0, 4, 7]
of which 2 are surviving nonsolos
reads assigned: 633
start codons at 34, 344, 368, 461
confident = true

TIG 2[bases=572]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
37-387 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=8)
399-449 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
449-572 ==> 0-123 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 27 reads
cdr3 = CARDNGWVNAFDIW at 376, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 37, 81, 337, 389, 401, 430
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 33.603 = CCTCTGACAGACAAAT-1

using 87 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 3, 78]
surviving nonsolo ucounts = 1[78]
ids = [3]

====================================================================================
NOT paired!
sorting bam, mem = 0.06
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk033-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk033-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

14.942 seconds used processing barcodes, peak mem = 0.23
