[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.31 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk025-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk025-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk025.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.1 = CATCGAATCTTTCCTC-1

using 18 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.12 = CATCGGGAGCGTAATA-1

using 125 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[123]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.15 = CATCGGGAGGACTGGT-1

using 141 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[140]
surviving nonsolo ucounts = 1[140]
ids = [1]

====================================================================================

UMI info for barcode CATCGGGAGGACTGGT-1 contig 1 = GCTGGGGTCA...
umi TCATTAATCC = 141 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=477]
0-41 ==> 121-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
41-381 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
junction support: 1 umis using 15 reads
cdr3 = CCSEAGGGVPGLLF at 365, score = 7 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 139
start codons at 41, 195
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.19 = CATCGGGAGGTAGCTG-1

using 630 reads

====================================================================================

graph has 200 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[630]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.25 = CATCGGGAGTGGAGAA-1

using 32 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 12, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.27 = CATCGGGAGTTTCCTT-1

using 1662 reads

====================================================================================

graph has 1894 edges initially, 16 edges after simplification

total ucounts = 468
nonsolo ucounts = 233[2^90, 3^51, 4^33, 5^23, 6^13, 7^6, 8^4, 9^3, 10, 11^2, 13, 18, 22, 59, 96, 198, 230]
surviving nonsolo ucounts = 5[7, 59, 96, 198, 230]
ids = [66, 421, 116, 202, 16]

====================================================================================

UMI info for barcode CATCGGGAGTTTCCTT-1 contig 1 = GGAGTCTCCC...
umi AATAGCGACA = 219 reads: -380 +1 -1XX +1 -2XX +1 -1XX +1 -10XX +1 -2XX +1 -2XX +1 -3XX +1 invalidated
umi AGCCCCCCCC = 7 reads: -26 +125 -69 +56 -40 +56 -37 non-validated
umi CACAAACGGT = 101 reads: +396 -2 +11 non-validated
umi CTAAAGCACC = 195 reads: +409 validated
umi TGTGAGCCGT = 58 reads: +358 -1 +50 non-validated

GOOD CONTIGS

TIG 1[bases=650]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=11)
420-468 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
468-650 ==> 0-182 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 2 umis using 27 reads
cdr3 = CARTDYSAFDHW at 401, score = 8 + 7
umis assigned: [16, 66, 116, 202, 421]
of which 5 are surviving nonsolos
reads assigned: 570
start codons at 59, 233, 257, 270
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.33 = CATCGGGCAATCACAC-1

using 336 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[334]
surviving nonsolo ucounts = 1[334]
ids = [2]

====================================================================================

UMI info for barcode CATCGGGCAATCACAC-1 contig 1 = AGGAGTCAGA...
umi TGAGCTAATA = 311 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=488]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-488 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.34 = CATCGGGCACAAGACG-1

using 138 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 135]
surviving nonsolo ucounts = 1[135]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=381]
0-138 ==> 7-145 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=3)
138-342 ==> 147-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=17)
341-379 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
cdr3 = CLQYSSSPWTF at 318, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 114
start codons at 68, 202
confident = false
not full
VJ delta = 16
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.38 = CATCGGGCACAGGAGT-1

using 75 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 11[2^2, 3^2, 4^2, 7, 8, 11, 12, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.40 = CATCGGGCACATGTGT-1

using 94 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 14[2^2, 3^4, 4, 7, 8^2, 9, 11, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.46 = CATCGGGCACTGTGTA-1

using 206 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[201]
surviving nonsolo ucounts = 1[201]
ids = [1]

====================================================================================

UMI info for barcode CATCGGGCACTGTGTA-1 contig 1 = ATCAGACCCA...
umi ACTTTCTGCG = 185 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=489]
0-23 ==> 4-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=1)
373-411 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
411-489 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYNSYPPTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 182
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.47 = CATCGGGCACTTAAGC-1

using 22079 reads

====================================================================================

graph has 6688 edges initially, 52 edges after simplification

total ucounts = 509
nonsolo ucounts = 254[2^75, 3^47, 4^19, 5^12, 6^5, 7, 8^3, 10^2, 11^2, 14, 15^2, 25^2, 27, 31, 58, 67, 69, 76, 78, 100, 102, 108, 124, 141, 142, 145, 161, 171, 174, 176, 180, 185, 206, 208^2, 210, 213, 214, 215, 222, 232, 233, 236, 237, 243, 248, 249, 253, 254, 257, 258, 261, 262, 263, 271, 272, 273, 274, 275, 280, 281, 282, 287, 291, 292, 295, 296, 298^2, 303, 304, 307, 308, 309, 310, 316, 328, 329, 333, 344, 345, 350, 354, 355, 356^2, 363, 370, 383, 388, 392, 393, 405, 471, 666]
surviving nonsolo ucounts = 77[25, 58, 100, 102, 108, 141, 142, 145, 161, 171, 174, 176, 180, 185, 206, 208^2, 210, 213, 214, 215, 222, 232, 233, 236, 237, 243, 248, 249, 253, 254, 257, 258, 261, 262, 263, 271, 272, 273, 274, 275, 280, 281, 282, 287, 291, 292, 295, 296, 298^2, 303, 304, 307, 308, 309, 310, 316, 328, 329, 333, 344, 345, 350, 354, 355, 356^2, 363, 370, 383, 388, 392, 393, 405, 471, 666]
ids = [203, 154, 42, 292, 349, 430, 315, 60, 225, 455, ...]

====================================================================================

UMI info for barcode CATCGGGCACTTAAGC-1 contig 1 = AGGAGTCAGT...
umi AAATCAGGTG = 332 reads: +388 validated
umi AAATTCGGTG = 252 reads: +388 validated
umi AACTCGATCC = 395 reads: +388 validated
umi AAGCCCCCCC = 173 reads: -343 +45 non-validated
umi ACCTCGAACC = 238 reads: +388 validated
umi ACCTTTAGGA = 99 reads: +388 validated
umi ACGGGTACAT = 259 reads: +388 validated
umi ACGTCCCTTG = 357 reads: +388 validated
umi ACTCCGCGCC = 149 reads: +388 validated
umi AGGAATCCAC = 362 reads: +388 validated
umi AGGAGTTTCA = 288 reads: +388 validated
umi ATATCGTCGT = 278 reads: +388 validated
umi ATCATCGCTA = 697 reads: +138 -1XX +1 -12XX +1 -1XX +1 -1XX +1 -1XX +2 -6XX +1 -141 +2 -7X +1 -5XX +1 -1XX +1 -3XX +1 -3XX +1 -1XX +53 invalidated
umi ATCATTAGGG = 345 reads: +388 validated
umi CAAGAAATCC = 367 reads: +388 validated
umi CACCACGCTT = 287 reads: +388 validated
umi CACCATGCAT = 215 reads: +388 validated
umi CACTTTCTTC = 398 reads: +388 validated
umi CCCGCTATTA = 382 reads: +388 validated
umi CCCTCCCGGC = 296 reads: +388 validated
umi CCGGGCCCGG = 355 reads: +388 validated
umi CGGCATATCA = 345 reads: +388 validated
umi CTTTATGTCT = 266 reads: +388 validated
umi GATAGTCCTT = 222 reads: +388 validated
umi GATCCCTCTC = 184 reads: +388 validated
umi GCGATTCCCT = 285 reads: +388 validated
umi GGTATCTTGG = 295 reads: +388 validated
umi GTAAGAGCCA = 273 reads: +388 validated
umi GTCACCGTGC = 143 reads: +388 validated
umi GTCCATTGCG = 180 reads: +388 validated
umi TACCTATCTC = 274 reads: +388 validated
umi TATAGCGCGG = 173 reads: +388 validated
umi TATCGGCTGC = 316 reads: +388 validated
umi TCAGCTTCTC = 272 reads: +388 validated
umi TCAGTGCGCG = 314 reads: +388 validated
umi TCAGTTTACG = 254 reads: +388 validated
umi TCCAATGGGT = 235 reads: +388 validated
umi TCCGTGCTCA = 404 reads: +388 validated
umi TCCTGTATCA = 377 reads: +388 validated
umi TCGTCGCGGA = 261 reads: +388 validated
umi TCTCCCGCTC = 331 reads: +388 validated
umi TCTCCTGTCA = 470 reads: -70X +318 invalidated
umi TCTGCGCCGC = 141 reads: +388 validated
umi TGAGAAGCTA = 261 reads: +388 validated
umi TGTCACAACT = 309 reads: +388 validated
umi TGTTGTGTTA = 259 reads: +388 validated
umi TTAAAACCGC = 368 reads: +388 validated
umi TTATGCGCTA = 312 reads: +388 validated
umi TTCTAATACC = 344 reads: +388 validated
umi TTTCGTCGTG = 327 reads: +388 validated
umi TTTCTATTAC = 232 reads: +388 validated

UMI info for barcode CATCGGGCACTTAAGC-1 contig 2 = AGTGCTTTCT...
umi AACTCCCATT = 297 reads: +439 validated
umi AATACGACCG = 306 reads: +439 validated
umi ACAGATACTA = 252 reads: +433 -1 +5 non-validated
umi ACGGTTTCGA = 295 reads: +439 validated
umi ACTTGAACCT = 303 reads: +439 validated
umi AGTTATGTCC = 246 reads: +439 validated
umi CAGATGGGCG = 205 reads: +439 validated
umi CAGTATTCTG = 58 reads: +439 validated
umi CATAGCCTTG = 264 reads: +439 validated
umi CCCGTCGGTA = 302 reads: +439 validated
umi CCGTATTCTG = 312 reads: +439 validated
umi CGCGATTCAA = 273 reads: +439 validated
umi CGTTTTTCCC = 163 reads: +439 validated
umi GACCCCCTTC = 208 reads: +439 validated
umi GCCCATTTTC = 232 reads: +439 validated
umi GCTTGTAGCA = 100 reads: +423 -11 +5 non-validated
umi GGAAAAGGTT = 312 reads: +439 validated
umi GGCTCTGTTC = 211 reads: +439 validated
umi TACAATGCGG = 108 reads: -2X +431 -1 +2 -1 +1 -1 invalidated
umi TATGTAGCAT = 232 reads: +439 validated
umi TGGAACGCTA = 357 reads: +439 validated
umi TGTTAGCACT = 172 reads: +428 -1X +10 invalidated
umi TTCGTATCTG = 209 reads: +403 -1 +6 -1 +1 -2 +11 -1 +3 -1 +9 non-validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
27-352 ==> 0-325 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=13)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 49 umis using 2254 reads
cdr3 = CQQTYSSPRTF at 354, score = 9 + 8
umis assigned: [4, 5, 10, 12, 39, 42, 48, 53, 60, 76] and 41 others
of which 51 are surviving nonsolos
reads assigned: 14704
start codons at 27, 33, 89, 102, 238, 457
confident = true

TIG 2[bases=527]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=17)
410-456 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=7)
456-527 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 20 umis using 388 reads
cdr3 = CARGDARSDSLSVDYW at 377, score = 8 + 5
umis assigned: [9, 19, 31, 51, 63, 88, 142, 154, 157, 180] and 13 others
of which 23 are surviving nonsolos
reads assigned: 5328
start codons at 17, 38, 82, 168, 347, 390
confident = true
now this is a cell
paired!

GCGGACACGGCTGTGTATTACTGTGCGAGGGGGGATGCCCGGTCTGATTCACTAAGTGTTGACTACTGGGGCCACGGAAACCTGATCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTTTTGTCAGCAGACGTACAGTTCCCCTCGAACGTTCGGCCAAGGGACCAAGGTGGAGATCAAGC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.52 = CATCGGGCAGATTGCT-1

using 410 reads

====================================================================================

graph has 158 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 197, 208]
surviving nonsolo ucounts = 2[197, 208]
ids = [2, 3]

====================================================================================

UMI info for barcode CATCGGGCAGATTGCT-1 contig 1 = GACTTTCTGA...
umi ATGCTTACTC = 205 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=465]
36-384 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=11)
413-463 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
junction support: 1 umis using 15 reads
cdr3 = CARDLLWFGETRAFDIW at 381, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 36, 80, 398, 444
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.56 = CATCGGGCAGGCGATA-1

using 195 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[191]
surviving nonsolo ucounts = 1[191]
ids = [3]

====================================================================================

UMI info for barcode CATCGGGCAGGCGATA-1 contig 1 = GCTGGCACCA...
umi CTTAGGAACA = 192 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=630]
0-34 ==> 0-34 on |387|IGLV7-46|5'UTR| [len=34] (mis=1)
34-385 ==> 0-351 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=3)
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
419-630 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CLLSYSGAWVF at 358, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 189
start codons at 34, 242, 341
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.59 = CATCGGGCAGTTTACG-1

using 415 reads

====================================================================================

graph has 116 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 167, 243]
surviving nonsolo ucounts = 2[167, 243]
ids = [5, 1]

====================================================================================

UMI info for barcode CATCGGGCAGTTTACG-1 contig 1 = ACCCAAAAAC...
umi ACTGTCTGGG = 238 reads: +436 validated

UMI info for barcode CATCGGGCAGTTTACG-1 contig 2 = ATCAGTCCCA...
umi TGGGACGCGT = 156 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=508]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 54, 252, 257, 274, 318, 351
confident = false

TIG 2[bases=489]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-489 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 155
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.60 = CATCGGGCATACTCTT-1

using 340 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3^2, 333]
surviving nonsolo ucounts = 1[333]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=558]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-378 ==> 0-348 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=0)
384-422 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 30, 99, 352, 464
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.62 = CATCGGGCATCACGTA-1

using 365 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 4[2^3, 349]
surviving nonsolo ucounts = 1[349]
ids = [2]

====================================================================================

UMI info for barcode CATCGGGCATCACGTA-1 contig 1 = GTCAGTCCCA...
umi AGAGCTCAAC = 324 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=448]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
411-448 ==> 0-37 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CHQYESVPYTF at 350, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 320
start codons at 23, 29, 85, 98, 237, 333, 360
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.63 = CATCGGGCATCCCACT-1

using 314 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[314]
surviving nonsolo ucounts = 1[314]
ids = [0]

====================================================================================

UMI info for barcode CATCGGGCATCCCACT-1 contig 1 = GGGGAGGAAC...
umi CATCGCGGGC = 288 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=498]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
418-498 ==> 0-80 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CLQYSDWPRTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.67 = CATCGGGCATTCCTGC-1

using 211 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[14, 195]
surviving nonsolo ucounts = 1[195]
ids = [3]

====================================================================================

UMI info for barcode CATCGGGCATTCCTGC-1 contig 1 = GCTCTGCTTC...
umi CGACATTTGT = 3 reads: -4 +5 -1X +3 -2X +2 -2X +7 -1X +6 -1X +4 -2XX +24 -3X +4 -1X +5 -2X +2 -1 +1 -1X +7 -303 invalidated
umi TTCGTTCGGA = 190 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=554]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-554 ==> 0-109 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0, 3]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.75 = CATCGGGGTATCACCA-1

using 357 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 349]
surviving nonsolo ucounts = 1[349]
ids = [0]

====================================================================================

UMI info for barcode CATCGGGGTATCACCA-1 contig 1 = GAATCAGTCC...
umi ACACGATTCC = 350 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 343
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.80 = CATCGGGGTCTAGAGG-1

using 287 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[287]
surviving nonsolo ucounts = 1[287]
ids = [0]

====================================================================================

UMI info for barcode CATCGGGGTCTAGAGG-1 contig 1 = GCTCTGCTTC...
umi CAGAAAGCAG = 282 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=606]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-606 ==> 0-164 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.101 = CATCGGGTCAACTCTT-1

using 289 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[12, 277]
surviving nonsolo ucounts = 1[277]
ids = [0]

====================================================================================

UMI info for barcode CATCGGGTCAACTCTT-1 contig 1 = GGGAATCAGA...
umi CGAATCACGC = 259 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=481]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=17)
380-418 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=4)
418-481 ==> 0-63 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYRTYPRITF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 27, 33, 89, 102, 238, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.102 = CATCGGGTCAAGATCC-1

using 282 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[277]
surviving nonsolo ucounts = 1[277]
ids = [0]

====================================================================================

UMI info for barcode CATCGGGTCAAGATCC-1 contig 1 = AGACCCAGTC...
umi AGACGGGGCC = 262 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
0-20 ==> 161-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
20-371 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
408-503 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYNSYSWTF at 347, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 20, 26, 82, 95, 327, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.103 = CATCGGGTCAATAAGG-1

using 266 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^2, 3, 5, 252]
surviving nonsolo ucounts = 1[252]
ids = [1]

====================================================================================

UMI info for barcode CATCGGGTCAATAAGG-1 contig 1 = ACTTTCTGAG...
umi CATCCCGTCC = 242 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=550]
0-35 ==> 66-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
35-391 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=23)
402-450 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
450-550 ==> 0-100 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 1 umis using 28 reads
cdr3 = CARRHWGGYYSYW at 380, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 35, 79, 371
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.105 = CATCGGGTCACTTACT-1

using 52 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 8[2^2, 3, 4, 6^2, 7, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.117 = CATCGGGTCCATTCTA-1

using 925 reads

====================================================================================

graph has 1378 edges initially, 4 edges after simplification

total ucounts = 430
nonsolo ucounts = 193[2^78, 3^44, 4^29, 5^11, 6^13, 7^9, 8^4, 9, 10, 11^2, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.118 = CATCGGGTCCCTGACT-1

using 440 reads

====================================================================================

graph has 186 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[436]
surviving nonsolo ucounts = 1[436]
ids = [3]

====================================================================================

UMI info for barcode CATCGGGTCCCTGACT-1 contig 1 = ACTTTCTGAG...
umi CTATCTACTC = 435 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=549]
0-35 ==> 37-72 on |181|IGHV4-31|5'UTR| [len=72] (mis=0)
35-391 ==> 0-356 on |182|IGHV4-31|L-REGION+V-REGION| [len=356] (mis=1)
396-447 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
447-549 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CARGYGGWFDPW at 380, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 428
start codons at 35, 79, 393, 465, 526
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.122 = CATCGGGTCGAACTGT-1

using 49 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2, 3, 9, 10, 11, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.134 = CATCGGGTCTATGTGG-1

using 55 reads

====================================================================================

graph has 60 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2, 4^2, 7, 8, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.147 = CATGACAAGACAATAC-1

using 3057 reads

====================================================================================

graph has 1837 edges initially, 18 edges after simplification

total ucounts = 276
nonsolo ucounts = 143[2^38, 3^36, 4^14, 5^15, 6^12, 7^4, 8^2, 9^3, 11, 12^3, 14^2, 15, 41, 91, 152, 159, 162, 201, 212, 217, 223, 257, 320, 341]
surviving nonsolo ucounts = 10[41, 91, 152, 159, 201, 212, 217, 257, 320, 341]
ids = [35, 266, 235, 93, 184, 21, 263, 103, 241, 114]

====================================================================================

UMI info for barcode CATGACAAGACAATAC-1 contig 1 = AGTCTGGGCC...
umi ACAAGTCCGG = 201 reads: +382 validated
umi CAGCTTTCAA = 161 reads: +210 -1XX +171 invalidated
umi CCCAATTCCG = 260 reads: +382 validated
umi TCCGCGCACT = 140 reads: +382 validated
umi TTCGAACCCC = 91 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=633]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-372 ==> 0-332 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=12)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
422-633 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 5 umis using 125 reads
cdr3 = CQVWDRSSDHWVF at 355, score = 7 + 8
umis assigned: [21, 93, 103, 235, 266]
of which 5 are surviving nonsolos
reads assigned: 835
start codons at 40, 101, 242, 338
confident = true

REJECT CONTIGS

TIG 1[bases=548]
1-82 ==> 5665-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
25-356 ==> 0-331 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=8)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [42, 114, 184, 241, 263]
of which 4 are surviving nonsolos
reads assigned: 1097
start codons at 25, 31, 87, 100, 236, 454
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.150 = CATGACAAGAGTGAGA-1

using 235 reads

====================================================================================

graph has 176 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 226]
surviving nonsolo ucounts = 1[226]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.151 = CATGACAAGATAGCAT-1

using 831 reads

====================================================================================

graph has 1036 edges initially, 16 edges after simplification

total ucounts = 372
nonsolo ucounts = 148[2^55, 3^29, 4^20, 5^11, 6^15, 7^4, 8^3, 9, 10^2, 11^2, 12, 13, 14^3, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.156 = CATGACAAGCACGCCT-1

using 331 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 7[2^2, 5, 7^2, 15, 284]
surviving nonsolo ucounts = 1[284]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=508]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
0-26 ==> 5974-6000 on rc of segment after IGKV1-5 exon 1 [len=6000] (mis=1)
0-26 ==> 5270-5296 on rc of segment before IGKV1-13 exon 2 [len=5296] (mis=1)
0-26 ==> 783-809 on rc of segment before IGKV2-23 exon 2 [len=809] (mis=1)
0-26 ==> 9984-10010 on rc of segment before IGKV2-40 exon 1 [len=10010] (mis=1)
0-26 ==> 787-813 on segment before IGKV1D-22 exon 1 [len=813] (mis=1)
11-83 ==> 8895-8967 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=6)
11-83 ==> 8904-8976 on rc of segment before IGKV2OR2-10 exon 1 [len=9109] (mis=6)
11-83 ==> 8903-8975 on segment before IGKV1OR2-11 exon 1 [len=9108] (mis=6)
26-223 ==> 0-197 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=7)
224-378 ==> 197-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=12) [SHIFT!]
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
412-508 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQSNSYWTF at 354, score = 8 + 8
umis assigned: [1, 2]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 26, 32, 86, 101, 238, 241, 334, 454
confident = false
not full
frameshifted full length stopped transcript of length 508
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.162 = CATGACAAGCGTCAAG-1

using 295 reads

====================================================================================

graph has 104 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2, 3, 4, 7, 11, 266]
surviving nonsolo ucounts = 1[266]
ids = [7]

====================================================================================

UMI info for barcode CATGACAAGCGTCAAG-1 contig 1 = GCTGCTCAGT...
umi TTGCTTCAAG = 247 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=502]
0-28 ==> 24-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
28-376 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
416-502 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQYGSSPRVTF at 352, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 28, 236, 362, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.166 = CATGACAAGGACAGAA-1

using 545 reads

====================================================================================

graph has 212 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[4, 248, 287]
surviving nonsolo ucounts = 2[248, 287]
ids = [8, 4]

====================================================================================

UMI info for barcode CATGACAAGGACAGAA-1 contig 1 = TGAGCGCAGA...
umi TTGCAGTTCC = 241 reads: +388 validated

UMI info for barcode CATGACAAGGACAGAA-1 contig 2 = AGCTCTGGGA...
umi TACCCTGTGC = 274 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=486]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=13)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-486 ==> 0-62 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CGAWDTSLSAWVF at 357, score = 7 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 36, 190, 241, 365
confident = false

TIG 2[bases=531]
0-80 ==> 0-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=2)
460-510 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
510-531 ==> 0-21 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CTRDLSNWGTEDAFDIW at 428, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 80, 133, 231, 236, 303, 360, 389, 462, 491
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.167 = CATGACAAGGACTGGT-1

using 14431 reads

====================================================================================

graph has 5738 edges initially, 56 edges after simplification

total ucounts = 736
nonsolo ucounts = 356[2^115, 3^73, 4^39, 5^32, 6^14, 7^4, 8^9, 9^4, 10^3, 11^2, 13, 14, 19, 20, 31, 46, 50, 52, 58, 85, 87, 102, 111, 119, 128, 142, 144, 156, 161, 177^2, 186, 195, 200, 219, 222, 228, 235, 244, 249, 251, 252, 257, 259^2, 260, 264, 268, 269, 272, 273, 279, 282, 283, 287, 288, 291, 299, 306, 310, 311, 312, 313, 315, 321, 322, 341, 342, 344, 356, 357]
surviving nonsolo ucounts = 52[50, 58, 85, 87, 102, 111, 128, 142, 144, 156, 177^2, 186, 195, 200, 219, 222, 228, 235, 244, 249, 251, 252, 257, 259^2, 260, 264, 268, 269, 272, 273, 279, 282, 283, 287, 288, 291, 299, 306, 310, 311, 312, 313, 315, 321, 322, 341, 342, 344, 356, 357]
ids = [263, 63, 402, 359, 29, 512, 513, 371, 314, 514, ...]

====================================================================================

UMI info for barcode CATGACAAGGACTGGT-1 contig 1 = ATCACATAAC...
umi AAGGGACTCA = 101 reads: +329 -1 +10 -2 +2 -2 +66 -6 non-validated
umi AATTTATGAC = 276 reads: +54 -1XX +363 invalidated
umi ACCCCTTCGC = 244 reads: +418 validated
umi ACCCGATTGC = 61 reads: +305 -1 +75 -37 non-validated
umi ACGCAAAACG = 185 reads: +418 validated
umi ACGCCGCGAC = 268 reads: +418 validated
umi ACTATACTTA = 178 reads: +418 validated
umi AGTTGGGCCA = 220 reads: +418 validated
umi CACCACTCTA = 322 reads: +418 validated
umi CACGATGCTT = 201 reads: +408 -1 +9 non-validated
umi CAGCGGTCTA = 279 reads: +418 validated
umi CCACAGCAGC = 276 reads: +414 -4 non-validated
umi CCATTAGTCC = 224 reads: +418 validated
umi CCTATTCGTC = 48 reads: +418 validated
umi CGGTTACACA = 278 reads: +418 validated
umi CTAATCCTTT = 147 reads: +418 validated
umi CTTATGCTAT = 1 reads: -393 +25 non-validated
umi GACAACCCTT = 322 reads: +418 validated
umi GATAGCTCTA = 86 reads: +382 -1 +35 non-validated
umi GCAGTTGGAA = 178 reads: +415 -1 +2 non-validated
umi GGGCACTGCC = 212 reads: +418 validated
umi GTACCGCGCT = 193 reads: +416 -2 non-validated
umi GTAGTTCCGG = 267 reads: +418 validated
umi GTATGGCTGC = 255 reads: +418 validated
umi GTTTATGATA = 23 reads: +159 -259 non-validated
umi GTTTGTCTAT = 131 reads: +416 -1 +1 non-validated
umi TAAACATCCC = 153 reads: +418 validated
umi TAATCATAGA = 359 reads: +418 validated
umi TCAGCCTCAT = 307 reads: +418 validated
umi TCCCGTTTTG = 340 reads: +418 validated
umi TGTCTCTGCG = 10 reads: -364X +1 -2XX +3 -5XX +1 -5XX +1 -4XX +32 invalidated
umi TTTCGGGGGA = 266 reads: +418 validated

UMI info for barcode CATGACAAGGACTGGT-1 contig 2 = AGGAGTCAGA...
umi ACTTTCGGAG = 248 reads: +391 validated
umi AGACATGCTC = 311 reads: +391 validated
umi CAAGGCAGGT = 253 reads: +391 validated
umi CCATACACAA = 263 reads: +391 validated
umi CGGCATAACC = 256 reads: +391 validated
umi CTTTCACCAT = 142 reads: +391 validated
umi GGGATCGCTA = 257 reads: +391 validated
umi GGGCGCTTGC = 314 reads: +391 validated
umi GGTTGTGTCT = 322 reads: +391 validated
umi GTTGAAATTA = 325 reads: +391 validated
umi TAAACCATAT = 266 reads: +391 validated
umi TAACGGTATA = 306 reads: +391 validated
umi TCACTCTGCA = 219 reads: +391 validated
umi TCCATTACCT = 348 reads: +391 validated
umi TGTCAGAATA = 286 reads: +391 validated
umi TTGAAGTGAG = 266 reads: +391 validated
umi TTTGCGACGG = 251 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=547]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=1)
428-476 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
476-547 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 25 umis using 457 reads
cdr3 = CARVWLERRKIFDYW at 400, score = 9 + 7
umis assigned: [29, 39, 61, 63, 75, 80, 86, 128, 194, 197] and 22 others
of which 32 are surviving nonsolos
reads assigned: 6335
start codons at 58, 209, 256, 355
confident = true

TIG 2[bases=554]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 17 umis using 681 reads
cdr3 = CQQYNSYPMYTF at 354, score = 8 + 8
umis assigned: [95, 98, 186, 244, 293, 371, 450, 453, 468, 507] and 7 others
of which 17 are surviving nonsolos
reads assigned: 4568
start codons at 27, 33, 89, 102, 238, 241, 334, 378, 460
confident = true
now this is a cell
paired!

TCTGAGGACACGGCCGTGTATTACTGTGCGAGAGTCTGGCTGGAACGACGGAAGATCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTACCCCATGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.173 = CATGACAAGTAGCCGA-1

using 379 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 374]
surviving nonsolo ucounts = 1[374]
ids = [0]

====================================================================================

UMI info for barcode CATGACAAGTAGCCGA-1 contig 1 = AGTCCCAACC...
umi GGGCTCCCTG = 373 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 11-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
20-371 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=13)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQHYDNLEYTF at 347, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 368
start codons at 20, 26, 82, 95, 357, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.180 = CATGACACAACACCCG-1

using 121 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 117]
surviving nonsolo ucounts = 1[117]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=448]
39-176 ==> 0-137 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=25)
176-302 ==> 140-266 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=30)
cdr3 = CARGPLVRGIL at 378, score = 8 + 4
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 111
start codons at 39, 83, 348
confident = false
see deletion of 3 bases at pos 137 on |197|IGHV4/OR15-8|L-REGION+V-REGION|
>vscore_25.180_77.1%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGCGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.181 = CATGACACAACGATGG-1

using 271 reads

====================================================================================

graph has 76 edges initially, 10 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 6, 258]
surviving nonsolo ucounts = 2[6, 258]
ids = [1, 7]

====================================================================================

UMI info for barcode CATGACACAACGATGG-1 contig 1 = TCTGGGAGAG...
umi ACACGAAGCC = 1 reads: -261 +3 -1X +13 -3X +3 -1X +3 -1X +1 -1X +20 -1X +5 -101 invalidated
umi TTGAGCCGCA = 255 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=521]
0-77 ==> 3-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=0)
77-432 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=13)
428-445 ==> 0-17 on |9|IGHD1-20|D-REGION| [len=17] (mis=1)
470-495 ==> 24-49 on |52|IGHJ3|J-REGION| [len=49] (mis=0)
495-521 ==> 0-26 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARGITGTTGVFTIW at 419, score = 9 + 8
umis assigned: [1, 7]
of which 2 are surviving nonsolos
reads assigned: 255
start codons at 77, 222, 233, 294, 380, 476
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.189 = CATGACACACACATGT-1

using 311 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[306]
surviving nonsolo ucounts = 1[306]
ids = [3]

====================================================================================

UMI info for barcode CATGACACACACATGT-1 contig 1 = GAGTCAGACT...
umi GAACTATCGT = 301 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=546]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=24)
373-410 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=6)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CHQYNSYSSF at 352, score = 8 + 6
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 25, 31, 87, 100, 236, 239, 332, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.198 = CATGACACACGCTTTC-1

using 321 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 312]
surviving nonsolo ucounts = 1[312]
ids = [0]

====================================================================================

UMI info for barcode CATGACACACGCTTTC-1 contig 1 = GGTGCTTTCT...
umi AGGTTTCCTG = 315 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=573]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=8)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
453-573 ==> 0-120 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 1 umis using 32 reads
cdr3 = CARAHGDYYTLLDYW at 377, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 17, 38, 82, 168, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.201 = CATGACACAGACACTT-1

using 417 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[417]
surviving nonsolo ucounts = 1[417]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.205 = CATGACACAGCTGCTG-1

using 14 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.208 = CATGACACAGGCGATA-1

using 322 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 314]
surviving nonsolo ucounts = 1[314]
ids = [3]

====================================================================================

UMI info for barcode CATGACACAGGCGATA-1 contig 1 = GGAATCAGTC...
umi TCCGCTGCGC = 318 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.212 = CATGACACAGTTTACG-1

using 414 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[199, 210]
surviving nonsolo ucounts = 2[199, 210]
ids = [2, 1]

====================================================================================

UMI info for barcode CATGACACAGTTTACG-1 contig 1 = AGCTTCAGCT...
umi AATCTTCAGG = 204 reads: +388 validated
umi GCTCGACCCT = 196 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-557 ==> 0-122 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 73 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 397
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.219 = CATGACACATGTAAGA-1

using 317 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 308]
surviving nonsolo ucounts = 1[308]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=566]
8-318 ==> 43-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=2)
317-355 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
355-566 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 119, 170, 294
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.239 = CATGACAGTGATGATA-1

using 329 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[324]
surviving nonsolo ucounts = 1[324]
ids = [4]

====================================================================================

UMI info for barcode CATGACAGTGATGATA-1 contig 1 = GAGCTACAAC...
umi TTTCCCTTAA = 322 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CHQYYSLLSF at 369, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 321
start codons at 30, 352, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.241 = CATGACAGTGCAGACA-1

using 313 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 5[2^2, 7, 8, 294]
surviving nonsolo ucounts = 1[294]
ids = [2]

====================================================================================

UMI info for barcode CATGACAGTGCAGACA-1 contig 1 = GGAGTCAGAC...
umi CTGATTTTTG = 294 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYNGQSRAF at 353, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 26, 32, 101, 237, 240, 333, 366, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.242 = CATGACAGTGCGAAAC-1

using 372 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[372]
surviving nonsolo ucounts = 1[372]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.251 = CATGACAGTTCTCATT-1

using 19 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.257 = CATGACAGTTTGTTTC-1

using 883 reads

====================================================================================

graph has 226 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[2^4, 3^2, 863]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.263 = CATGACATCACGATGT-1

using 649 reads

====================================================================================

graph has 248 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[305, 344]
surviving nonsolo ucounts = 2[305, 344]
ids = [0, 1]

====================================================================================

UMI info for barcode CATGACATCACGATGT-1 contig 1 = GAGGAATCAG...
umi CATGACTTGA = 305 reads: +388 validated
umi CGACTCGATT = 344 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 110 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 641
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 25.266 = CATGACATCAGAAATG-1

using 254 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 1[246]
surviving nonsolo ucounts = 1[246]
ids = [7]

====================================================================================

UMI info for barcode CATGACATCAGAAATG-1 contig 1 = GCAGGAGTCA...
umi TTGGCAGGGT = 234 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=496]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=1)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
417-496 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CLQDYNYPRTF at 356, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 29, 35, 91, 104, 186, 240, 459
confident = false
NOT paired!
sorting bam, mem = 0.07
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk025-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk025-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

11.421 seconds used processing barcodes, peak mem = 0.23
