[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.28 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk032-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk032-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk032.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.0 = CCTACACGTAACGCGA-1

using 807 reads

====================================================================================

graph has 288 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 128, 323, 350]
surviving nonsolo ucounts = 2[128, 323]
ids = [3, 7]

====================================================================================

UMI info for barcode CCTACACGTAACGCGA-1 contig 1 = GTCAGACTCA...
umi ATGGATACAC = 30 reads: -315 +1 -4XX +10 -3XX +2 -3XX +1 -8XX +1 -1XX +1 -1XX +26 -1XX +10 invalidated
umi CGCTTAAGGC = 130 reads: +388 validated
umi TTATCAAACA = 323 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 82 reads
cdr3 = CQQYDSFSWTF at 350, score = 8 + 8
umis assigned: [2, 3, 7]
of which 2 are surviving nonsolos
reads assigned: 473
start codons at 23, 29, 85, 98, 234, 237, 330, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.4 = CCTACACGTAGCAAAT-1

using 2023 reads

====================================================================================

graph has 2866 edges initially, 24 edges after simplification

total ucounts = 801
nonsolo ucounts = 407[2^157, 3^93, 4^59, 5^34, 6^17, 7^22, 8^10, 9^7, 10^3, 11^2, 12, 15, 151]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=492]
3-225 ==> 124-346 on rc of segment before IGHJ2 exon 1 [len=346] (mis=0)
285-442 ==> 0-157 on rc of segment before IGHJ2P exon 1 [len=157] (mis=1)
441-491 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
umis assigned: [493]
of which 0 are surviving nonsolos
reads assigned: 109
start codons at 3, 12, 192, 369, 443, 472
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.11 = CCTACACGTCCATGAT-1

using 340 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[4, 331]
surviving nonsolo ucounts = 1[331]
ids = [6]

====================================================================================

UMI info for barcode CCTACACGTCCATGAT-1 contig 1 = AGTCTCAGTC...
umi TCGTTAGCAC = 333 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQSYTALLTF at 347, score = 9 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 325
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.15 = CCTACACGTCGAACAG-1

using 270 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[3^4, 253]
surviving nonsolo ucounts = 1[253]
ids = [9]

====================================================================================

UMI info for barcode CCTACACGTCGAACAG-1 contig 1 = AGCTTCAGCT...
umi TTAGCGCTTA = 252 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=576]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=9)
399-437 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
437-576 ==> 0-139 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CAAWDDSLNGFYVF at 367, score = 7 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 46, 200, 350, 375, 380, 392, 401, 569
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.19 = CCTACACGTCTCTTTA-1

using 240 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 235]
surviving nonsolo ucounts = 1[235]
ids = [3]

====================================================================================

UMI info for barcode CCTACACGTCTCTTTA-1 contig 1 = GGAGGAATCA...
umi GCGAGTGCAA = 219 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=476]
29-380 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-476 ==> 0-59 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CLQYSSSPWTF at 356, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 29, 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.29 = CCTACACGTTCGCGAC-1

using 150 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[147]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.34 = CCTACACGTTTGACTG-1

using 249 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 246]
surviving nonsolo ucounts = 1[246]
ids = [0]

====================================================================================

UMI info for barcode CCTACACGTTTGACTG-1 contig 1 = GCTGCGGGTA...
umi ACTCTTTCAC = 246 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-40 ==> 0-40 on |318|IGLV1-36|5'UTR| [len=40] (mis=0)
40-393 ==> 0-353 on |319|IGLV1-36|L-REGION+V-REGION| [len=353] (mis=1)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
428-550 ==> 0-122 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CAAWDDSLNGPVF at 361, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 40, 191, 248, 251, 344, 369, 374, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.38 = CCTACACTCAAGGCTT-1

using 429 reads

====================================================================================

graph has 166 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[3, 5, 193, 220]
surviving nonsolo ucounts = 2[193, 220]
ids = [4, 3]

====================================================================================

UMI info for barcode CCTACACTCAAGGCTT-1 contig 1 = AGGAATCAGT...
umi AGTTCATCTT = 176 reads: +388 validated

UMI info for barcode CCTACACTCAAGGCTT-1 contig 2 = AGCTTCAGCT...
umi AGGGTAATCC = 213 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=428]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 26 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 175
start codons at 27, 33, 102, 238
confident = false

TIG 2[bases=531]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-531 ==> 0-96 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.41 = CCTACACTCACTCTTA-1

using 451 reads

====================================================================================

graph has 166 edges initially, 6 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[2^3, 3, 8, 154, 274]
surviving nonsolo ucounts = 2[154, 274]
ids = [7, 5]

====================================================================================

UMI info for barcode CCTACACTCACTCTTA-1 contig 1 = GTCAGTCTCA...
umi CTGCATCGGT = 256 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=498]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-498 ==> 0-87 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQSYTTLLTF at 350, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.50 = CCTACACTCCAATGGT-1

using 264 reads

====================================================================================

graph has 190 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[264]
surviving nonsolo ucounts = 1[264]
ids = [0]

====================================================================================

UMI info for barcode CCTACACTCCAATGGT-1 contig 1 = GAGAGGAGCC...
umi GATATCCCTC = 284 reads: +2 -1 +1 -3XX +2 -1XX +2 -8XX +1 -2XX +380 invalidated

GOOD CONTIGS

TIG 1[bases=550]
0-71 ==> 8-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
71-424 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=31)
438-474 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=1)
474-550 ==> 0-76 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CAKNSGIYAW at 413, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 71, 137, 227, 374, 435
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.51 = CCTACACTCCAGAAGG-1

using 309 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 9[2, 3^2, 5, 6^2, 7, 12, 258]
surviving nonsolo ucounts = 1[258]
ids = [11]

====================================================================================

UMI info for barcode CCTACACTCCAGAAGG-1 contig 1 = AGCTGTGGGT...
umi GGGTTTACAA = 257 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=524]
0-41 ==> 73-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
41-394 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=18)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
429-524 ==> 0-95 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CAAWDASLIGVVF at 362, score = 8 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 41, 246, 327, 345, 370, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.56 = CCTACACTCCCGGATG-1

using 921 reads

====================================================================================

graph has 292 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 7[2^2, 5^2, 7, 232, 660]
surviving nonsolo ucounts = 2[232, 660]
ids = [7, 6]

====================================================================================

UMI info for barcode CCTACACTCCCGGATG-1 contig 1 = GCTCTGCCTC...
umi ACGTAGCTAC = 3 reads: -209 +2 -2X +2 -1X +2 -1X +1 -2X +2 -1X +9 -1X +1 -1X +5 -1X +22 -129 invalidated
umi CTACAGGCCG = 226 reads: +394 validated

UMI info for barcode CCTACACTCCCGGATG-1 contig 2 = TGGGGAGGCT...
umi CTAACGAACT = 658 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=583]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=9)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
445-583 ==> 0-138 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQSYDTSLSGSNVF at 375, score = 8 + 8
umis assigned: [2, 7]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false

TIG 2[bases=576]
52-403 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=17)
401-440 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
440-576 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 88 reads
cdr3 = CLQDYNFPFTF at 379, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 653
start codons at 52, 58, 114, 482
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.59 = CCTACACTCCGAGCCA-1

using 756 reads

====================================================================================

graph has 322 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[10, 743]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.64 = CCTACACTCCTTTCGG-1

using 278 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[276]
surviving nonsolo ucounts = 1[276]
ids = [1]

====================================================================================

UMI info for barcode CCTACACTCCTTTCGG-1 contig 1 = ACAACAGGCA...
umi CACCGAGGCG = 276 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=561]
0-25 ==> 150-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
25-388 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
387-425 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYYSTPWTF at 364, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 25, 94, 347, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.68 = CCTACACTCGCATGAT-1

using 246 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 244]
surviving nonsolo ucounts = 1[244]
ids = [0]

====================================================================================

UMI info for barcode CCTACACTCGCATGAT-1 contig 1 = GGGGAGGAAC...
umi ATTCTCTAGT = 244 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYNNWPPLTF at 357, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 36, 105, 241, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.69 = CCTACACTCGCCAAAT-1

using 483 reads

====================================================================================

graph has 203 edges initially, 12 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 191, 282]
surviving nonsolo ucounts = 2[191, 282]
ids = [4, 1]

====================================================================================

UMI info for barcode CCTACACTCGCCAAAT-1 contig 1 = AGGAGTCAGT...
umi AAGTTGTGTG = 286 reads: +388 validated

UMI info for barcode CCTACACTCGCCAAAT-1 contig 2 = CTCAGTTCAC...
umi GGGGACGTCC = 191 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQSYRRPITF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 27, 33, 89, 102, 238, 337, 457
confident = false

TIG 2[bases=552]
0-19 ==> 11-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
19-379 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CMQALQTRETF at 355, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 19, 52, 88, 176, 338, 358, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.82 = CCTACACTCTCGCTTG-1

using 649 reads

====================================================================================

graph has 228 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 8[2^3, 3^2, 4^2, 618]
surviving nonsolo ucounts = 1[618]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=548]
0-34 ==> 5703-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
33-363 ==> 0-330 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=25)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYRNSITF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 612
start codons at 33, 454
confident = false
not full
full length stopped transcript of length 548
frameshifted full length stopped transcript of length 548
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.103 = CCTACCAAGCAGCGTA-1

using 1503 reads

====================================================================================

graph has 1089 edges initially, 10 edges after simplification

total ucounts = 273
nonsolo ucounts = 90[2^35, 3^20, 4^10, 5^3, 6^6, 7^2, 8^3, 9^3, 10^2, 12^2, 133, 171, 333, 353]
surviving nonsolo ucounts = 4[133, 171, 333, 353]
ids = [28, 161, 181, 83]

====================================================================================

UMI info for barcode CCTACCAAGCAGCGTA-1 contig 1 = GAGAGATCTG...
umi ACCTCATCAA = 129 reads: +388 validated
umi GGGCAGTCTA = 165 reads: +388 validated

UMI info for barcode CCTACCAAGCAGCGTA-1 contig 2 = AGTCACCAGA...
umi CATGCAATTA = 354 reads: +436 validated
umi GTTGTCGTTG = 328 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=499]
0-67 ==> 47-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
67-420 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
417-455 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
455-499 ==> 0-44 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 33 reads
cdr3 = CAAWDDSLNGWVF at 388, score = 8 + 8
umis assigned: [28, 161]
of which 2 are surviving nonsolos
reads assigned: 289
start codons at 67, 371, 396, 401, 413
confident = true

TIG 2[bases=527]
0-20 ==> 32-52 on |206|IGHV6-1|5'UTR| [len=52] (mis=0)
20-385 ==> 0-365 on |207|IGHV6-1|L-REGION+V-REGION| [len=365] (mis=1)
405-456 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
456-527 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 60 reads
cdr3 = CARELQLEAGEDWFDPW at 374, score = 10 + 7
umis assigned: [83, 181]
of which 2 are surviving nonsolos
reads assigned: 676
start codons at 20, 64, 261, 267
confident = true
now this is a cell
paired!

GACACGGCTGTGTATTACTGTGCAAGGGAGCTACAACTAGAGGCGGGCGAGGACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAATGGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.107 = CCTACCAAGCGTAATA-1

using 291 reads

====================================================================================

graph has 153 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[2, 3, 4, 5, 7, 8, 256]
surviving nonsolo ucounts = 1[256]
ids = [9]

====================================================================================

UMI info for barcode CCTACCAAGCGTAATA-1 contig 1 = GACCCAGTCA...
umi TAACATCCAG = 238 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=486]
0-19 ==> 8-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
19-370 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
375-407 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
407-486 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQYNSYPPTF at 346, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 19, 25, 81, 94, 230, 449
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.113 = CCTACCAAGGATGTAT-1

using 11 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.115 = CCTACCAAGGCCCTCA-1

using 285 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[285]
surviving nonsolo ucounts = 1[285]
ids = [0]

====================================================================================

UMI info for barcode CCTACCAAGGCCCTCA-1 contig 1 = AGAGCTCTGG...
umi ACAACAGCTT = 285 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=559]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
386-423 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYNNWPHF at 365, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 44, 113, 249, 465
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.128 = CCTACCAAGTTACCCA-1

using 71 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 5, 59]
surviving nonsolo ucounts = 1[59]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.132 = CCTACCACAAATACAG-1

using 730 reads

====================================================================================

graph has 254 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2^2, 227, 491]
surviving nonsolo ucounts = 2[227, 491]
ids = [6, 0]

====================================================================================

UMI info for barcode CCTACCACAAATACAG-1 contig 1 = TGGGGAGGAA...
umi ACTAAGGTCG = 488 reads: +388 validated
umi CTACATCCCC = 227 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 125 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [0, 6]
of which 2 are surviving nonsolos
reads assigned: 707
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.133 = CCTACCACAACTGGCC-1

using 1016 reads

====================================================================================

graph has 408 edges initially, 8 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 208, 289, 510]
surviving nonsolo ucounts = 3[208, 289, 510]
ids = [5, 1, 0]

====================================================================================

UMI info for barcode CCTACCACAACTGGCC-1 contig 1 = GGAGTCAGAC...
umi AAGCCACGGC = 512 reads: +385 validated

UMI info for barcode CCTACCACAACTGGCC-1 contig 2 = GATCAGGACT...
umi ATACAGTACC = 289 reads: +400 validated

UMI info for barcode CCTACCACAACTGGCC-1 contig 3 = AGCTCTCAGA...
umi CTGGTATACT = 203 reads: +445 validated

GOOD CONTIGS

TIG 1[bases=547]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=25)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 79 reads
cdr3 = CHQYNSYSTF at 353, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 506
start codons at 26, 32, 88, 101, 237, 240, 333, 453
confident = false

TIG 2[bases=566]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 286
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false

TIG 3[bases=538]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=10)
437-464 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=6)
471-524 ==> 10-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
junction support: 1 umis using 14 reads
cdr3 = CARAGFITMVRGAPTSGYCGMDVW at 421, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 79, 235, 356, 382, 445, 481
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.137 = CCTACCACAATAACGA-1

using 246 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[5, 238]
surviving nonsolo ucounts = 1[238]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=314]
0-78 ==> 2-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=2)
0-78 ==> 7068-7146 on rc of segment before IGHVII-30-1 exon 1 [len=7146] (mis=2)
0-78 ==> 7062-7140 on rc of segment before IGHVII-33-1 exon 1 [len=7140] (mis=2)
0-78 ==> 6887-6965 on rc of segment before IGHVII-62-1 exon 1 [len=6965] (mis=2)
47-114 ==> 6507-6574 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=2)
78-127 ==> 0-49 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=1)
81-146 ==> 0-65 on segment before IGHV3OR16-10 exon 2 [len=151] (mis=7)
123-154 ==> 0-31 on rc of segment before IGHV3-47 exon 1 [len=111] (mis=3)
154-314 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 78, 131, 208
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.140 = CCTACCACACAAGTAA-1

using 536 reads

====================================================================================

graph has 228 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 8[2^2, 3^4, 247, 266]
surviving nonsolo ucounts = 2[247, 266]
ids = [1, 14]

====================================================================================

UMI info for barcode CCTACCACACAAGTAA-1 contig 1 = ACTTTCTGAG...
umi TCATATAACT = 261 reads: +415 validated

UMI info for barcode CCTACCACACAAGTAA-1 contig 2 = GGAGGAACTG...
umi AGCTGCTCAG = 233 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=521]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=26)
415-450 ==> 11-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
450-521 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CASTTLGYCPSFFW at 377, score = 9 + 7
umis assigned: [14]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 14, 35, 79
confident = false

TIG 2[bases=470]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=13)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
419-470 ==> 0-51 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CHQRSNWPPWTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 34, 239, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.141 = CCTACCACACACCGAC-1

using 16 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.152 = CCTACCACAGACAAGC-1

using 19 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 4, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.157 = CCTACCACATCCGGGT-1

using 971 reads

====================================================================================

graph has 922 edges initially, 36 edges after simplification

total ucounts = 232
nonsolo ucounts = 113[2^48, 3^21, 4^21, 5^7, 6^4, 7^2, 8^2, 9^2, 10^3, 12, 190, 270]
surviving nonsolo ucounts = 2[190, 270]
ids = [185, 80]

====================================================================================

UMI info for barcode CCTACCACATCCGGGT-1 contig 1 = AGCTTCAGCT...
umi CCCTGGGTAA = 266 reads: +385 validated
umi TCAATTTATT = 54 reads: +6 -1XX +1 -5XX +1 -3X +1 -3XX +2 -3XX +1 -4XX +1 -2XX +3 -1XX +2 -1XX +1 -1XX +21 -2XX +11 -1XX +5 -1XX +5 -1XX +3 -1XX +4 -85 +1 -2X +12 -1XX +1 -1XX +2 -1XX +3 -6XX +1 -1XX +1 -1XX +22 -1XX +2 -1XX +22 -1XX +1 -1XX +1 -1XX +9 -1XX +2 -1XX +2 -2XX +10 -1XX +25 -5XX +3 -2XX +1 -2XX +1 -1XX +4 -4X +3 -3X +1 -1X +4 -27 invalidated

GOOD CONTIGS

TIG 1[bases=529]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=1)
394-432 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
432-529 ==> 0-97 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CAAWDDSLNGLF at 368, score = 8 + 8
umis assigned: [80, 185]
of which 2 are surviving nonsolos
reads assigned: 314
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.158 = CCTACCACATCCGTGG-1

using 214 reads

====================================================================================

graph has 268 edges initially, 2 edges after simplification

total ucounts = 101
nonsolo ucounts = 37[2^10, 3^10, 4^7, 5^3, 6^2, 7, 8, 9, 10, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.166 = CCTACCAGTAAGAGAG-1

using 256 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 4[2, 3, 4, 238]
surviving nonsolo ucounts = 1[238]
ids = [4]

====================================================================================

UMI info for barcode CCTACCAGTAAGAGAG-1 contig 1 = GAGTCAGACC...
umi CATCTCACAG = 220 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=455]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-360 ==> 0-335 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=14)
372-410 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
410-455 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQYSSYATF at 352, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 25, 31, 100, 332, 371
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.169 = CCTACCAGTAAGTGTA-1

using 421 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 417]
surviving nonsolo ucounts = 1[417]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=475]
0-77 ==> 5531-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
32-133 ==> 0-101 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
133-272 ==> 192-331 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4) [SHIFT!]
301-339 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
339-475 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 414
start codons at 32, 65, 101, 260, 381
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.175 = CCTACCAGTAGCCTCG-1

using 1203 reads

====================================================================================

graph has 1552 edges initially, 12 edges after simplification

total ucounts = 535
nonsolo ucounts = 260[2^116, 3^48, 4^38, 5^22, 6^11, 7^7, 8^6, 9^4, 10^4, 12^2, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.178 = CCTACCAGTATATGAG-1

using 464 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[7, 453]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.180 = CCTACCAGTCAAAGAT-1

using 46 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[46]
surviving nonsolo ucounts = 1[46]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.181 = CCTACCAGTCAAGCGA-1

using 824 reads

====================================================================================

graph has 244 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 3^2, 8, 802]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.182 = CCTACCAGTCACCCAG-1

using 361 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[355]
surviving nonsolo ucounts = 1[355]
ids = [5]

====================================================================================

UMI info for barcode CCTACCAGTCACCCAG-1 contig 1 = GGAGACTCAG...
umi TCCTTCCGGA = 358 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=543]
22-364 ==> 0-342 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=14)
370-407 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
407-543 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYNGLISF at 349, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 354
start codons at 22, 28, 84, 97, 233, 236, 329, 362, 449
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.186 = CCTACCAGTCGAAAGC-1

using 306 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 4[2, 3^2, 287]
surviving nonsolo ucounts = 1[287]
ids = [9]

====================================================================================

UMI info for barcode CCTACCAGTCGAAAGC-1 contig 1 = GGTGTCTCCA...
umi TGCCATTACC = 282 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=507]
12-349 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
356-394 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
394-507 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CNSRDSSGNHVVF at 327, score = 8 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 12, 131, 160, 211, 310, 355
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.187 = CCTACCAGTCGCGAAA-1

using 65 reads

====================================================================================

graph has 52 edges initially, 4 edges after simplification

total ucounts = 22
nonsolo ucounts = 10[2^2, 3^2, 4, 5, 6^2, 10, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.188 = CCTACCAGTCGCTTCT-1

using 307 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[6, 295]
surviving nonsolo ucounts = 1[295]
ids = [5]

====================================================================================

UMI info for barcode CCTACCAGTCGCTTCT-1 contig 1 = AGGAGTCAGA...
umi CCGTCTCGGC = 276 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
415-503 ==> 0-88 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYNGQSRAF at 354, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 27, 33, 102, 238, 241, 334, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.192 = CCTACCAGTGAGCGAT-1

using 340 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 11[2, 3^5, 4, 7, 12, 14, 282]
surviving nonsolo ucounts = 1[282]
ids = [11]

====================================================================================

UMI info for barcode CCTACCAGTGAGCGAT-1 contig 1 = AGAAGAGCTG...
umi TGACCACGTA = 271 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=500]
0-34 ==> 18-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
34-382 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
416-500 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYGSSRTF at 358, score = 9 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 34, 242, 368, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.198 = CCTACCAGTGGGTCAA-1

using 37 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[37]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.201 = CCTACCAGTGTCAATC-1

using 340 reads

====================================================================================

graph has 135 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[340]
surviving nonsolo ucounts = 1[340]
ids = [0]

====================================================================================

UMI info for barcode CCTACCAGTGTCAATC-1 contig 1 = GTCAGTCTCA...
umi ACCCGAAGCT = 344 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 24-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CQQSYRRPITF at 350, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 336
start codons at 23, 29, 85, 98, 234, 333, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.207 = CCTACCAGTTCCCGAG-1

using 312 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 37
nonsolo ucounts = 12[2^5, 3^2, 4, 5, 10, 12, 240]
surviving nonsolo ucounts = 1[240]
ids = [8]

====================================================================================

UMI info for barcode CCTACCAGTTCCCGAG-1 contig 1 = ACCCAAAAAC...
umi ATACTACGCC = 234 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=547]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-547 ==> 0-57 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.208 = CCTACCAGTTCCCTTG-1

using 325 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[325]
surviving nonsolo ucounts = 1[325]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.210 = CCTACCAGTTCGGGCT-1

using 304 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[302]
surviving nonsolo ucounts = 1[302]
ids = [0]

====================================================================================

UMI info for barcode CCTACCAGTTCGGGCT-1 contig 1 = AGGAATCAGT...
umi CGAGTTCAGG = 287 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=487]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-487 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.216 = CCTACCATCAACACCA-1

using 46 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 5[3^3, 8, 29]
surviving nonsolo ucounts = 1[29]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.223 = CCTACCATCACTTATC-1

using 35 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[5, 29]
surviving nonsolo ucounts = 1[29]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.224 = CCTACCATCAGCTCGG-1

using 386 reads

====================================================================================

graph has 136 edges initially, 10 edges after simplification

total ucounts = 14
nonsolo ucounts = 9[2^2, 3, 5^2, 6, 8, 65, 285]
surviving nonsolo ucounts = 2[65, 285]
ids = [11, 2]

====================================================================================

UMI info for barcode CCTACCATCAGCTCGG-1 contig 1 = GAGCTACAAC...
umi ATATCTCCGT = 277 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=500]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
393-430 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
430-500 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYYSTPLTF at 369, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.228 = CCTACCATCATACGGT-1

using 276 reads

====================================================================================

graph has 122 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2^2, 3, 6, 7^2, 80, 165]
surviving nonsolo ucounts = 2[80, 165]
ids = [7, 4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=496]
0-75 ==> 5533-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=5)
391-429 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
429-496 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWDLLLHASSTNSSITF at 350, score = 4 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 159
start codons at 30, 63, 99, 349, 369, 471
confident = false
not full
frameshifted full length transcript of length 496
VJ delta = 30
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.229 = CCTACCATCATATCGG-1

using 405 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 400]
surviving nonsolo ucounts = 1[400]
ids = [4]

====================================================================================

UMI info for barcode CCTACCATCATATCGG-1 contig 1 = GAGGAATCAG...
umi TCTTCCGACT = 405 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=555]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=0)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CLQHNSYPQYTF at 355, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 399
start codons at 28, 34, 103, 185, 239, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.240 = CCTACCATCCTCCTAG-1

using 151 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[146]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.245 = CCTACCATCCTTTCTC-1

using 391 reads

====================================================================================

graph has 130 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 13[2^3, 3, 5, 6^2, 7^2, 9, 10, 13, 317]
surviving nonsolo ucounts = 1[317]
ids = [7]

====================================================================================

UMI info for barcode CCTACCATCCTTTCTC-1 contig 1 = GAGGAACTGC...
umi CTTTTTTTCT = 317 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
380-418 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQHYHNWPPITF at 354, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 313
start codons at 33, 102, 175, 238, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.246 = CCTACCATCGCATGAT-1

using 14092 reads

====================================================================================

graph has 5578 edges initially, 52 edges after simplification

total ucounts = 796
nonsolo ucounts = 432[2^153, 3^82, 4^48, 5^46, 6^21, 7^10, 8^11, 9^6, 10^4, 11, 12^2, 13^2, 15, 16, 17, 26, 29, 75, 90, 108, 119, 120, 139, 175, 178, 184, 204, 234, 237, 245, 249, 250, 269, 272, 278, 280^3, 296, 301, 317, 319, 323, 330^2, 335, 338, 342, 345, 352, 354, 396, 398, 407, 416, 467, 780, 800]
surviving nonsolo ucounts = 39[75, 90, 119, 120, 139, 175, 178, 184, 204, 234, 237, 245, 249, 250, 269, 272, 278, 280^2, 296, 301, 317, 319, 323, 330^2, 335, 338, 342, 345, 352, 354, 396, 398, 407, 416, 467, 780, 800]
ids = [630, 716, 299, 461, 130, 472, 623, 382, 417, 633, ...]

====================================================================================

UMI info for barcode CCTACCATCGCATGAT-1 contig 1 = ATCACATAAC...
umi AAAGGCGGTG = 264 reads: +439 validated
umi AAGAGCCGCT = 297 reads: +439 validated
umi AGGAGACTCT = 251 reads: +439 validated
umi AGGTTCATAA = 271 reads: +439 validated
umi CAGAATGTAG = 394 reads: +439 validated
umi CCCCCAGGTC = 123 reads: +439 validated
umi CTCCTCTCTT = 184 reads: +348 -1 +90 non-validated
umi GAACATCTTC = 20 reads: -297 +142 non-validated
umi GCCGTACGTA = 122 reads: +439 validated
umi GCGTTATAGG = 172 reads: +439 validated
umi GGTATCTCAG = 30 reads: -377 +16 -3XX +15 -1XX +27 invalidated
umi TAACACGATA = 248 reads: +370 -7 +62 non-validated
umi TCAAGTTGAC = 167 reads: +439 validated
umi TCATAACTTC = 74 reads: +435 -4 non-validated
umi TCATTTTCGG = 233 reads: +439 validated
umi TTAATAGCTG = 73 reads: -59X +1 -3XX +1 -5XX +1 -8XX +1 -2XX +85 -2XX +1 -2X +38 -99 +56 -31 +44 invalidated
umi TTAATGATTG = 238 reads: +439 validated

UMI info for barcode CCTACCATCGCATGAT-1 contig 2 = GGGGAGGAAC...
umi AAACACTTCC = 395 reads: +385 validated
umi ACAACACGGT = 247 reads: +385 validated
umi ACGTAGTACG = 322 reads: +385 validated
umi ACTACCCCTT = 299 reads: +385 validated
umi AGCGCGGATT = 139 reads: +385 validated
umi ATACACTGAA = 398 reads: +385 validated
umi ATACTTGATT = 312 reads: +385 validated
umi ATATATGGGT = 335 reads: +385 validated
umi ATCACGTCAT = 350 reads: +385 validated
umi ATGATATTCC = 325 reads: +385 validated
umi ATTAGCACCA = 281 reads: +385 validated
umi CACTAATCAC = 472 reads: +385 validated
umi CCAATCGCAT = 276 reads: +385 validated
umi CCACGACCGG = 338 reads: +385 validated
umi CCTCACACCA = 789 reads: +385 validated
umi CCTTAGCCAG = 301 reads: +385 validated
umi CTGCGGGCCT = 343 reads: +385 validated
umi CTTAATAATT = 334 reads: +385 validated
umi GAACACTCAG = 272 reads: +385 validated
umi GACCCGGCCC = 353 reads: +385 validated
umi TATAAATTGG = 17 reads: -348 +1 -2X +2 -1X +6 -2XX +15 -1XX +7 invalidated
umi TTACACCGGT = 400 reads: +385 validated
umi TTCCTTTTCT = 352 reads: +385 validated
umi TTCGTTCTGC = 7 reads: -363 +14 -1X +7 invalidated

GOOD CONTIGS

TIG 1[bases=568]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=3)
409-427 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=2)
434-497 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
497-568 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 13 umis using 219 reads
cdr3 = CAWAYSSSSGTHYYYYYGMDVW at 400, score = 9 + 7
umis assigned: [8, 26, 137, 144, 242, 299, 382, 417, 461, 472] and 7 others
of which 17 are surviving nonsolos
reads assigned: 3112
start codons at 58, 209, 256, 355, 454
confident = true

TIG 2[bases=557]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 22 umis using 1152 reads
cdr3 = CQQYNNWPPLTF at 357, score = 9 + 9
umis assigned: [3, 54, 100, 104, 130, 160, 166, 170, 177, 189] and 14 others
of which 22 are surviving nonsolos
reads assigned: 7545
start codons at 36, 105, 241, 463
confident = true
now this is a cell
paired!

TACTGTGCGTGGGCGTATAGCAGCTCGTCGGGAACCCATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> AGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCCTCCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.247 = CCTACCATCGCGATCG-1

using 388 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 6[2^3, 6, 8, 359]
surviving nonsolo ucounts = 1[359]
ids = [11]

====================================================================================

UMI info for barcode CCTACCATCGCGATCG-1 contig 1 = GAGTCAGACC...
umi CTCAACCTCT = 345 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=510]
0-25 ==> 22-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
25-376 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=21)
375-413 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
413-510 ==> 0-97 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQANSFPFTF at 352, score = 9 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 342
start codons at 25, 31, 100, 236, 257, 335, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.253 = CCTACCATCTACCAGA-1

using 371 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^3, 3, 8, 350]
surviving nonsolo ucounts = 1[350]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=568]
3-319 ==> 37-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=1)
319-357 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
357-568 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CSSYTSSSTLVVF at 290, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 349
start codons at 123, 167, 174, 177
confident = false
not full
VJ delta = 27
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.256 = CCTACCATCTCGATGA-1

using 169 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2^2, 158]
surviving nonsolo ucounts = 1[158]
ids = [3]

====================================================================================

UMI info for barcode CCTACCATCTCGATGA-1 contig 1 = GAGCTACAAC...
umi CACAGGATTG = 153 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=520]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-520 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 153
start codons at 27, 30, 85, 99, 352, 382, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 32.270 = CCTAGCTAGAAGATTC-1

using 285 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 7[2, 3^2, 8, 12, 13, 233]
surviving nonsolo ucounts = 1[233]
ids = [1]

====================================================================================

UMI info for barcode CCTAGCTAGAAGATTC-1 contig 1 = ATCAGTCCCA...
umi AATGGTGGCA = 213 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=497]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-497 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!
sorting bam, mem = 0.06
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk032-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk032-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

7.603 seconds used processing barcodes, peak mem = 0.23
