[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.31 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk026-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk026-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk026.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.0 = CATGACATCATGCAAC-1

using 10010 reads

====================================================================================

graph has 8283 edges initially, 156 edges after simplification

total ucounts = 1529
nonsolo ucounts = 1152[2^184, 3^151, 4^120, 5^94, 6^97, 7^88, 8^72, 9^73, 10^40, 11^38, 12^47, 13^26, 14^27, 15^27, 16^18, 17^10, 18^10, 19^5, 20^4, 21^7, 22^3, 23^3, 25, 28, 29, 30, 34, 55, 368, 1263]
surviving nonsolo ucounts = 2[368, 1263]
ids = [1030, 1412]

====================================================================================

UMI info for barcode CATGACATCATGCAAC-1 contig 1 = GGGCTTTCTG...
umi GTTACTGCTA = 373 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=526]
16-387 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=15)
409-455 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=7)
455-526 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARGADRSDTVSLEYW at 376, score = 8 + 6
umis assigned: [1030]
of which 1 are surviving nonsolos
reads assigned: 365
start codons at 16, 37, 81, 167
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.3 = CATGACATCCGAACGC-1

using 262 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 4, 254]
surviving nonsolo ucounts = 1[254]
ids = [0]

====================================================================================

UMI info for barcode CATGACATCCGAACGC-1 contig 1 = GGGGGACTCC...
umi ACATTACGGC = 251 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=520]
21-371 ==> 0-350 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=23)
402-454 ==> 0-52 on |49|IGHJ1|J-REGION| [len=52] (mis=4)
454-520 ==> 0-66 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CAGPWSSGFFATAEYFPHW at 366, score = 8 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 21, 65, 244, 327
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.7 = CATGACATCCTAGTGA-1

using 460 reads

====================================================================================

graph has 174 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 186, 266]
surviving nonsolo ucounts = 2[186, 266]
ids = [1, 2]

====================================================================================

UMI info for barcode CATGACATCCTAGTGA-1 contig 1 = GCAGGAGTCA...
umi CTACAAATGC = 171 reads: +388 validated

UMI info for barcode CATGACATCCTAGTGA-1 contig 2 = CGAGCCCAGC...
umi CTCCCTTGGG = 249 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=458]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=21)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
417-458 ==> 0-41 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CLQDYSYPLTF at 356, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 169
start codons at 29, 35, 91, 104, 261, 410
confident = false

TIG 2[bases=506]
0-67 ==> 0-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
67-420 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=2)
429-482 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=0)
482-506 ==> 0-24 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CASATRSYWYFDLW at 409, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 67, 218, 223, 281, 284, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.20 = CATGACATCTGTCCGT-1

using 664 reads

====================================================================================

graph has 244 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^3, 3, 5, 647]
surviving nonsolo ucounts = 1[647]
ids = [4]

====================================================================================

UMI info for barcode CATGACATCTGTCCGT-1 contig 1 = TGGGAGGAAT...
umi GCGATACGCC = 643 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 104 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 637
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.29 = CATGCCTAGATAGTCA-1

using 351 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 3^2, 4, 334]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.34 = CATGCCTAGCGAAGGG-1

using 187 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 3, 181]
surviving nonsolo ucounts = 1[181]
ids = [1]

====================================================================================

UMI info for barcode CATGCCTAGCGAAGGG-1 contig 1 = AAACCACACC...
umi CCTGGCCAAC = 173 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=557]
0-48 ==> 11-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
48-401 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
450-484 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
484-557 ==> 0-73 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 390, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 172
start codons at 48, 246, 251, 268, 312, 345, 538
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.44 = CATGCCTAGGCATGGT-1

using 113 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3, 6, 9, 93]
surviving nonsolo ucounts = 1[93]
ids = [5]

====================================================================================

UMI info for barcode CATGCCTAGGCATGGT-1 contig 1 = GAGTCAGACC...
umi TTCGACTGCA = 81 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=458]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=12)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
413-458 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CQQYDSYSWTF at 352, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 80
start codons at 25, 31, 87, 100, 332, 362
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.47 = CATGCCTAGGGCACTA-1

using 669 reads

====================================================================================

graph has 382 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2^2, 170, 246, 248]
surviving nonsolo ucounts = 3[170, 246, 248]
ids = [4, 1, 0]

====================================================================================

UMI info for barcode CATGCCTAGGGCACTA-1 contig 1 = AGCTCTGAGA...
umi CGTATCCCGA = 239 reads: +424 validated
umi TGTGAGTAGT = 169 reads: +111 -1XX +156 -1XX +155 invalidated

UMI info for barcode CATGCCTAGGGCACTA-1 contig 2 = GGGTAGAGAA...
umi CAGTCCCTGC = 237 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=567]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-567 ==> 0-64 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 2 umis using 51 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 393
start codons at 79, 230, 235, 382, 460
confident = true

TIG 2[bases=569]
0-35 ==> 79-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
35-388 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
385-423 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
423-569 ==> 0-146 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CASWDDSLRGRVF at 356, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 35, 189, 339, 364, 369
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.48 = CATGCCTAGGGTGTGT-1

using 409 reads

====================================================================================

graph has 140 edges initially, 4 edges after simplification

total ucounts = 16
nonsolo ucounts = 8[3^4, 4, 5, 157, 223]
surviving nonsolo ucounts = 2[157, 223]
ids = [6, 14]

====================================================================================

UMI info for barcode CATGCCTAGGGTGTGT-1 contig 1 = ACTTTCTGAG...
umi GACCTATCGA = 152 reads: +415 validated

UMI info for barcode CATGCCTAGGGTGTGT-1 contig 2 = GCTGCGGGTA...
umi TCATTAGAGG = 212 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=478]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=17)
400-450 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
450-478 ==> 0-28 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CARDFPGNYFTFDIW at 374, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 150
start codons at 35, 79, 159, 229, 431
confident = false

TIG 2[bases=536]
0-40 ==> 0-40 on |318|IGLV1-36|5'UTR| [len=40] (mis=0)
40-393 ==> 0-353 on |319|IGLV1-36|L-REGION+V-REGION| [len=353] (mis=3)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
428-536 ==> 0-108 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CAAWDDSLSGPVF at 361, score = 8 + 8
umis assigned: [14]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 40, 191, 248, 251, 344, 369, 374
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.51 = CATGCCTAGGTGATAT-1

using 873 reads

====================================================================================

graph has 262 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 3, 175, 259, 428]
surviving nonsolo ucounts = 2[259, 428]
ids = [0, 6]

====================================================================================

UMI info for barcode CATGCCTAGGTGATAT-1 contig 1 = AGCTTCAGCT...
umi AATTATTATA = 259 reads: +391 validated
umi CGTTATATAT = 440 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=560]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=14)
399-437 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
437-560 ==> 0-123 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 94 reads
cdr3 = CATWDDSLKGPYVF at 367, score = 7 + 8
umis assigned: [0, 6]
of which 2 are surviving nonsolos
reads assigned: 672
start codons at 46, 200, 350, 375, 380, 401
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.53 = CATGCCTAGTCGATAA-1

using 287 reads

====================================================================================

graph has 98 edges initially, 10 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 136, 145]
surviving nonsolo ucounts = 2[136, 145]
ids = [4, 3]

====================================================================================

UMI info for barcode CATGCCTAGTCGATAA-1 contig 1 = GCTGGGGTCT...
umi CCAGCTCTTT = 144 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=449]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-395 ==> 0-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 31 reads
cdr3 = CSSYTSSSTLVVF at 365, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 141
start codons at 41, 198, 242, 249
confident = false

REJECT CONTIGS

TIG 1[bases=483]
4-223 ==> 114-333 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=20)
234-272 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=6)
272-483 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
cdr3 = CQVWNSETEQKLF at 205, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 136
start codons at 188
confident = false
not full
VJ delta = 26
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.56 = CATGCCTAGTGGTAGC-1

using 150 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 8, 137]
surviving nonsolo ucounts = 1[137]
ids = [3]

====================================================================================

UMI info for barcode CATGCCTAGTGGTAGC-1 contig 1 = GCTGGGGTCT...
umi GTCGATTTCC = 132 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=515]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-356 ==> 0-315 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=12)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
429-515 ==> 0-86 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CTSYAGGSNVVF at 365, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 131
start codons at 41, 249, 348, 375, 390
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.67 = CATGCCTCAAGAAGAG-1

using 56 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 51]
surviving nonsolo ucounts = 1[51]
ids = [3]

====================================================================================

UMI info for barcode CATGCCTCAAGAAGAG-1 contig 1 = CCATGGAAAC...
umi CTTTACCCTG = 45 reads: +308 -1 +73 non-validated

GOOD CONTIGS

TIG 1[bases=422]
2-338 ==> 0-336 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
347-384 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
384-422 ==> 0-38 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CQQYRNSITF at 326, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 45
start codons at 2
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.70 = CATGCCTCAAGGTTCT-1

using 57 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 10[2^5, 3, 5, 7, 12, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.94 = CATGCCTCAGCTCCGA-1

using 87 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[87]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.99 = CATGCCTCAGTAAGCG-1

using 163 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[5, 6, 151]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.104 = CATGCCTCATACCATG-1

using 78 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 21
nonsolo ucounts = 12[2^3, 3, 5^3, 6, 7, 9, 11, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.108 = CATGCCTCATCACGAT-1

using 297 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 293]
surviving nonsolo ucounts = 1[293]
ids = [1]

====================================================================================

UMI info for barcode CATGCCTCATCACGAT-1 contig 1 = GATCAGGACT...
umi CCATTTCAAG = 289 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=488]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
388-427 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
427-488 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CMQALQTPCSF at 366, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.119 = CATGCCTCATTGAGCT-1

using 11563 reads

====================================================================================

graph has 8784 edges initially, 155 edges after simplification

total ucounts = 1583
nonsolo ucounts = 1193[2^232, 3^156, 4^145, 5^88, 6^106, 7^71, 8^71, 9^66, 10^51, 11^54, 12^43, 13^24, 14^26, 15^16, 16^8, 17^8, 18^4, 19^6, 20, 21^3, 22, 129, 151, 241, 264, 267, 319, 335, 336, 337, 339, 359, 370, 388]
surviving nonsolo ucounts = 11[241, 264, 267, 319, 335, 336, 337, 339, 359, 370, 388]
ids = [19, 89, 58, 393, 1542, 1352, 1473, 532, 1495, 210, ...]

====================================================================================

UMI info for barcode CATGCCTCATTGAGCT-1 contig 1 = GAAGAGCTGC...
umi AAAGGTGGAA = 242 reads: +388 validated
umi AAGTTAACCC = 267 reads: +388 validated
umi AATTCGTCGC = 262 reads: +388 validated
umi AGATAGTGCT = 369 reads: -30 +358 non-validated
umi ATCCCCTGGG = 372 reads: +388 validated
umi ATTTTGGTGC = 313 reads: +388 validated
umi CCGCTAGGAT = 334 reads: +388 validated
umi TGCATCCTCC = 332 reads: +388 validated
umi TTCGATCCTG = 338 reads: +388 validated
umi TTTCACAGTG = 334 reads: +388 validated

UMI info for barcode CATGCCTCATTGAGCT-1 contig 2 = GGTTTTTCCA...
umi TTGCAGCCGA = 318 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 502 reads
cdr3 = CQQYGSSPGWTF at 357, score = 9 + 8
umis assigned: [19, 58, 89, 210, 311, 393, 532, 1352, 1473, 1542]
of which 10 are surviving nonsolos
reads assigned: 3125
start codons at 33, 241, 367, 463
confident = true

TIG 2[bases=505]
44-399 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=29)
411-459 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
459-505 ==> 0-46 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CAKGSVANYYFDYW at 386, score = 9 + 7
umis assigned: [1495]
of which 1 are surviving nonsolos
reads assigned: 317
start codons at 44, 189, 195, 200, 279, 347, 477
confident = true
now this is a cell
paired!

AGAGCTGAGGACACGGCCTTGTATTACTGTGCAAAAGGATCGGTGGCTAATTACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCGGGGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.124 = CATGCCTGTAAATGTG-1

using 278 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^3, 3, 265]
surviving nonsolo ucounts = 1[265]
ids = [2]

====================================================================================

UMI info for barcode CATGCCTGTAAATGTG-1 contig 1 = CAGGACACAG...
umi ATTTCCTCGT = 250 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=461]
11-362 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=6)
361-399 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
399-461 ==> 0-62 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYGNLSWTF at 338, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 11, 17, 73, 86, 225, 348, 441
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.150 = CATGCCTGTCTTGATG-1

using 183 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 179]
surviving nonsolo ucounts = 1[179]
ids = [0]

====================================================================================

UMI info for barcode CATGCCTGTCTTGATG-1 contig 1 = GGAGGAATCA...
umi ACGGTCTGGT = 179 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
29-380 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CLQYSSSPWTF at 356, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 177
start codons at 29, 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.173 = CATGCCTGTTCGTCTC-1

using 895 reads

====================================================================================

graph has 252 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 889]
surviving nonsolo ucounts = 1[889]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.174 = CATGCCTGTTGCGTTA-1

using 408 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 6[2, 4, 5^2, 7, 385]
surviving nonsolo ucounts = 1[385]
ids = [1]

====================================================================================

UMI info for barcode CATGCCTGTTGCGTTA-1 contig 1 = GTCAGACCCA...
umi CAGAGCATAA = 391 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 24-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=24)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 68 reads
cdr3 = CLQADSFPRTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 384
start codons at 23, 29, 85, 98, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.199 = CATGCCTTCATTGCCC-1

using 10 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.203 = CATGCCTTCCAGGGCT-1

using 299 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 7, 290]
surviving nonsolo ucounts = 1[290]
ids = [1]

====================================================================================

UMI info for barcode CATGCCTTCCAGGGCT-1 contig 1 = GGGAATCAGT...
umi GGTTCACTTA = 294 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=20)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.209 = CATGCCTTCCTAGAAC-1

using 230 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[5, 14, 204]
surviving nonsolo ucounts = 1[204]
ids = [8]

====================================================================================

UMI info for barcode CATGCCTTCCTAGAAC-1 contig 1 = ATCAGTCCCA...
umi TCAGACGTCT = 193 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=499]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=20)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-499 ==> 0-88 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.214 = CATGCCTTCGAATGGG-1

using 567 reads

====================================================================================

graph has 198 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 225, 335]
surviving nonsolo ucounts = 2[225, 335]
ids = [2, 1]

====================================================================================

UMI info for barcode CATGCCTTCGAATGGG-1 contig 1 = GGAGGAACTG...
umi ATTTAGGGGC = 313 reads: +382 validated

UMI info for barcode CATGCCTTCGAATGGG-1 contig 2 = ATCACATAAC...
umi CCATGCGTGG = 222 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=493]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=7)
416-493 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQRRTWPPAF at 355, score = 9 + 6
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 34, 83, 239, 458
confident = false

TIG 2[bases=512]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=1)
58-336 ==> 0-278 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=22)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
479-512 ==> 0-33 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARDGGTEARQYSAYW at 400, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 16, 58, 209, 256, 278, 322, 355, 410
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.215 = CATGCCTTCGAGAGCA-1

using 22721 reads

====================================================================================

graph has 9346 edges initially, 124 edges after simplification

total ucounts = 1265
nonsolo ucounts = 633[2^217, 3^132, 4^76, 5^43, 6^41, 7^17, 8^12, 9^8, 10^9, 12^4, 13, 14, 15, 18, 19, 21, 28, 29, 37, 48, 52, 56^2, 66, 75, 83, 108, 109, 128, 151, 164, 165^2, 174, 182, 183, 184, 187, 203, 209, 220^2, 231^2, 232, 237, 238, 243, 245, 251, 254, 255^2, 261, 262, 265^2, 268, 274, 276, 292, 305, 306, 309, 312, 318, 330, 333^2, 344, 351, 353^2, 357, 384, 430, 654, 718, 759, 817, 836, 839, 1022, 1089]
surviving nonsolo ucounts = 64[52, 56^2, 66, 75, 83, 108, 109, 128, 151, 164, 165^2, 174, 182, 183, 184, 187, 203, 209, 220^2, 231^2, 232, 237, 238, 243, 245, 251, 254, 255^2, 261, 262, 265^2, 268, 274, 276, 292, 305, 306, 309, 312, 318, 330, 333^2, 344, 351, 353^2, 357, 384, 430, 654, 718, 759, 817, 836, 839, 1022, 1089]
ids = [1184, 580, 699, 372, 102, 1061, 170, 1144, 381, 1102, ...]

====================================================================================

UMI info for barcode CATGCCTTCGAGAGCA-1 contig 1 = TGGGACTGAT...
umi AAACTTCTCC = 242 reads: +397 validated
umi GAGCACCCTT = 53 reads: +397 validated
umi TGCCTTTTAT = 277 reads: +397 validated
umi TGTCACCTCT = 105 reads: +397 validated

UMI info for barcode CATGCCTTCGAGAGCA-1 contig 2 = TGGGGATGCT...
umi AAATTGGTCA = 352 reads: +415 validated
umi ACAACAACCT = 329 reads: +415 validated
umi ACATCTAACG = 74 reads: -1 +2 -1 +384 -27 non-validated
umi AGGCAATACT = 255 reads: +415 validated
umi ATTTTTTTTG = 229 reads: +415 validated
umi CAGCCGACTG = 66 reads: +415 validated
umi CAGCGGGCTA = 252 reads: +415 validated
umi CAGGTTTGTT = 129 reads: +4 -1 +410 non-validated
umi CCTATATATC = 161 reads: +415 validated
umi CGAAGATCCC = 341 reads: +415 validated
umi CGATACAGCT = 434 reads: +415 validated
umi CTCACTACTC = 293 reads: +415 validated
umi CTCCTCTTCC = 316 reads: +415 validated
umi GAAATTTTGA = 234 reads: +415 validated
umi GAGGGACTCG = 313 reads: +415 validated
umi GTAAGCCGCC = 354 reads: +415 validated
umi GTATACCAGG = 232 reads: +415 validated
umi GTTGCACTAT = 331 reads: +412 -3 non-validated
umi TAGTCTACCT = 361 reads: +415 validated
umi TCCAAATCAG = 158 reads: +415 validated
umi TCCGTCGGGG = 164 reads: +415 validated
umi TCTACCATGG = 82 reads: +415 validated
umi TGGCCCAGGG = 259 reads: +415 validated
umi TGTATCGTCT = 707 reads: +415 validated
umi TTCACTCGTA = 51 reads: +390 -25 non-validated

UMI info for barcode CATGCCTTCGAGAGCA-1 contig 3 = GGGGTCTCAG...
umi ACACAGTCCT = 238 reads: +388 validated
umi ACCAGCCAGA = 220 reads: +388 validated
umi ACTATCGGCT = 304 reads: +388 validated
umi AGAGCCGTCT = 109 reads: +388 validated
umi AGCCCTCGCT = 1094 reads: -332X +56 invalidated
umi AGCCGAGGTA = 267 reads: +388 validated
umi AGGGCGTACG = 185 reads: +388 validated
umi CACATAGCTC = 204 reads: +388 validated
umi CAGATATGCC = 256 reads: +388 validated
umi CCGCCATACT = 220 reads: +388 validated
umi CCGGCTATCA = 272 reads: +388 validated
umi CGATCCCCGC = 239 reads: +388 validated
umi CTGGACCCAG = 259 reads: +388 validated
umi CTTTGTTCCG = 823 reads: -346X +1 -3XX +2 -1XX +2 -1XX +31 -1XX invalidated
umi GAGCGGGATC = 249 reads: +388 validated
umi GCACAGATCG = 174 reads: +388 validated
umi GGGCATGTCT = 182 reads: +388 validated
umi GTTGGAAGCA = 329 reads: -44 +344 non-validated
umi TCACGGCACC = 761 reads: -339X +2 -5XX +1 -3XX +2 -1XX +2 -1XX +31 -1XX invalidated
umi TCTAGTATAT = 843 reads: -339X +2 -5XX +1 -3XX +2 -1XX +2 -1XX +31 -1XX invalidated
umi TGATGGCATA = 150 reads: +388 validated
umi TGGGACCTTG = 209 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=528]
37-397 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=13)
397-434 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
434-528 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 4 umis using 94 reads
cdr3 = CMQRTHWLRPI at 373, score = 7 + 6
umis assigned: [12, 699, 1111, 1144]
of which 4 are surviving nonsolos
reads assigned: 665
start codons at 37, 70, 98, 106, 194, 356, 376, 476
confident = true

TIG 2[bases=528]
42-390 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=26)
420-457 ==> 9-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
457-528 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 22 umis using 622 reads
cdr3 = CARQIGYPGLEYW at 387, score = 9 + 7
umis assigned: [34, 88, 102, 195, 328, 372, 373, 381, 484, 510] and 15 others
of which 25 are surviving nonsolos
reads assigned: 6381
start codons at 5, 30, 42, 86
confident = true

TIG 3[bases=637]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=6)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
426-637 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 18 umis using 667 reads
cdr3 = CSSYAGSNNLEF at 362, score = 8 + 9
umis assigned: [92, 110, 150, 170, 183, 184, 205, 348, 370, 463] and 12 others
of which 22 are surviving nonsolos
reads assigned: 7462
start codons at 38, 195, 246, 345, 372
confident = true

REJECT CONTIGS

TIG 1[bases=597]
0-80 ==> 0-80 on |111|IGHV3-15|5'UTR| [len=80] (mis=0)
0-80 ==> 9419-9499 on rc of segment before IGHVII-15-1 exon 1 [len=9499] (mis=0)
1-83 ==> 5918-6000 on rc of segment after IGHV3-47 exon 1 [len=6000] (mis=3)
80-439 ==> 0-359 on |112|IGHV3-15|L-REGION+V-REGION| [len=359] (mis=21)
452-476 ==> 0-24 on |21|IGHD3-3|D-REGION| [len=31] (mis=1)
475-526 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=3)
526-597 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [580, 626, 696, 955, 1078]
of which 5 are surviving nonsolos
reads assigned: 956
start codons at 80, 236, 303, 360, 381, 389
confident = false
frameshifted full length stopped transcript of length 597
did not find CDR3

TIG 2[bases=729]
4-28 ==> 5976-6000 on segment before IGLV10-54 exon 1 [len=6000] (mis=0)
41-84 ==> 0-43 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=0)
87-199 ==> 0-112 on segment before IGLV10-54 exon 2 [len=112] (mis=2)
196-243 ==> 43-90 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=0) [SHIFT!]
243-288 ==> 91-136 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=1)
288-480 ==> 160-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=12)
480-518 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
518-729 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [109, 857, 861, 897, 931, 974, 986, 1252]
of which 8 are surviving nonsolos
reads assigned: 3738
start codons at 41, 339, 457
confident = false
see deletion of 24 bases at pos 136 on |333|IGLV10-54|L-REGION+V-REGION|
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.222 = CATGCCTTCTAAGCCA-1

using 223 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 2[6, 205]
surviving nonsolo ucounts = 1[205]
ids = [2]

====================================================================================

UMI info for barcode CATGCCTTCTAAGCCA-1 contig 1 = GGGAATCAGT...
umi AGTCAGCGGT = 184 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=481]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-481 ==> 0-66 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 182
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.256 = CATGGCGAGGCAATTA-1

using 170 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 5, 158]
surviving nonsolo ucounts = 1[158]
ids = [7]

====================================================================================

UMI info for barcode CATGGCGAGGCAATTA-1 contig 1 = CTGGGCCTAA...
umi TTAGCAGGAG = 149 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=539]
0-37 ==> 214-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
37-388 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=20)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
419-539 ==> 0-120 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQLWHSGSDHQVF at 352, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 146
start codons at 37, 185, 236, 239, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.259 = CATGGCGAGGCTATCT-1

using 2238 reads

====================================================================================

graph has 2850 edges initially, 55 edges after simplification

total ucounts = 945
nonsolo ucounts = 415[2^169, 3^98, 4^57, 5^43, 6^17, 7^13, 8^6, 9^2, 10^4, 12^4, 22, 264]
surviving nonsolo ucounts = 1[264]
ids = [755]

====================================================================================

UMI info for barcode CATGGCGAGGCTATCT-1 contig 1 = GGGGGGTCTC...
umi TATTCGACAA = 257 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=553]
40-383 ==> 0-343 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=17)
393-431 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
431-553 ==> 0-122 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CSSYSSTPTYWLF at 364, score = 8 + 8
umis assigned: [755]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 40, 197, 251
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 26.261 = CATGGCGAGGTAAACT-1

using 182 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[3, 171]
surviving nonsolo ucounts = 1[171]
ids = [6]

====================================================================================

UMI info for barcode CATGGCGAGGTAAACT-1 contig 1 = AGCTTCAGCT...
umi GTCGTTGCGC = 162 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=529]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
396-434 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
434-529 ==> 0-95 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CAAWDDSLSGRVF at 367, score = 7 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 159
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!
sorting bam, mem = 0.08
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk026-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk026-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

10.210 seconds used processing barcodes, peak mem = 0.23
