[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.31 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk023-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk023-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk023.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.0 = CAGCTGGGTCACTGGC-1

using 518 reads

====================================================================================

graph has 168 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 190, 320]
surviving nonsolo ucounts = 2[190, 320]
ids = [5, 0]

====================================================================================

UMI info for barcode CAGCTGGGTCACTGGC-1 contig 1 = GAGGCAGAAC...
umi CGATTCGCCA = 320 reads: +382 validated

UMI info for barcode CAGCTGGGTCACTGGC-1 contig 2 = GGAGCCCCAG...
umi TCTAACACAT = 200 reads: +41 -1XX +400 invalidated

GOOD CONTIGS

TIG 1[bases=618]
0-25 ==> 18-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
25-362 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
369-407 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
407-618 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CQSADSSGTHWVF at 340, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 25, 86, 155, 173
confident = false

TIG 2[bases=581]
0-68 ==> 168-236 on |168|IGHV3-74|5'UTR| [len=236] (mis=0)
68-419 ==> 0-351 on |169|IGHV3-74|L-REGION+V-REGION| [len=351] (mis=5)
447-510 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
510-581 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CAVLNYGSGSYEGYYYYYGMDVW at 410, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 68, 224, 285, 371, 426, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.16 = CAGCTGGGTCTTGTCC-1

using 623 reads

====================================================================================

graph has 258 edges initially, 6 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2^2, 3, 278, 330]
surviving nonsolo ucounts = 2[278, 330]
ids = [12, 10]

====================================================================================

UMI info for barcode CAGCTGGGTCTTGTCC-1 contig 1 = GTCAGTCTCA...
umi TTGCATGTGC = 280 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=8)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQSYSTPWTF at 350, score = 8 + 8
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 23, 29, 85, 98, 234, 453
confident = false

REJECT CONTIGS

TIG 1[bases=480]
3-307 ==> 56-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=7)
306-344 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
344-480 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQGTHWPWTF at 283, score = 8 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 8, 16, 104, 266, 286, 386
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.18 = CAGCTGGGTGAGTGAC-1

using 236 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 230]
surviving nonsolo ucounts = 1[230]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.30 = CAGCTGGGTTCCACTC-1

using 16 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 3, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.31 = CAGCTGGGTTCCGGCA-1

using 288 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 7, 9, 265]
surviving nonsolo ucounts = 1[265]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.37 = CAGCTGGGTTGTGGCC-1

using 408 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[404]
surviving nonsolo ucounts = 1[404]
ids = [3]

====================================================================================

UMI info for barcode CAGCTGGGTTGTGGCC-1 contig 1 = TGGGGAGGAA...
umi TGAGCTATCG = 407 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=558]
0-37 ==> 60-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
37-382 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
384-422 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQYNNWPPITF at 358, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 398
start codons at 37, 106, 242, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.52 = CAGCTGGTCAGTTTGG-1

using 25125 reads

====================================================================================

graph has 9888 edges initially, 78 edges after simplification

total ucounts = 1143
nonsolo ucounts = 627[2^154, 3^123, 4^58, 5^37, 6^37, 7^20, 8^21, 9^18, 10^10, 11^10, 12^11, 13^9, 14^6, 15^6, 16^2, 17^5, 19, 21, 22, 31, 36, 47, 52, 53^2, 61, 63, 65, 69, 75, 83, 87, 102, 109, 113, 121, 128, 133, 144, 149, 157, 158, 169, 173, 174^2, 175, 185, 187, 191, 196^2, 199, 202, 205, 215, 216^2, 219, 220^2, 222, 224^2, 225, 227, 237, 238, 239, 240, 241, 243, 248, 249, 250, 252, 254^3, 255, 257, 260, 263, 264, 267, 270, 271^2, 273, 274, 278, 280, 281, 287, 288, 297, 304, 307^2, 313, 315, 319, 323, 326, 331, 333, 343, 345, 355, 366, 369, 380, 425, 430, 442, 600]
surviving nonsolo ucounts = 98[8, 14, 22, 31, 36, 52, 53^2, 61, 63, 65, 69, 75, 83, 87, 102, 109, 113, 121, 128, 133, 144, 149, 157, 158, 169, 174^2, 175, 185, 187, 191, 196^2, 199, 202, 205, 215, 216^2, 219, 220^2, 222, 224^2, 225, 227, 237, 238, 239, 240, 241, 243, 248, 249, 250, 252, 254^3, 255, 257, 260, 263, 264, 267, 270, 271^2, 273, 274, 278, 280, 281, 287, 288, 297, 304, 307^2, 313, 315, 319, 323, 326, 331, 333, 343, 345, 355, 366, 369, 380, 425, 430, 442, 600]
ids = [918, 787, 267, 644, 118, 431, 947, 983, 1130, 315, ...]

====================================================================================

UMI info for barcode CAGCTGGTCAGTTTGG-1 contig 1 = GGAGTCTCCC...
umi AAGCGCCGCG = 128 reads: +430 validated
umi AATACTCGTT = 314 reads: +430 validated
umi AATTCAGCTC = 348 reads: +430 validated
umi ACAATCGGCG = 108 reads: +418 -1 +6 -5 non-validated
umi ACGCGCCACC = 36 reads: +240 -44 +98 -19 +23 -1 +5 non-validated
umi AGGCGGCATG = 239 reads: +430 validated
umi AGGTACGTCA = 326 reads: +430 validated
umi ATCCTATCTT = 75 reads: +411 -3 +1 -15 non-validated
umi ATGTCTCGCG = 23 reads: +255 -27 +62 -86 non-validated
umi CAACTGGCAT = 112 reads: +18 -1X +2 -1 +2 -2X +1 -2X +1 -2X +1 -4X +378 -15 invalidated
umi CAATCGTTAT = 69 reads: +168 -1XX +183 -1 +2 -1 +1 -2 +1 -2 +1 -1 +66 invalidated
umi CACGAAGTCG = 65 reads: +353 -1 +1 -1 +2 -1 +10 -2 +5 -3 +2 -1 +8 -1 +39 non-validated
umi CACTCAATAA = 67 reads: +263 -1 +2 -2 +1 -2 +159 non-validated
umi CATCACATAT = 197 reads: +430 validated
umi CCCAGGAGTG = 300 reads: +430 validated
umi CCGCAGTCTG = 306 reads: +430 validated
umi CGGTAGGCAT = 103 reads: +420 -10 non-validated
umi CGTAACGTCA = 211 reads: +430 validated
umi CTACTGTCGA = 265 reads: +430 validated
umi CTATATGGAT = 243 reads: +421 -9 non-validated
umi GCATGACAAC = 26 reads: +250 -51 +68 -1 +19 -8 +4 -2 +27 non-validated
umi GCCACTTATC = 131 reads: +430 validated
umi GCGACTAGTA = 326 reads: +430 validated
umi GGATCCTCGT = 275 reads: +430 validated
umi GTCATTCATG = 190 reads: +430 validated
umi GTGTGCGTCG = 15 reads: -36 +76 -13 +4 -1 +96 -2X +5 -5X +85 -107 invalidated
umi GTGTGTGCTT = 301 reads: +430 validated
umi GTTTAAAGTA = 269 reads: +430 validated
umi GTTTATGCGA = 307 reads: +430 validated
umi GTTTTTGAGC = 250 reads: +430 validated
umi TAACACTATA = 221 reads: +430 validated
umi TAGCGCTAGG = 149 reads: +430 validated
umi TATATGATCT = 219 reads: +425 -5 non-validated
umi TCAGTTTCGG = 269 reads: +403 -27 non-validated
umi TCCAGTACCG = 8 reads: -49 +7 -2 +5 -1 +7 -2 +63 -1 +7 -1 +11 -1 +33 -1 +72 -17 +56 -94 non-validated
umi TCGGCTGCGC = 53 reads: +426 -4 non-validated
umi TCTTTCAGAG = 357 reads: +430 validated
umi TGCAGCTCCG = 238 reads: +430 validated
umi TGCCCCTCCA = 233 reads: -390 +2 -2X +16 -1XX +1 -1XX +12 -1XX +4 invalidated
umi TGGGTTCGAA = 569 reads: +430 validated
umi TGTAACTTCA = 367 reads: +430 validated
umi TGTAATACCA = 172 reads: +430 validated
umi TTGTATTCTT = 172 reads: +425 -1 +4 non-validated
umi TTTCCCGGTC = 199 reads: +430 validated

UMI info for barcode CAGCTGGTCAGTTTGG-1 contig 2 = AGGAGTCAGA...
umi AATACATACA = 304 reads: +382 validated
umi ATAAATTTAG = 261 reads: +382 validated
umi ATATTTCCCA = 239 reads: +382 validated
umi CATTGATATA = 193 reads: +382 validated
umi CCCACAATGT = 82 reads: +382 validated
umi CCTGTCGACC = 255 reads: +382 validated
umi CTGAACTCGA = 385 reads: +382 validated
umi CTTGTAGTGG = 156 reads: +382 validated
umi GACCTGGCAA = 158 reads: +382 validated
umi GGATTGGAGC = 270 reads: +382 validated
umi GTCGTTCCAC = 279 reads: +382 validated
umi TATTGTGACT = 172 reads: +382 validated
umi TCGTACTTCC = 227 reads: +382 validated
umi TCTGAGATCC = 267 reads: +382 validated
umi TGACACCTTC = 54 reads: +382 validated
umi TGAGTTCATT = 254 reads: +382 validated
umi TGCGGCCTCC = 238 reads: +382 validated
umi TGGATTGCTG = 247 reads: +382 validated
umi TTTACTTGCA = 255 reads: +382 validated
umi TTTACTTTCC = 311 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=560]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=1)
412-433 ==> 0-21 on |33|IGHD6-19|D-REGION| [len=21] (mis=1)
439-489 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
489-560 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 29 umis using 602 reads
cdr3 = CARPGIAVAGNPFDAFDIW at 401, score = 8 + 8
umis assigned: [32, 47, 59, 72, 118, 189, 194, 242, 267, 304] and 34 others
of which 44 are surviving nonsolos
reads assigned: 8708
start codons at 59, 233, 257, 392, 441, 470
confident = true

TIG 2[bases=551]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=3)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 20 umis using 718 reads
cdr3 = CQQYYSYWGTF at 354, score = 9 + 8
umis assigned: [46, 217, 236, 390, 413, 457, 553, 586, 610, 704] and 10 others
of which 20 are surviving nonsolos
reads assigned: 4541
start codons at 33, 89, 102, 238, 457
confident = true

REJECT CONTIGS

TIG 1[bases=632]
0-27 ==> 5785-5812 on segment before IGLV2-34 exon 1 [len=6000] (mis=0)
22-88 ==> 5809-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=3)
41-386 ==> 0-345 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=0)
383-421 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
421-632 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [51, 141, 142, 172, 187, 272, 282, 295, 386, 398] and 15 others
of which 25 are surviving nonsolos
reads assigned: 5079
start codons at 41, 198, 242, 249, 348, 375
confident = false
did not find CDR3

TIG 2[bases=489]
26-298 ==> 2164-2436 on rc of segment before IGHD2-2 exon 1 [len=2436] (mis=0)
324-387 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
387-489 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [104, 149, 492, 668, 765, 792, 872, 902, 956]
of which 9 are surviving nonsolos
reads assigned: 2212
start codons at 53, 59, 100, 344, 405, 466
confident = false
did not find CDR3
now this is a cell
paired!

GCCATGTATTACTGTGCGAGACCGGGTATAGCAGTGGCTGGTAATCCCTTTGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> ATCAGCTGCCTGCAGTCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTTACTGGGGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.60 = CAGCTGGTCCCTGACT-1

using 225 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 4, 6, 208]
surviving nonsolo ucounts = 1[208]
ids = [7]

====================================================================================

UMI info for barcode CAGCTGGTCCCTGACT-1 contig 1 = GGAGAAGAGC...
umi GCTTCGCCCC = 213 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=14)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQHYGSSPGTF at 360, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 36, 244, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.62 = CAGCTGGTCCGAGCCA-1

using 290 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 6[2, 4, 5, 6, 9, 254]
surviving nonsolo ucounts = 1[254]
ids = [13]

====================================================================================

UMI info for barcode CAGCTGGTCCGAGCCA-1 contig 1 = TGGGGGAGTC...
umi TAAACACACC = 260 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
30-383 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQSYSTPLTF at 357, score = 9 + 9
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 30, 36, 92, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.69 = CAGCTGGTCCTTGCCA-1

using 767 reads

====================================================================================

graph has 216 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[5, 8, 24, 725]
surviving nonsolo ucounts = 2[24, 725]
ids = [6, 1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.76 = CAGCTGGTCGCCAGCA-1

using 37 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 3, 6, 20]
surviving nonsolo ucounts = 1[20]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.79 = CAGCTGGTCGTAGATC-1

using 60 reads

====================================================================================

graph has 75 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 5[6, 11^3, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.80 = CAGCTGGTCGTGGGAA-1

using 2630 reads

====================================================================================

graph has 3072 edges initially, 50 edges after simplification

total ucounts = 727
nonsolo ucounts = 395[2^86, 3^63, 4^52, 5^40, 6^35, 7^17, 8^20, 9^20, 10^11, 11^8, 12^14, 13^6, 14^7, 15^6, 16^3, 17^2, 19^2, 22, 29, 57]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.87 = CAGCTGGTCTGAGGGA-1

using 58 reads

====================================================================================

graph has 38 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 8[3^3, 4, 7, 10, 12, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.98 = CAGGTGCAGACCGGAT-1

using 945 reads

====================================================================================

graph has 322 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 304, 639]
surviving nonsolo ucounts = 2[304, 639]
ids = [0, 1]

====================================================================================

UMI info for barcode CAGGTGCAGACCGGAT-1 contig 1 = GGGGAGGAAT...
umi AGCAAGGGGT = 303 reads: +388 validated
umi TATCGATTTA = 640 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 156 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 929
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.118 = CAGGTGCAGGCATTGG-1

using 244 reads

====================================================================================

graph has 121 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 4, 230]
surviving nonsolo ucounts = 1[230]
ids = [0]

====================================================================================

UMI info for barcode CAGGTGCAGGCATTGG-1 contig 1 = AGTCTGGGCC...
umi ACCGGCTTCG = 236 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=639]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-370 ==> 0-330 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=19)
390-428 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
428-639 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQVWDATGDHPSVVF at 355, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 40, 101, 239, 338, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.119 = CAGGTGCAGGCCATAG-1

using 811 reads

====================================================================================

graph has 358 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 13, 216, 573]
surviving nonsolo ucounts = 2[216, 573]
ids = [1, 6]

====================================================================================

UMI info for barcode CAGGTGCAGGCCATAG-1 contig 1 = GCTCTGCTTC...
umi AATTAGCTTC = 210 reads: +394 validated
umi GAACGCCATA = 559 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=554]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-554 ==> 0-109 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 128 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [1, 6]
of which 2 are surviving nonsolos
reads assigned: 754
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.123 = CAGGTGCAGGGTTTCT-1

using 476 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 471]
surviving nonsolo ucounts = 1[471]
ids = [3]

====================================================================================

UMI info for barcode CAGGTGCAGGGTTTCT-1 contig 1 = GAGGAATCAG...
umi CGCATTACTC = 472 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 78 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 466
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.131 = CAGGTGCAGTGCGTGA-1

using 24 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.146 = CAGGTGCCACACCGCA-1

using 258 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 251]
surviving nonsolo ucounts = 1[251]
ids = [0]

====================================================================================

UMI info for barcode CAGGTGCCACACCGCA-1 contig 1 = GAGTGCTTTC...
umi AAGTGAGTCT = 242 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=544]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
406-454 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
454-544 ==> 0-90 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 36 reads
cdr3 = CARYFAFVNYYFDKW at 378, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 18, 39, 83
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.155 = CAGGTGCCAGATAATG-1

using 532 reads

====================================================================================

graph has 292 edges initially, 4 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[137, 395]
surviving nonsolo ucounts = 2[137, 395]
ids = [1, 0]

====================================================================================

UMI info for barcode CAGGTGCCAGATAATG-1 contig 1 = GGAGGAACTG...
umi CACTACCCTC = 394 reads: +382 validated

UMI info for barcode CAGGTGCCAGATAATG-1 contig 2 = GAGAGAGGAG...
umi GTACTCTTCA = 140 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CLQYSDWPRTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 388
start codons at 34, 103, 239, 458
confident = false

TIG 2[bases=538]
0-73 ==> 6-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=32)
440-476 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=1)
476-538 ==> 0-62 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CAKNSGIYAW at 415, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 136
start codons at 73, 139, 229, 376, 437
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.164 = CAGGTGCCAGTTAACC-1

using 417 reads

====================================================================================

graph has 156 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[2, 4, 204, 207]
surviving nonsolo ucounts = 2[204, 207]
ids = [2, 0]

====================================================================================

UMI info for barcode CAGGTGCCAGTTAACC-1 contig 1 = AGCTCTGAGA...
umi ATACTTCCAT = 199 reads: +415 validated

UMI info for barcode CAGGTGCCAGTTAACC-1 contig 2 = GGAGTCAGAC...
umi TCCGCGCTTG = 192 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=529]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-226 ==> 0-147 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=1)
226-423 ==> 156-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=14)
447-494 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
494-529 ==> 0-35 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARDRAATARLGGMDVW at 412, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 79, 226, 373, 451
confident = false
see deletion of 9 bases at pos 147 on |120|IGHV3-21|L-REGION+V-REGION|

TIG 2[bases=478]
0-26 ==> 21-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=10)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-478 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQANSFPLTF at 353, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 26, 32, 88, 101, 240, 258, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.176 = CAGGTGCGTAGCTAAA-1

using 122 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[119]
surviving nonsolo ucounts = 1[119]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.188 = CAGGTGCGTCTCCCTA-1

using 148 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[145]
surviving nonsolo ucounts = 1[145]
ids = [0]

====================================================================================

UMI info for barcode CAGGTGCGTCTCCCTA-1 contig 1 = GGGGAGGAAT...
umi ACTCCTGTAT = 129 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=445]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-445 ==> 0-26 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 128
start codons at 31, 37, 106, 242
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.189 = CAGGTGCGTGATGATA-1

using 217 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 209]
surviving nonsolo ucounts = 1[209]
ids = [3]

====================================================================================

UMI info for barcode CAGGTGCGTGATGATA-1 contig 1 = AGCTCTCAGA...
umi TAGCATGGCA = 204 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=546]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=15)
437-485 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
485-546 ==> 0-61 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARVGPLFDYW at 421, score = 9 + 6
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 202
start codons at 79, 235, 356, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.204 = CAGGTGCTCAACCAAC-1

using 324 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3, 5, 310]
surviving nonsolo ucounts = 1[310]
ids = [5]

====================================================================================

UMI info for barcode CAGGTGCTCAACCAAC-1 contig 1 = AGGAGTCAGA...
umi TCTATGGTGC = 310 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=1)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQANSFPRTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 305
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.205 = CAGGTGCTCAATCTCT-1

using 259 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 31, 220]
surviving nonsolo ucounts = 1[220]
ids = [7]

====================================================================================

UMI info for barcode CAGGTGCTCAATCTCT-1 contig 1 = GGCTTTCTGA...
umi TTTACGTGGG = 213 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=498]
15-386 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
403-451 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
451-498 ==> 0-47 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CARYFAFVNYYFDKW at 375, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 15, 36, 80
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.208 = CAGGTGCTCACGATGT-1

using 411 reads

====================================================================================

graph has 86 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[3^3, 190, 207]
surviving nonsolo ucounts = 2[190, 207]
ids = [3, 2]

====================================================================================

UMI info for barcode CAGGTGCTCACGATGT-1 contig 1 = GAGCTACAAC...
umi ATCAAGGCCC = 202 reads: +400 validated

UMI info for barcode CAGGTGCTCACGATGT-1 contig 2 = AGCTTCAGCT...
umi CACCTACCAA = 173 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
392-430 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYYSTPWTF at 369, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 30, 99, 352, 472
confident = false

TIG 2[bases=520]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
435-520 ==> 0-85 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CAAWDDSLNGWVF at 368, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 173
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.213 = CAGGTGCTCATAAAGG-1

using 66 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 4, 8, 48]
surviving nonsolo ucounts = 2[8, 48]
ids = [1, 5]

====================================================================================

UMI info for barcode CAGGTGCTCATAAAGG-1 contig 1 = GCAGGAGTCA...
umi CAGTCTCTGG = 7 reads: -127 +133 -1 +6 -1 +13 -75 +32 non-validated
umi CGTTTCTGCG = 44 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=499]
29-382 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
417-499 ==> 0-82 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 6 reads
cdr3 = CQQSYTTLLTF at 356, score = 9 + 9
umis assigned: [1, 5]
of which 2 are surviving nonsolos
reads assigned: 51
start codons at 29, 35, 91, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.217 = CAGGTGCTCCAAACAC-1

using 7172 reads

====================================================================================

graph has 5814 edges initially, 64 edges after simplification

total ucounts = 1455
nonsolo ucounts = 605[2^247, 3^136, 4^81, 5^44, 6^31, 7^19, 8^7, 9^6, 10^5, 11^4, 12^2, 13^4, 14, 15^2, 18, 19, 20, 30, 209, 238, 280, 307, 322, 331, 333, 339, 347, 353, 360, 727]
surviving nonsolo ucounts = 12[209, 238, 280, 307, 322, 331, 333, 339, 347, 353, 360, 727]
ids = [429, 249, 556, 60, 452, 854, 378, 623, 1042, 1240, ...]

====================================================================================

UMI info for barcode CAGGTGCTCCAAACAC-1 contig 1 = AGTCCCAGTC...
umi AATATGCGCC = 310 reads: +391 validated
umi AGTAACTCCG = 238 reads: +391 validated
umi ATCGGGAGCT = 363 reads: +391 validated
umi CAAGCCCCCT = 333 reads: +391 validated
umi CAGATACGAT = 212 reads: +391 validated
umi CATCTCCTCA = 325 reads: +391 validated
umi CGATCGTATA = 283 reads: +391 validated
umi CTACCTGACT = 339 reads: +391 validated
umi GCTGCGCTCT = 336 reads: +391 validated
umi TACATCGTTC = 350 reads: +391 validated
umi TATCACATTA = 726 reads: +391 validated
umi TGAGCATAAC = 353 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=547]
0-20 ==> 38-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
20-371 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=8)
373-411 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 12 umis using 706 reads
cdr3 = CQHLNGYPRFTF at 347, score = 9 + 7
umis assigned: [60, 249, 311, 378, 429, 452, 556, 623, 854, 1042] and 2 others
of which 12 are surviving nonsolos
reads assigned: 4089
start codons at 20, 26, 82, 231, 360, 453
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.226 = CAGGTGCTCCCTTGCA-1

using 8703 reads

====================================================================================

graph has 5165 edges initially, 54 edges after simplification

total ucounts = 1001
nonsolo ucounts = 452[2^184, 3^103, 4^62, 5^36, 6^18, 7^8, 8^3, 9^8, 10^2, 11^2, 12^2, 21, 22, 82, 118, 119, 126, 164, 168, 187, 204, 246, 251, 261, 269, 279, 295, 301, 327, 328, 400, 509, 512, 588, 946]
surviving nonsolo ucounts = 24[4, 21, 82, 118, 119, 126, 164, 168, 187, 204, 246, 251, 261, 269, 279, 295, 301, 327, 328, 400, 509, 512, 588, 946]
ids = [186, 23, 75, 311, 419, 851, 582, 834, 165, 856, ...]

====================================================================================

UMI info for barcode CAGGTGCTCCCTTGCA-1 contig 1 = AGCTTCAGCT...
umi ACGCCATCGC = 81 reads: +388 validated
umi AGCACTAACC = 589 reads: -371 +17 non-validated
umi ATCGTACCCC = 191 reads: +388 validated
umi ATGAATGTTC = 286 reads: +388 validated
umi CACCGCTGCT = 267 reads: +388 validated
umi CCAATTCCAT = 247 reads: +388 validated
umi CCATTTGGCT = 118 reads: +388 validated
umi CCCTGAACCG = 954 reads: -220 +168 non-validated
umi CCTGCGTCAC = 293 reads: +388 validated
umi CGGCATAGTA = 119 reads: +388 validated
umi CTTTCACATG = 266 reads: +388 validated
umi GCACTGGTTC = 146 reads: +388 validated
umi GCCATATACT = 507 reads: +388 validated
umi GCGGTAAGGC = 516 reads: +388 validated
umi GGATCAGGCG = 334 reads: +388 validated
umi TATACCGGGT = 301 reads: +388 validated
umi TCAACAGCCC = 396 reads: +388 validated
umi TCTCGATTGT = 144 reads: +388 validated
umi TCTTTTTTGA = 128 reads: +388 validated
umi TGAGTCTGGA = 185 reads: +388 validated

UMI info for barcode CAGGTGCTCCCTTGCA-1 contig 2 = AGCTCTGGGA...
umi AATAACTCAC = 19 reads: +259 -3X +1 -2 +5 -1 +2 -1 +2 -1 +30 -1 +14 -35 +11 -1 +44 -11 invalidated
umi ATGTGGCCTT = 4 reads: -47 +76 -21 +56 -7 +14 -1 +2 -1 +38 -161 non-validated
umi GTGTCTCGGC = 244 reads: +234 -1XX +189 invalidated
umi TTCCGCTCCT = 270 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=645]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
434-645 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 19 umis using 800 reads
cdr3 = CAAWDDSLSGWVF at 367, score = 7 + 8
umis assigned: [75, 115, 165, 174, 239, 289, 311, 330, 379, 419] and 10 others
of which 20 are surviving nonsolos
reads assigned: 5953
start codons at 46, 200, 350, 375, 380
confident = true

TIG 2[bases=536]
0-80 ==> 0-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=3)
80-435 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=27)
456-504 ==> 15-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
504-536 ==> 0-32 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 67 reads
cdr3 = CAKDDAYSSGGDGMDVW at 422, score = 9 + 7
umis assigned: [23, 186, 698, 950]
of which 4 are surviving nonsolos
reads assigned: 512
start codons at 80, 225, 231, 236, 315, 383, 432, 435, 461
confident = true
now this is a cell
paired!

GACACGGCCTTGTATTACTGTGCAAAAGATGATGCCTATAGCAGTGGCGGCGACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> GGGCTCCGGTCCGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAGTGGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.227 = CAGGTGCTCCGCGGTA-1

using 279 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 274]
surviving nonsolo ucounts = 1[274]
ids = [3]

====================================================================================

UMI info for barcode CAGGTGCTCCGCGGTA-1 contig 1 = GGAGTCAGTC...
umi TTGACAACGA = 277 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 26, 32, 88, 101, 237, 336, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.228 = CAGGTGCTCCTATTCA-1

using 335 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 4, 323]
surviving nonsolo ucounts = 1[323]
ids = [6]

====================================================================================

UMI info for barcode CAGGTGCTCCTATTCA-1 contig 1 = GAAGAGCTGC...
umi CTAGCTCCTT = 323 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
383-421 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYGSSPLFTF at 357, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 319
start codons at 33, 241, 367, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.229 = CAGGTGCTCCTCATTA-1

using 301 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 294]
surviving nonsolo ucounts = 1[294]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=663]
4-44 ==> 5960-6000 on segment before IGLVI-70 exon 1 [len=6000] (mis=0)
28-60 ==> 196-228 on segment before IGLV3-31 exon 2 [len=424] (mis=0)
44-60 ==> 0-16 on |367|IGLV3-32|L-REGION+V-REGION| [len=344] (mis=0)
44-68 ==> 0-24 on |353|IGLV3-12|L-REGION+V-REGION| [len=347] (mis=0)
44-69 ==> 0-25 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=1)
90-114 ==> 0-24 on segment before IGLVI-70 exon 2 [len=128] (mis=0)
283-386 ==> 210-313 on |367|IGLV3-32|L-REGION+V-REGION| [len=344] (mis=20)
363-388 ==> 314-339 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=1)
414-452 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
452-663 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
cdr3 = CSTWDYSLSAWVF at 385, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 44, 105, 218, 268, 393
confident = false
not full
frameshifted full length stopped transcript of length 663
VJ delta = -7
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.232 = CAGGTGCTCGAATGCT-1

using 188 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 182]
surviving nonsolo ucounts = 1[182]
ids = [1]

====================================================================================

UMI info for barcode CAGGTGCTCGAATGCT-1 contig 1 = TGAGCGCAGA...
umi ACCACGTTGT = 177 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=535]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=5)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
424-535 ==> 0-111 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CGTWDNSLSAVVF at 357, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 171
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.247 = CAGTAACAGAACTGTA-1

using 658 reads

====================================================================================

graph has 244 edges initially, 8 edges after simplification

total ucounts = 17
nonsolo ucounts = 5[2, 8, 70, 278, 288]
surviving nonsolo ucounts = 3[70, 278, 288]
ids = [8, 0, 7]

====================================================================================

UMI info for barcode CAGTAACAGAACTGTA-1 contig 1 = CCTCCTTGGG...
umi CCTTCACATA = 65 reads: +423 -13 non-validated

GOOD CONTIGS

TIG 1[bases=586]
0-38 ==> 21-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
38-391 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
440-474 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
474-586 ==> 0-112 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 0 umis using 0 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 380, score = 7 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 65
start codons at 38, 236, 241, 258, 302, 335
confident = false

REJECT CONTIGS

TIG 1[bases=497]
3-314 ==> 66-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=27)
337-385 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
385-497 ==> 0-112 on |40|IGHG1|C-REGION| [len=884] (mis=1)
cdr3 = CARRDYYGSERVDFDYW at 303, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 18, 106, 225, 322
confident = false
VJ delta = 8
not full
not full

TIG 2[bases=392]
0-222 ==> 126-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
219-256 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
256-392 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYRSSPTF at 198, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 298
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.276 = CAGTAACAGTGTCCAT-1

using 305 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[8, 294]
surviving nonsolo ucounts = 1[294]
ids = [2]

====================================================================================

UMI info for barcode CAGTAACAGTGTCCAT-1 contig 1 = GCTGGGGTCT...
umi GTGTGTCAGT = 286 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=582]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-394 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
429-582 ==> 0-153 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CSSYTSSSTLVF at 365, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 41, 198, 242, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.282 = CAGTAACCAACACCCG-1

using 127 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[125]
surviving nonsolo ucounts = 1[125]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.291 = CAGTAACCACATTTCT-1

using 341 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 16, 321]
surviving nonsolo ucounts = 1[321]
ids = [4]

====================================================================================

UMI info for barcode CAGTAACCACATTTCT-1 contig 1 = TGATCAGGAC...
umi TCGACACGAT = 321 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=564]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
390-428 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CMQALQTPFTF at 367, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 317
start codons at 31, 64, 100, 188, 350, 370, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.292 = CAGTAACCACCCAGTG-1

using 139 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 3^2, 130]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.293 = CAGTAACCACTCAGGC-1

using 413 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[5, 7, 399]
surviving nonsolo ucounts = 1[399]
ids = [4]

====================================================================================

UMI info for barcode CAGTAACCACTCAGGC-1 contig 1 = AGAGCTCTGG...
umi TATATAGTCA = 402 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=568]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=10)
393-432 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYDGWPFMYTF at 365, score = 10 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 391
start codons at 44, 113, 249, 375, 378, 392, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.299 = CAGTAACCAGCATGAG-1

using 595 reads

====================================================================================

graph has 218 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[278, 314]
surviving nonsolo ucounts = 2[278, 314]
ids = [0, 4]

====================================================================================

UMI info for barcode CAGTAACCAGCATGAG-1 contig 1 = AAGAGCTGCT...
umi AACGATCGAC = 278 reads: +385 validated

UMI info for barcode CAGTAACCAGCATGAG-1 contig 2 = GTCAGTCCCA...
umi TTCGGACAAT = 313 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-32 ==> 20-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
32-380 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYGSSPKTF at 356, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 32, 240, 366, 459
confident = false

TIG 2[bases=547]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=36)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=8)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQRYDNLPYVF at 350, score = 9 + 6
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 23, 29, 85, 237, 360, 404, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.305 = CAGTAACCAGGATCGA-1

using 365 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 3, 354]
surviving nonsolo ucounts = 1[354]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.308 = CAGTAACCAGTGGGAT-1

using 165 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 161]
surviving nonsolo ucounts = 1[161]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.311 = CAGTAACCATCCTAGA-1

using 76 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3^2, 66]
surviving nonsolo ucounts = 1[66]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.314 = CAGTAACCATGAGCGA-1

using 19 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.315 = CAGTAACCATGGGAAC-1

using 297 reads

====================================================================================

graph has 176 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 289]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode CAGTAACCATGGGAAC-1 contig 1 = GGGATCAGGA...
umi TCGGACAATC = 286 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=530]
32-397 ==> 0-365 on |734|IGKV2D-40|L-REGION+V-REGION| [len=365] (mis=0)
394-432 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
432-530 ==> 0-98 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CMQRIEFPSTF at 371, score = 9 + 8
umis assigned: [5]
of which 0 are surviving nonsolos
reads assigned: 275
start codons at 32, 65, 101, 189, 192, 354, 374, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.317 = CAGTAACCATGTCGAT-1

using 699 reads

====================================================================================

graph has 214 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 12, 679]
surviving nonsolo ucounts = 1[679]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=437]
5-70 ==> 5927-5992 on segment before IGLV2-5 exon 1 [len=6137] (mis=0)
43-177 ==> 0-134 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=7)
188-226 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=7)
226-437 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 670
start codons at 43
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.327 = CAGTAACGTCCAGTTA-1

using 260 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^3, 3, 248]
surviving nonsolo ucounts = 1[248]
ids = [0]

====================================================================================

UMI info for barcode CAGTAACGTCCAGTTA-1 contig 1 = GTCAGACTCA...
umi AAAATTCCCT = 239 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=486]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
411-486 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYNGQSRAF at 350, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 23, 29, 98, 234, 237, 330, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.343 = CAGTAACGTTCCTCCA-1

using 492 reads

====================================================================================

graph has 208 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 235, 253]
surviving nonsolo ucounts = 2[235, 253]
ids = [2, 3]

====================================================================================

UMI info for barcode CAGTAACGTTCCTCCA-1 contig 1 = GCCTCAGGAA...
umi CTAATGAGTA = 248 reads: +382 validated

UMI info for barcode CAGTAACGTTCCTCCA-1 contig 2 = ATCATCCAAC...
umi CAAGCAAATG = 231 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=556]
0-33 ==> 19-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
33-372 ==> 0-339 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=21)
377-415 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
415-556 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQAWGSSTLNVVF at 348, score = 6 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 33, 38, 94, 222, 232, 238, 327, 331, 376
confident = false

TIG 2[bases=503]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=29)
404-431 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=6)
432-482 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
482-503 ==> 0-21 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARIMVRGVIMAPFDIW at 400, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 58, 145, 256, 322, 355, 385, 412, 430
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.344 = CAGTAACGTTCGGGCT-1

using 352 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[348]
surviving nonsolo ucounts = 1[348]
ids = [3]

====================================================================================

UMI info for barcode CAGTAACGTTCGGGCT-1 contig 1 = GATCAGGACT...
umi TCTAAAGCTC = 353 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=560]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=11)
386-424 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CMQALQALTF at 366, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 345
start codons at 30, 63, 99, 187, 349, 369, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.347 = CAGTAACGTTTGGGCC-1

using 456 reads

====================================================================================

graph has 152 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[114, 340]
surviving nonsolo ucounts = 2[114, 340]
ids = [3, 1]

====================================================================================

UMI info for barcode CAGTAACGTTTGGGCC-1 contig 1 = GACTCCTGTG...
umi TGATCGGTTT = 114 reads: +433 validated

UMI info for barcode CAGTAACGTTTGGGCC-1 contig 2 = GGGAGTCTCA...
umi CGACAACACT = 325 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=469]
17-367 ==> 0-350 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=23)
398-450 ==> 0-52 on |49|IGHJ1|J-REGION| [len=52] (mis=4)
450-469 ==> 0-19 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CAGPWSSGFFATAEYFPHW at 362, score = 8 + 6
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 112
start codons at 17, 61, 240, 323
confident = false

TIG 2[bases=507]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
411-507 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQSYTTLLTF at 350, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 319
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.358 = CAGTAACTCAGTGCAT-1

using 942 reads

====================================================================================

graph has 1492 edges initially, 2 edges after simplification

total ucounts = 432
nonsolo ucounts = 204[2^80, 3^45, 4^32, 5^23, 6^9, 7^7, 8^6, 11, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.361 = CAGTAACTCATAGCAC-1

using 1806 reads

====================================================================================

graph has 2660 edges initially, 28 edges after simplification

total ucounts = 752
nonsolo ucounts = 367[2^139, 3^92, 4^40, 5^29, 6^22, 7^10, 8^10, 9^10, 10^3, 11^6, 12, 13^2, 14, 17, 25]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.367 = CAGTAACTCCCGGATG-1

using 263 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[263]
surviving nonsolo ucounts = 1[263]
ids = [0]

====================================================================================

UMI info for barcode CAGTAACTCCCGGATG-1 contig 1 = GGAGGAACTG...
umi CCCTTCTTTA = 264 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=549]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQRSNWITF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 34, 239, 242, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.369 = CAGTAACTCCGCATAA-1

using 257 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 253]
surviving nonsolo ucounts = 1[253]
ids = [2]

====================================================================================

UMI info for barcode CAGTAACTCCGCATAA-1 contig 1 = GGGATCACAC...
umi TGGACTCGGG = 255 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=590]
0-60 ==> 0-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=3)
60-413 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=22)
432-478 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=8)
478-590 ==> 0-112 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 39 reads
cdr3 = CLTENSDFWSGFPYW at 402, score = 10 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 60, 221, 258, 324, 357
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.370 = CAGTAACTCCTAGAAC-1

using 7880 reads

====================================================================================

graph has 3976 edges initially, 72 edges after simplification

total ucounts = 481
nonsolo ucounts = 241[2^61, 3^50, 4^42, 5^27, 6^8, 7^14, 8^7, 9^2, 10^2, 11^3, 17, 22, 94, 103, 206, 217, 219, 233, 238, 283, 285, 298, 307^2, 315, 323, 329, 330, 339, 347, 349, 364, 367, 376, 524]
surviving nonsolo ucounts = 22[103, 206, 217, 219, 233, 238, 283, 285, 298, 307^2, 315, 323, 329, 330, 339, 347, 349, 364, 367, 376, 524]
ids = [54, 467, 1, 298, 456, 200, 400, 360, 26, 56, ...]

====================================================================================

UMI info for barcode CAGTAACTCCTAGAAC-1 contig 1 = TGGGGACTCA...
umi AAAATAATCC = 219 reads: +436 validated
umi ACATCTCACT = 298 reads: +436 validated
umi ACCATTCGGC = 321 reads: +436 validated
umi ACTTGTACTA = 99 reads: +351 -44 +26 -1 +14 non-validated
umi ATGCTACGGT = 325 reads: +436 validated
umi ATGGCCCCTT = 366 reads: +436 validated
umi CGGTACAGTC = 240 reads: +436 validated
umi GGCGCTAGTC = 223 reads: +436 validated
umi TAACTGTGCC = 364 reads: +436 validated
umi TATTGTCATC = 285 reads: +436 validated
umi TCTATTACTA = 282 reads: +436 validated
umi TTCGCGTTCC = 219 reads: +436 validated
umi TTTCAATCCC = 196 reads: +436 validated

UMI info for barcode CAGTAACTCCTAGAAC-1 contig 2 = AGTCCCAACC...
umi AACTCCATCA = 315 reads: +388 validated
umi ACATTTGATC = 351 reads: +388 validated
umi CACCTTGCAA = 347 reads: +388 validated
umi TCAATACCCT = 338 reads: +388 validated
umi TTTCCTTCAC = 365 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=567]
60-413 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=3)
433-496 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
496-567 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 10 umis using 188 reads
cdr3 = CARTSNWNDVGHYYYYGMDVW at 402, score = 9 + 7
umis assigned: [1, 26, 34, 54, 96, 97, 200, 298, 324, 360] and 3 others
of which 13 are surviving nonsolos
reads assigned: 3383
start codons at 60, 211, 258, 263, 267, 295, 324, 357, 453
confident = true

TIG 2[bases=544]
0-20 ==> 11-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
20-371 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 5 umis using 266 reads
cdr3 = CQQYDNLPITF at 347, score = 9 + 8
umis assigned: [11, 31, 128, 366, 470]
of which 5 are surviving nonsolos
reads assigned: 1689
start codons at 20, 26, 82, 95, 234, 357, 450
confident = true

REJECT CONTIGS

TIG 1[bases=310]
19-189 ==> 1241-1411 on rc of segment before IGHD5-18 exon 1 [len=1822] (mis=2)
193-239 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
239-310 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [77]
of which 1 are surviving nonsolos
reads assigned: 495
start codons at 41, 147
confident = false
did not find CDR3
now this is a cell
paired!

TATTACTGTGCGAGGACAAGTAACTGGAACGACGTAGGTCACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCCGATCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.377 = CAGTAACTCGGAATCT-1

using 207 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 200]
surviving nonsolo ucounts = 1[200]
ids = [3]

====================================================================================

UMI info for barcode CAGTAACTCGGAATCT-1 contig 1 = GGCTGGGGTC...
umi CCAATTCGTA = 198 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=585]
42-403 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=8)
399-427 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
427-585 ==> 0-158 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CSSYTSSSTLF at 366, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 42, 199, 243, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.378 = CAGTAACTCGGCATCG-1

using 234 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[232]
surviving nonsolo ucounts = 1[232]
ids = [2]

====================================================================================

UMI info for barcode CAGTAACTCGGCATCG-1 contig 1 = CTCTCCAGCA...
umi TGGAAAGGCA = 223 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=482]
0-83 ==> 168-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
83-434 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=5)
433-471 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQVWDSSSDHLHVVF at 398, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 83, 144, 282, 285, 381, 432
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.380 = CAGTAACTCGTGGACC-1

using 285 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 3, 276]
surviving nonsolo ucounts = 1[276]
ids = [4]

====================================================================================

UMI info for barcode CAGTAACTCGTGGACC-1 contig 1 = AATTAGGACT...
umi GCCGGAATGC = 264 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=462]
0-30 ==> 0-30 on |262|IGKV2-24|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |263|IGKV2-24|L-REGION+V-REGION| [len=360] (mis=7)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
427-462 ==> 0-35 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CMQATQIPWTF at 366, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 30, 63, 99, 187, 349, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.384 = CAGTAACTCTCCCTGA-1

using 23 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.390 = CAGTAACTCTGCGGCA-1

using 169 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[169]
surviving nonsolo ucounts = 1[169]
ids = [0]

====================================================================================

UMI info for barcode CAGTAACTCTGCGGCA-1 contig 1 = TGAGCGCAGA...
umi CCGTATGGTT = 164 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=474]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=6)
386-424 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
424-474 ==> 0-50 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 23 reads
cdr3 = CGTWDSSLSAYVF at 357, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 161
start codons at 36, 190, 241, 365, 388
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.391 = CAGTAACTCTGCTTGC-1

using 9037 reads

====================================================================================

graph has 4144 edges initially, 30 edges after simplification

total ucounts = 590
nonsolo ucounts = 287[2^104, 3^54, 4^40, 5^25, 6^9, 7^8, 8^3, 9^4, 10^3, 11^2, 12, 15, 19, 34, 96, 110, 132, 133, 152, 155, 166, 168, 183, 188, 190, 210, 211, 219, 223, 226, 238, 264, 267, 275, 288, 310, 319, 325, 338, 341, 370, 379, 386, 404, 511]
surviving nonsolo ucounts = 27[34, 96, 110, 152, 168, 188, 190, 210, 211, 219, 223, 226, 238, 264, 267, 275, 288, 310, 319, 325, 338, 341, 370, 379, 386, 404, 511]
ids = [538, 322, 411, 478, 458, 136, 341, 472, 188, 359, ...]

====================================================================================

UMI info for barcode CAGTAACTCTGCTTGC-1 contig 1 = GAGCTACAAC...
umi AAACCTTGCT = 325 reads: +400 validated
umi AAGGCACTTC = 253 reads: +400 validated
umi AATATTTGTC = 406 reads: +400 validated
umi ACGCATGTCC = 229 reads: +400 validated
umi ACGTAGTCAC = 321 reads: +400 validated
umi ATGGCTGTAA = 192 reads: +400 validated
umi CTAACTTACA = 224 reads: +400 validated
umi CTAATTCCCG = 289 reads: +400 validated
umi CTCCATCCGG = 379 reads: +400 validated
umi GCCAGTGGGT = 96 reads: +400 validated
umi GGAAATCTGC = 187 reads: +400 validated
umi GGACTCCTCA = 240 reads: +400 validated
umi GGGATTCCTT = 220 reads: +400 validated
umi TAACTCGGGT = 311 reads: +400 validated
umi TAATACCTCT = 111 reads: +400 validated
umi TCACGTCTAT = 339 reads: +400 validated
umi TCATAGTCCT = 168 reads: +400 validated
umi TCCTACCACT = 212 reads: +400 validated
umi TCGACTGCTT = 150 reads: +400 validated
umi TGCAAAATCA = 373 reads: +400 validated
umi TTCAGTCGGT = 341 reads: +400 validated

UMI info for barcode CAGTAACTCTGCTTGC-1 contig 2 = GAGAGTCCTG...
umi AACAGCTATT = 483 reads: -354X +1 -7XX +1 -4XX +1 -2XX +2 -7XX +1 -2XX +1 -1XX +3 -2XX +35 invalidated
umi CATAGATGCC = 262 reads: +424 validated
umi CATGTACCGC = 169 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
393-430 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 21 umis using 735 reads
cdr3 = CQQYYSTPLTF at 369, score = 9 + 9
umis assigned: [6, 31, 36, 68, 74, 136, 248, 252, 262, 322] and 11 others
of which 21 are surviving nonsolos
reads assigned: 5277
start codons at 30, 99, 352, 472
confident = true

TIG 2[bases=554]
0-28 ==> 73-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
28-384 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=13)
406-452 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
452-554 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 2 umis using 40 reads
cdr3 = CARVTAGYGSGRVDYW at 373, score = 9 + 7
umis assigned: [16, 179, 188]
of which 3 are surviving nonsolos
reads assigned: 912
start codons at 28, 72, 395, 470, 531
confident = true
now this is a cell
paired!

GCAGACACGGCCGTGTATTACTGTGCGAGAGTTACTGCGGGCTATGGTTCGGGGAGAGTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACCCCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.392 = CAGTAACTCTTCTGGC-1

using 274 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2^2, 3, 4, 256]
surviving nonsolo ucounts = 1[256]
ids = [3]

====================================================================================

UMI info for barcode CAGTAACTCTTCTGGC-1 contig 1 = GAGTCAGACT...
umi ATAACCACCT = 257 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYNGQSRAF at 352, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 25, 31, 100, 236, 239, 332, 365, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.396 = CAGTCCTAGAATTGTG-1

using 343 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 3, 7, 325]
surviving nonsolo ucounts = 1[325]
ids = [4]

====================================================================================

UMI info for barcode CAGTCCTAGAATTGTG-1 contig 1 = GATCAGGACT...
umi CCTTCCCTTA = 307 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=487]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
427-487 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CMQALQTPQTF at 366, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.398 = CAGTCCTAGACCGGAT-1

using 751 reads

====================================================================================

graph has 294 edges initially, 42 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 5, 7, 249, 484]
surviving nonsolo ucounts = 2[249, 484]
ids = [3, 8]

====================================================================================

UMI info for barcode CAGTCCTAGACCGGAT-1 contig 1 = GGGGTCACAA...
umi TTACAGTCCT = 483 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=643]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=0)
394-432 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
432-643 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CCSYAGSSTPHWVF at 362, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 480
start codons at 38, 177, 239, 246, 372
confident = false

REJECT CONTIGS

TIG 1[bases=644]
0-69 ==> 5923-5992 on segment before IGLV2-5 exon 1 [len=6137] (mis=0)
42-378 ==> 0-336 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=25)
375-396 ==> 0-21 on segment before IGLV3-4 exon 1 [len=986] (mis=0)
395-433 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
433-644 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 42, 181, 193, 199, 243, 253, 321
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.408 = CAGTCCTAGCATCATC-1

using 56 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[56]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.409 = CAGTCCTAGCCAGAAC-1

using 354 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 349]
surviving nonsolo ucounts = 1[349]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=420]
0-247 ==> 104-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=1)
246-284 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
284-420 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQDYNYPRTF at 223, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 304
start codons at 53, 107, 326
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.411 = CAGTCCTAGCGTGAAC-1

using 365 reads

====================================================================================

graph has 155 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 4, 5, 12, 338]
surviving nonsolo ucounts = 1[338]
ids = [0]

====================================================================================

UMI info for barcode CAGTCCTAGCGTGAAC-1 contig 1 = GAAGAGCTGC...
umi AAATGGCGCG = 337 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQQCGSSPGTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 33, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.412 = CAGTCCTAGCGTTGCC-1

using 804 reads

====================================================================================

graph has 368 edges initially, 4 edges after simplification

total ucounts = 195
nonsolo ucounts = 159[2^34, 3^36, 4^17, 5^16, 6^20, 7^9, 8^11, 9^5, 10^4, 11^3, 12, 14^2, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.414 = CAGTCCTAGCTAAGAT-1

using 1179 reads

====================================================================================

graph has 1430 edges initially, 8 edges after simplification

total ucounts = 451
nonsolo ucounts = 217[2^97, 3^50, 4^19, 5^20, 6^12, 7^13, 8^2, 9, 11, 14, 212]
surviving nonsolo ucounts = 1[212]
ids = [409]

====================================================================================

UMI info for barcode CAGTCCTAGCTAAGAT-1 contig 1 = AGCTTCAGCT...
umi TGTTTCCCGC = 208 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=520]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
396-434 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
434-520 ==> 0-86 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CAAWDDSLSGVVF at 367, score = 7 + 8
umis assigned: [409]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.419 = CAGTCCTAGGACAGCT-1

using 276 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 3, 264]
surviving nonsolo ucounts = 1[264]
ids = [5]

====================================================================================

UMI info for barcode CAGTCCTAGGACAGCT-1 contig 1 = AGCTTCAGCT...
umi TCCTAGTGCC = 231 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=483]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-483 ==> 0-48 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.423 = CAGTCCTAGGCCATAG-1

using 855 reads

====================================================================================

graph has 196 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 849]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.437 = CAGTCCTAGTCTCGGC-1

using 1231 reads

====================================================================================

graph has 1152 edges initially, 28 edges after simplification

total ucounts = 386
nonsolo ucounts = 147[2^60, 3^36, 4^19, 5^10, 6^8, 7^5, 8, 9^2, 11, 13, 16, 124, 171, 194]
surviving nonsolo ucounts = 2[171, 194]
ids = [161, 131]

====================================================================================

UMI info for barcode CAGTCCTAGTCTCGGC-1 contig 1 = CATAACAACC...
umi CCAAAGGCTT = 71 reads: +17 -2XX +4 -1XX +2 -2XX +11 -1XX +1 -1XX +4 -1XX +2 -1XX +3 -1XX +7 -2XX +3 -1XX +13 -2XX +20 -1XX +4 -1XX +5 -1XX +2 -1XX +11 -1XX +1 -1XX +3 -2XX +9 -2XX +1 -2XX +1 -1XX +4 -1XX +2 -1XX +1 -1XX +26 -1XX +15 -2XX +1 -1XX +1 -2XX +1 -2XX +2 -2XX +1 -2XX +1 -214 invalidated
umi CGTTCCGCCT = 172 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=524]
0-54 ==> 7-61 on |82|IGHV1-69|5'UTR| [len=61] (mis=0)
54-405 ==> 0-351 on |83|IGHV1-69|L-REGION+V-REGION| [len=351] (mis=40)
442-490 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
490-524 ==> 0-34 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CVTVPLGGSSLWDPPPYFDSW at 396, score = 8 + 7
umis assigned: [131, 161]
of which 2 are surviving nonsolos
reads assigned: 239
start codons at 54, 205, 252
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.441 = CAGTCCTAGTGGAGTC-1

using 167 reads

====================================================================================

graph has 58 edges initially, 4 edges after simplification

total ucounts = 17
nonsolo ucounts = 9[2, 3^4, 4^2, 11, 126]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode CAGTCCTAGTGGAGTC-1 contig 1 = GACCTCCTGT...
umi GTAGGGCCTG = 120 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=486]
18-366 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=11)
395-445 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
445-486 ==> 0-41 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARDLLWFGETRAFDIW at 363, score = 9 + 8
umis assigned: [11]
of which 0 are surviving nonsolos
reads assigned: 118
start codons at 18, 62, 380, 426
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.451 = CAGTCCTCACACCGCA-1

using 67 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[67]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.453 = CAGTCCTCACATAACC-1

using 270 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[270]
surviving nonsolo ucounts = 1[270]
ids = [0]

====================================================================================

UMI info for barcode CAGTCCTCACATAACC-1 contig 1 = GAGTCAGTCC...
umi CAATATTATC = 268 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 33-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
25-376 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=15)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQLNAYPLTF at 352, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 25, 31, 87, 236, 365, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.462 = CAGTCCTCACGAGAGT-1

using 1000 reads

====================================================================================

graph has 384 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 991]
surviving nonsolo ucounts = 1[991]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=317]
3-68 ==> 291-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=3)
68-106 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
106-317 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 36, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 980
start codons at 19, 46, 70, 238
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.469 = CAGTCCTCAGAGCCAA-1

using 43 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[43]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.473 = CAGTCCTCAGCTGCTG-1

using 225 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 4, 213]
surviving nonsolo ucounts = 1[213]
ids = [4]

====================================================================================

UMI info for barcode CAGTCCTCAGCTGCTG-1 contig 1 = GGAGGAACTG...
umi GTCAGTTCAT = 185 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=472]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
419-472 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQYNNWPPWTF at 355, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 182
start codons at 34, 103, 239, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.481 = CAGTCCTCAGTGGGAT-1

using 2213 reads

====================================================================================

graph has 2748 edges initially, 28 edges after simplification

total ucounts = 813
nonsolo ucounts = 385[2^144, 3^85, 4^51, 5^41, 6^17, 7^11, 8^11, 9^10, 10^3, 11^3, 12^2, 13^2, 15^2, 18, 37, 278]
surviving nonsolo ucounts = 1[278]
ids = [641]

====================================================================================

UMI info for barcode CAGTCCTCAGTGGGAT-1 contig 1 = TGAGCGCAGA...
umi TCATATGGGG = 273 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=564]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=1)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
424-564 ==> 0-140 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CGTWDSSLSAWVF at 357, score = 7 + 8
umis assigned: [641]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.492 = CAGTCCTCATGGTTGT-1

using 304 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^2, 3, 4^2, 283]
surviving nonsolo ucounts = 1[283]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=555]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-34 ==> 5703-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
381-419 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 33, 241, 367, 461
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.494 = CAGTCCTCATGTCCTC-1

using 52304 reads

====================================================================================

graph has 17997 edges initially, 136 edges after simplification

total ucounts = 3363
nonsolo ucounts = 1643[2^665, 3^340, 4^188, 5^123, 6^48, 7^29, 8^21, 9^13, 10^10, 11^12, 12^3, 13^5, 14^3, 15^2, 16^3, 18^2, 22, 23^2, 24, 25, 26^2, 28, 29, 30, 32, 34, 37, 38, 39, 40^2, 42, 50, 67, 73, 79, 91, 92, 108, 116, 117^2, 119, 121, 139, 144^2, 146, 149, 159^2, 161, 167, 170, 174, 185^3, 195, 198, 203, 204, 216^2, 219, 231, 233, 236, 248^2, 250, 253, 254, 255, 257^2, 258, 260, 263, 264, 265^2, 268, 269, 270^2, 271, 272, 276, 279^2, 283^2, 284^2, 285, 286^2, 287, 290, 291^3, 294, 295, 296, 297, 298^3, 299^3, 300, 301^2, 304, 305, 306^2, 307^3, 310, 311^2, 312^2, 314, 315^2, 317, 318, 319^2, 323^2, 324, 329, 330^2, 332, 333^2, 337^2, 338^2, 339, 341, 342, 346, 348, 349, 351, 352, 353, 354^2, 357^2, 359, 360, 361^3, 362, 363, 364, 366^3, 367^3, 370^2, 373, 380, 382^2, 392, 394, 395, 400, 404, 410, 448, 503, 649]
surviving nonsolo ucounts = 166[2, 8, 22, 23, 26, 28, 30, 32, 34, 37, 38, 39, 40, 42, 79, 92, 108, 117, 119, 121, 139, 144^2, 146, 149, 159^2, 161, 167, 170, 174, 185^3, 195, 198, 203, 204, 216^2, 219, 231, 233, 236, 248^2, 250, 253, 254, 255, 257^2, 258, 260, 263, 264, 265^2, 268, 269, 270^2, 271, 272, 276, 279^2, 283^2, 284^2, 285, 286^2, 287, 290, 291^3, 294, 295, 296, 297, 298^3, 299^3, 300, 301^2, 304, 305, 306^2, 307^3, 310, 311^2, 312^2, 314, 315^2, 317, 318, 319^2, 323^2, 324, 329, 330^2, 332, 333^2, 337^2, 338^2, 339, 341, 342, 346, 348, 349, 351, 352, 353, 354^2, 357^2, 359, 360, 361^3, 362, 363, 364, 366^3, 367^3, 370^2, 373, 380, 382^2, 392, 394, 395, 400, 404, 410, 448, 503, 649]
ids = [2925, 1437, 271, 2634, 3256, 943, 249, 2779, 1214, 60, ...]

====================================================================================

UMI info for barcode CAGTCCTCATGTCCTC-1 contig 1 = GGGGAGGAGT...
umi AAAGGTCCTT = 350 reads: +388 validated
umi AAATGCCGGT = 314 reads: -8X +1 -1X +378 invalidated
umi AACAACTCCC = 260 reads: +388 validated
umi AACAGCGCGA = 331 reads: +388 validated
umi AACCAACTGC = 632 reads: -116X +1 -1XX +1 -2XX +1 -5XX +1 -4XX +3 -3XX +1 -4XX +245 invalidated
umi AACCCTCTTA = 297 reads: +388 validated
umi AACCCTGCTT = 304 reads: +388 validated
umi AACGACAACC = 323 reads: +388 validated
umi AACTGTGTCG = 287 reads: +388 validated
umi AATTCCTCCA = 185 reads: +388 validated
umi ACCACATCAC = 322 reads: +388 validated
umi ACCCCCGGGG = 327 reads: +388 validated
umi ACCTCTTACA = 280 reads: +388 validated
umi ACCTGCTTCA = 235 reads: +388 validated
umi ACGACAGGGC = 217 reads: +388 validated
umi ACGCAATGTG = 270 reads: +388 validated
umi ACTCCTCACG = 286 reads: +388 validated
umi ACTTAAGCTG = 371 reads: +388 validated
umi AGACTAACAG = 176 reads: +388 validated
umi AGAGCAGGAT = 290 reads: +388 validated
umi AGCATCCACG = 300 reads: +388 validated
umi AGCCAATTCC = 366 reads: +388 validated
umi AGCTCGCTTT = 135 reads: +388 validated
umi ATACGCTACT = 339 reads: +388 validated
umi ATCAGTATCG = 365 reads: +388 validated
umi ATCCAGCCAG = 314 reads: +388 validated
umi ATCCGATTAC = 369 reads: +388 validated
umi ATCCTCCCGC = 265 reads: +388 validated
umi ATCTGCCCCC = 302 reads: +388 validated
umi ATGTGGCATT = 302 reads: +388 validated
umi ATGTTCGTAC = 310 reads: +388 validated
umi ATTCATTCAT = 228 reads: +388 validated
umi CAACTCCCCA = 283 reads: +388 validated
umi CAATTGCGGG = 253 reads: +388 validated
umi CACCACCAAT = 212 reads: +388 validated
umi CACCTCCACT = 155 reads: -198X +1 -2X +2 -9X +1 -2XX +3 -1X +5 -1XX +5 -1XX +157 invalidated
umi CACGTTATGG = 289 reads: +388 validated
umi CACGTTCGGT = 274 reads: +388 validated
umi CACTCAGGAT = 366 reads: +388 validated
umi CAGGCCGGGG = 123 reads: +388 validated
umi CATAACCGTC = 297 reads: +388 validated
umi CATCAGTTTG = 266 reads: +388 validated
umi CATCCTCTGC = 179 reads: +388 validated
umi CATCTGGCGC = 308 reads: +388 validated
umi CATCTTTCGA = 269 reads: +388 validated
umi CATTTTCGAC = 332 reads: +388 validated
umi CCACCTTATA = 282 reads: +388 validated
umi CCCGGGGAGG = 355 reads: +388 validated
umi CCCTTCCTTC = 249 reads: +388 validated
umi CCGAGTTATC = 362 reads: +388 validated
umi CCGGGGTGCT = 267 reads: +388 validated
umi CCTCACTAAC = 170 reads: +388 validated
umi CCTGCGCGTA = 352 reads: +388 validated
umi CGACCTCCAT = 394 reads: +388 validated
umi CGCCTCCCTC = 143 reads: +388 validated
umi CGCCTTGGGG = 351 reads: +388 validated
umi CGCGATCAAT = 346 reads: -9 +379 non-validated
umi CTATTTCTCG = 255 reads: +388 validated
umi CTCAACCTGG = 392 reads: +388 validated
umi CTCCAGGGTT = 357 reads: +388 validated
umi CTCCCGTAAG = 410 reads: +388 validated
umi CTCCGATTGG = 273 reads: +312 -1XX +75 invalidated
umi CTCTGTCGCA = 300 reads: +388 validated
umi CTCTTCTCCT = 312 reads: +388 validated
umi CTGTCAACCC = 366 reads: +388 validated
umi CTTAAATCCG = 257 reads: +388 validated
umi CTTAATCAGA = 302 reads: +388 validated
umi CTTCCAACAC = 362 reads: +388 validated
umi CTTCGTTCCC = 264 reads: +388 validated
umi CTTTTGTCTC = 275 reads: +388 validated
umi GAACCCTACG = 293 reads: +388 validated
umi GAAGTTCGGC = 298 reads: +388 validated
umi GAATTCCCCC = 285 reads: +388 validated
umi GACCATTCAC = 294 reads: +388 validated
umi GACGGCGGCC = 505 reads: +388 validated
umi GACGTTAGGG = 204 reads: +388 validated
umi GAGCAATCAA = 269 reads: +388 validated
umi GATGATTACC = 258 reads: +388 validated
umi GATTGGGGGA = 402 reads: +388 validated
umi GATTTAAAGG = 387 reads: +388 validated
umi GCAAACCCTT = 243 reads: +388 validated
umi GCACACCGTG = 370 reads: +388 validated
umi GCACTTGGTA = 357 reads: +388 validated
umi GCATCCCCGT = 304 reads: +388 validated
umi GCCGTCTTTA = 405 reads: +388 validated
umi GCGAATATCT = 341 reads: +388 validated
umi GCTATCCCTC = 253 reads: +388 validated
umi GCTCGTTCTC = 369 reads: +45 -4X +2 -1XX +2 -1XX +333 invalidated
umi GGCTGGCCTT = 160 reads: +388 validated
umi GGGGAACGGC = 461 reads: +236 -1XX +3 -2XX +146 invalidated
umi GGTGGTCCCG = 327 reads: +388 validated
umi GGTTATCCTG = 329 reads: +388 validated
umi GGTTGCACGC = 206 reads: +388 validated
umi GGTTTGACCG = 325 reads: +388 validated
umi GTAATCATGC = 347 reads: +388 validated
umi GTGAGTATCT = 355 reads: +388 validated
umi GTGCATTCAG = 364 reads: +388 validated
umi GTGCTTGACC = 197 reads: +388 validated
umi GTGTTATCAA = 308 reads: +388 validated
umi GTTCAGGCAT = 306 reads: +388 validated
umi GTTGAACGCA = 338 reads: +388 validated
umi GTTGACCGCC = 336 reads: +388 validated
umi GTTTATTCCA = 295 reads: +388 validated
umi GTTTATTGCA = 299 reads: +388 validated
umi TAAAGACCCT = 186 reads: +88 -1X +299 invalidated
umi TAACCGCGTT = 375 reads: +388 validated
umi TAAGATATGG = 317 reads: +388 validated
umi TAAGGCTCCT = 369 reads: +388 validated
umi TACACGGAGC = 222 reads: +388 validated
umi TACAGGCCGT = 342 reads: +388 validated
umi TACCTTCTCA = 288 reads: +388 validated
umi TACGGGGGCG = 262 reads: +388 validated
umi TACTAGGTGC = 392 reads: +388 validated
umi TAGAGAGCCT = 344 reads: +388 validated
umi TCAACGTCTA = 296 reads: +388 validated
umi TCAAGGCGAG = 195 reads: +388 validated
umi TCACGTCGGG = 272 reads: +388 validated
umi TCCCACTTGA = 338 reads: +388 validated
umi TCCCCACCTA = 330 reads: +388 validated
umi TCCCTGATTG = 342 reads: +388 validated
umi TCCTTTGGTC = 297 reads: +388 validated
umi TCGCTGCCCG = 324 reads: +388 validated
umi TCGTACTTCC = 319 reads: +388 validated
umi TCGTGTACCA = 295 reads: +388 validated
umi TCGTGTACCT = 316 reads: +388 validated
umi TCTAAGGGTT = 250 reads: +388 validated
umi TCTAGGCGGA = 143 reads: +388 validated
umi TCTATGCCCA = 370 reads: +388 validated
umi TGACCTCTCT = 368 reads: +388 validated
umi TGCGGAGTAC = 159 reads: +388 validated
umi TGCGGGGCGT = 379 reads: +388 validated
umi TGGTTAAGCC = 296 reads: +388 validated
umi TGTACGTGTC = 359 reads: +388 validated
umi TGTTTCATGC = 282 reads: +388 validated
umi TTAACCCGCT = 324 reads: +388 validated
umi TTCCAGGGAT = 304 reads: +388 validated
umi TTCTCTCCTG = 363 reads: +388 validated
umi TTGTATCACC = 293 reads: +388 validated
umi TTTCAGCTTC = 356 reads: +388 validated
umi TTTCTTTTCT = 299 reads: +388 validated

UMI info for barcode CAGTCCTCATGTCCTC-1 contig 2 = ATACTTTCTG...
umi AACATCCTGT = 31 reads: +43 -1X +1 -1XX +332 -1 +8 -1 +9 -27 invalidated
umi AAGTACGCTT = 201 reads: -386 +1 -2XX +12 -1XX +9 -2XX +6 -1XX +4 invalidated
umi AATGCCGGCA = 121 reads: +16 -4X +1 -3X +2 -3XX +3 -2XX +1 -6XX +2 -1XX +1 -1XX +378 invalidated
umi ACATTTACGT = 22 reads: +32 -2X +1 -6X +2 -1X +1 -1X +233 -12 +78 -55 invalidated
umi ACCCACCACA = 21 reads: +22 -20 +127 -1 +224 -30 non-validated
umi ACCGGGATCG = 34 reads: +46 -2XX +1 -3X +344 -28 invalidated
umi CACTTTTACT = 27 reads: -424 non-validated
umi CCTTTCTCGG = 34 reads: +404 -20 non-validated
umi CGTAGACTCC = 268 reads: +424 validated
umi CTCATTGCTG = 8 reads: -12X +1 -7X +1 -3X +2 -3X +3 -2X +1 -6X +2 -1XX +1 -1XX +75 -1 +1 -1 +78 -1 +5 -75 +9 -1 +7 -1 +38 -5 +56 -24 invalidated
umi GCTGACCCTT = 113 reads: -344 +80 non-validated
umi GTGCTATGGG = 95 reads: +33 -1 +1 -1 +3 -2X +2 -1X +1 -1XX +378 invalidated
umi TACGTTACTT = 172 reads: +424 validated
umi TATTATCCGT = 95 reads: +424 validated
umi TCCTCGGGCT = 20 reads: -20 +2 -2 +2 -1X +1 -1 +3 -2X +1 -6X +2 -1XX +1 -1XX +136 -5 +5 -1 +133 -29 +57 -12 invalidated
umi TCGGTTAGTG = 38 reads: +276 -7 +3 -1 +1 -3 +1 -1 +1 -2 +1 -1 +2 -2 +1 -1 +3 -2 +3 -2 +4 -2 +3 -1 +1 -1 +1 -1 +96 non-validated
umi TCTGCCTTCT = 2 reads: -424 non-validated
umi TCTTATCTGC = 34 reads: -51 +264 -16 +93 non-validated
umi TGCCAAGAAC = 126 reads: +26 -3X +3 -2XX +1 -6XX +2 -1XX +1 -1XX +184 -1XX +179 -2 +1 -1 +1 -2 +4 -1 +2 invalidated
umi TGTGTTAGAG = 65 reads: +26 -3XX +3 -2XX +1 -6XX +2 -1XX +1 -1XX +323 -6 +3 -1 +6 -2 +37 invalidated
umi TTGTGATCGC = 23 reads: +26 -3X +3 -2X +1 -6XX +2 -1XX +1 -1XX +113 -1 +168 -26 +56 -14 invalidated

GOOD CONTIGS

TIG 1[bases=555]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=21)
381-419 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 138 umis using 6488 reads
cdr3 = CQQYEDLPVTF at 358, score = 9 + 8
umis assigned: [32, 41, 51, 54, 62, 73, 74, 80, 101, 184] and 130 others
of which 140 are surviving nonsolos
reads assigned: 41765
start codons at 31, 37, 93, 106, 245, 368, 461
confident = true

TIG 2[bases=643]
0-37 ==> 64-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
37-393 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=30)
422-461 ==> 10-49 on |56|IGHJ5|J-REGION| [len=49] (mis=4)
461-643 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 5 umis using 88 reads
cdr3 = CARAEGSGWFRYLHPW at 382, score = 9 + 6
umis assigned: [60, 137, 170, 249, 271, 288, 943, 1214, 1324, 1437] and 11 others
of which 21 are surviving nonsolos
reads assigned: 1519
start codons at 37, 81, 260
confident = true
now this is a cell
paired!

GCGGACACGGCCGTGTATTACTGTGCGAGAGCAGAGGGCAGTGGCTGGTTTCGGTACCTCCACCCCTGGGGCCAGGGGACCCTGGTCCTCGTCTCTTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAATATGAGGATCTGCCGGTCACTTTCGGCCCTGGGACCAAAGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.522 = CAGTCCTGTCACTTCC-1

using 458 reads

====================================================================================

graph has 230 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[62, 390]
surviving nonsolo ucounts = 2[62, 390]
ids = [7, 5]

====================================================================================

UMI info for barcode CAGTCCTGTCACTTCC-1 contig 1 = GGAGGAGTCA...
umi GCATATTGTG = 390 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=1)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 74 reads
cdr3 = CLQDYTYPFSF at 356, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 384
start codons at 29, 35, 91, 104, 186, 189, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.525 = CAGTCCTGTCATATCG-1

using 343 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2^2, 334]
surviving nonsolo ucounts = 1[334]
ids = [5]

====================================================================================

UMI info for barcode CAGTCCTGTCATATCG-1 contig 1 = GGGGAGGAAC...
umi GAGCGGCGCC = 337 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
380-418 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQRSNWPITF at 357, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 331
start codons at 36, 241, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.527 = CAGTCCTGTCCGCTGA-1

using 253 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[3, 6, 8, 231]
surviving nonsolo ucounts = 1[231]
ids = [3]

====================================================================================

UMI info for barcode CAGTCCTGTCCGCTGA-1 contig 1 = GGAGGAACTG...
umi ATTTTAGCAC = 211 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=486]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=9)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
416-486 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQFNKWPPTF at 355, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 34, 103, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.537 = CAGTCCTGTGGACGAT-1

using 49 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 8, 37]
surviving nonsolo ucounts = 1[37]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.545 = CAGTCCTGTTACGCGC-1

using 368 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 4, 361]
surviving nonsolo ucounts = 1[361]
ids = [3]

====================================================================================

UMI info for barcode CAGTCCTGTTACGCGC-1 contig 1 = GAGGAACTGC...
umi TTGCATACGG = 364 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYNNWPYTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 356
start codons at 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.552 = CAGTCCTGTTCGGGCT-1

using 75 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 13[2^5, 4, 5, 6, 7^2, 8, 10, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.553 = CAGTCCTGTTCGTCTC-1

using 232 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 8, 216]
surviving nonsolo ucounts = 1[216]
ids = [5]

====================================================================================

UMI info for barcode CAGTCCTGTTCGTCTC-1 contig 1 = CCACTCAGGA...
umi CTAACTGGGC = 204 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=481]
16-367 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=20)
366-404 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
404-481 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CLQYSSSPWTF at 343, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 16, 22, 91, 227, 446
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.556 = CAGTCCTGTTGTGGAG-1

using 402 reads

====================================================================================

graph has 166 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 5, 120, 270]
surviving nonsolo ucounts = 2[120, 270]
ids = [6, 2]

====================================================================================

UMI info for barcode CAGTCCTGTTGTGGAG-1 contig 1 = AGGAGTCAGA...
umi TACGGAAGAA = 115 reads: +385 validated

UMI info for barcode CAGTCCTGTTGTGGAG-1 contig 2 = GGTCTGCTTC...
umi ATTGATCATC = 254 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=498]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=7)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
412-498 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CQQYNSYWTF at 354, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 114
start codons at 27, 33, 89, 102, 334, 454
confident = false

TIG 2[bases=503]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-503 ==> 0-61 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.558 = CAGTCCTGTTTGTGTG-1

using 497 reads

====================================================================================

graph has 166 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 4, 222, 267]
surviving nonsolo ucounts = 2[222, 267]
ids = [1, 3]

====================================================================================

UMI info for barcode CAGTCCTGTTTGTGTG-1 contig 1 = AGCTCTGAGA...
umi CATTTAAGGC = 265 reads: +424 validated

UMI info for barcode CAGTCCTGTTTGTGTG-1 contig 2 = GCTCTGCTTC...
umi CAAGTGGATT = 216 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=575]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=19)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-575 ==> 0-72 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 79, 230, 235, 382, 460
confident = false

TIG 2[bases=596]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-596 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.561 = CAGTCCTTCACAGGCC-1

using 310 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 304]
surviving nonsolo ucounts = 1[304]
ids = [1]

====================================================================================

UMI info for barcode CAGTCCTTCACAGGCC-1 contig 1 = GTCTCCCTCA...
umi GCTGAATTGT = 303 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=576]
0-56 ==> 3-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
56-409 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=13)
436-486 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
486-576 ==> 0-90 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CARPGYSGAWSRRDTFNIW at 398, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 56, 230, 254, 389, 467, 540
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.562 = CAGTCCTTCACCTTAT-1

using 372 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 7[2^5, 3, 352]
surviving nonsolo ucounts = 1[352]
ids = [3]

====================================================================================

UMI info for barcode CAGTCCTTCACCTTAT-1 contig 1 = GATCAGGACT...
umi ACATTTACAT = 359 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 350
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.571 = CAGTCCTTCATCGATG-1

using 238 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[238]
surviving nonsolo ucounts = 1[238]
ids = [0]

====================================================================================

UMI info for barcode CAGTCCTTCATCGATG-1 contig 1 = GCTGGGGTCA...
umi CATACCTCCT = 237 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=533]
0-41 ==> 121-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
41-381 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
435-533 ==> 0-98 on |306|IGLC2|C-REGION| [len=317] (mis=2)
junction support: 1 umis using 40 reads
cdr3 = CCSEAGGGVPGLLF at 365, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 41, 195
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.575 = CAGTCCTTCATTGCCC-1

using 71 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 22
nonsolo ucounts = 9[2, 3^2, 4, 5, 6, 7, 9, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.598 = CAGTCCTTCGGAATCT-1

using 120 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3^2, 110]
surviving nonsolo ucounts = 1[110]
ids = [3]

====================================================================================

UMI info for barcode CAGTCCTTCGGAATCT-1 contig 1 = TATATGGTGG...
umi CTTCTCGGGC = 110 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=526]
26-384 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=3)
399-447 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
447-526 ==> 0-79 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 18 reads
cdr3 = CARRRSPWFGALDYW at 371, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 105
start codons at 3, 26, 70, 249, 252, 332, 341, 391
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.621 = CAGTCCTTCTGTCTCG-1

using 292 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[2, 282]
surviving nonsolo ucounts = 1[282]
ids = [7]

====================================================================================

UMI info for barcode CAGTCCTTCTGTCTCG-1 contig 1 = GGGGAGGAAC...
umi TCGATTGCGC = 282 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
380-418 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=7)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQRRTWPPAF at 357, score = 9 + 6
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 36, 85, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.622 = CAGTCCTTCTGTGCAA-1

using 449 reads

====================================================================================

graph has 190 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^3, 168, 271]
surviving nonsolo ucounts = 2[168, 271]
ids = [7, 3]

====================================================================================

UMI info for barcode CAGTCCTTCTGTGCAA-1 contig 1 = GAGGAACTGC...
umi ACGCTACGTT = 246 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=491]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-366 ==> 0-333 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
412-491 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQERGGWWTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 33, 241, 454
confident = false

REJECT CONTIGS

TIG 1[bases=539]
4-50 ==> 0-46 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=1)
50-132 ==> 0-82 on rc of segment before IGHV4-61 exon 1 [len=82] (mis=1)
132-442 ==> 46-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=29) [SHIFT!]
471-510 ==> 10-49 on |56|IGHJ5|J-REGION| [len=49] (mis=4)
510-539 ==> 0-29 on |40|IGHG1|C-REGION| [len=884] (mis=0)
cdr3 = CARAEGSGWFRYLHPW at 431, score = 9 + 6
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 4, 73, 81, 309
confident = false
frameshifted full length transcript of length 539
VJ delta = -73
delta too large
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.627 = CAGTCCTTCTTGGGTA-1

using 328 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[3^2, 5, 7, 303]
surviving nonsolo ucounts = 1[303]
ids = [3]

====================================================================================

UMI info for barcode CAGTCCTTCTTGGGTA-1 contig 1 = GGGGAGGAGT...
umi ATCTACGATT = 296 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=504]
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
419-504 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQSYSTPWTF at 358, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 31, 37, 93, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.632 = CATATGGAGACCCACC-1

using 299 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 292]
surviving nonsolo ucounts = 1[292]
ids = [5]

====================================================================================

UMI info for barcode CATATGGAGACCCACC-1 contig 1 = GGGGGTCTCA...
umi TCGCTACTTC = 293 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=638]
39-391 ==> 0-352 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
389-427 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
427-638 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CSSYTSSSTQVF at 363, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 287
start codons at 39, 196, 240, 247, 250, 559
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.635 = CATATGGAGAGACTAT-1

using 298 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[3^2, 4, 287]
surviving nonsolo ucounts = 1[287]
ids = [0]

====================================================================================

UMI info for barcode CATATGGAGAGACTAT-1 contig 1 = GGGAGAGCCC...
umi AGGGTTCGTG = 277 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=512]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
391-429 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
429-512 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQRSNWPSTF at 368, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 47, 252, 255, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.640 = CATATGGAGAGTGAGA-1

using 203 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[202]
surviving nonsolo ucounts = 1[202]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=447]
0-342 ==> 21-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=22)
342-379 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
379-447 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYYSAPLTF at 318, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 48, 301, 421
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.654 = CATATGGAGGGATCTG-1

using 17968 reads

====================================================================================

graph has 5074 edges initially, 38 edges after simplification

total ucounts = 359
nonsolo ucounts = 194[2^56, 3^24, 4^14, 5^10, 6^11, 7^3, 8^2, 9^2, 10, 11^2, 12, 13, 14, 66, 101, 108, 124, 130, 150, 154, 158, 171, 179, 180^2, 186, 213, 217, 221, 227, 232, 234, 235, 239^2, 240, 249, 250, 252, 255^2, 256, 258, 266, 267, 270, 276, 278, 279, 280, 281, 287, 289^3, 295^3, 300^2, 301^2, 302, 303, 304^2, 313, 314, 316, 317^4, 328, 339, 350, 359, 503, 621]
surviving nonsolo ucounts = 62[108, 124, 130, 150, 158, 171, 179, 180^2, 186, 213, 217, 221, 227, 232, 234, 235, 239^2, 240, 249, 250, 252, 255^2, 256, 258, 266, 267, 270, 276, 278, 279, 280, 281, 287, 289^3, 295^3, 300^2, 301^2, 302, 303, 304^2, 313, 314, 316, 317^4, 328, 339, 350, 359, 621]
ids = [232, 29, 126, 316, 287, 279, 94, 5, 256, 20, ...]

====================================================================================

UMI info for barcode CATATGGAGGGATCTG-1 contig 1 = AGGAGTCAGA...
umi AAAACATCGG = 356 reads: +388 validated
umi AAACCACGGT = 179 reads: +388 validated
umi AACGCCTCAG = 223 reads: +388 validated
umi AAGCTCATCT = 186 reads: +388 validated
umi AAGTATTAAC = 328 reads: +388 validated
umi AATACTTCGA = 240 reads: +388 validated
umi AATTCAATTG = 261 reads: +388 validated
umi AATTCAGAAC = 315 reads: +388 validated
umi ACCCTCGTAT = 307 reads: +388 validated
umi ACGACTCGCT = 356 reads: +388 validated
umi ACTACTTTCA = 309 reads: +388 validated
umi AGAGCTCTTT = 303 reads: +388 validated
umi AGCTGGTCAT = 306 reads: +388 validated
umi AGGTATCCGT = 316 reads: +388 validated
umi ATATGAACCT = 300 reads: +388 validated
umi ATCAACTCTT = 285 reads: +388 validated
umi ATCACCCTAT = 288 reads: +388 validated
umi ATCCGCTCCG = 173 reads: -360 +3 -2X +9 -1 +5 -1XX +7 invalidated
umi CAACTCTGTG = 304 reads: +388 validated
umi CACAGACACG = 214 reads: +388 validated
umi CAGATTTGCC = 238 reads: +388 validated
umi CATATATTTC = 268 reads: +388 validated
umi CATTCTACGT = 129 reads: +380 -8 non-validated
umi CCAGAACATT = 625 reads: +388 validated
umi CCCTGATGCC = 287 reads: +388 validated
umi CCGCATGCCT = 320 reads: +388 validated
umi CGCGTACGCA = 316 reads: +388 validated
umi CGGCTCGGTT = 238 reads: +388 validated
umi CGGTTCAGTT = 280 reads: +388 validated
umi CTATAACGTG = 280 reads: +388 validated
umi CTCCCGTTGT = 289 reads: +388 validated
umi CTTCTACGCC = 267 reads: +388 validated
umi CTTGGGAGTA = 252 reads: +388 validated
umi CTTTAAACCG = 254 reads: +388 validated
umi CTTTAAATTG = 315 reads: +388 validated
umi GCGGGCACCA = 282 reads: +388 validated
umi GGAGGCTACT = 111 reads: +388 validated
umi GGCCGGCGTC = 258 reads: +388 validated
umi GGCGCAACAT = 294 reads: +388 validated
umi GGCTATTCTG = 270 reads: +388 validated
umi GGCTCAAGGG = 276 reads: +388 validated
umi GGGTTACCTC = 318 reads: +388 validated
umi GGTGCGGACC = 27 reads: -314 +1 -5X +1 -1XX +1 -2XX +1 -3XX +1 -1XX +1 -5XX +1 -8XX +1 -3XX +38 invalidated
umi GGTGTCGGTT = 237 reads: +388 validated
umi GTAGCACGGT = 257 reads: +388 validated
umi GTATCCGCCG = 179 reads: +388 validated
umi GTCTATGTGC = 218 reads: +388 validated
umi GTTAATTTTA = 292 reads: +388 validated
umi TAAAGCGAGG = 230 reads: +388 validated
umi TAGCCTGCTG = 169 reads: +388 validated
umi TATTGCTCTT = 160 reads: +388 validated
umi TCCCATCCCA = 329 reads: +388 validated
umi TCCGTGGTAT = 304 reads: +388 validated
umi TCTCAATCGA = 305 reads: +388 validated
umi TCTCCGCCTG = 303 reads: +388 validated
umi TGCAGCCCTC = 147 reads: +388 validated
umi TTCATCGGCA = 290 reads: +388 validated
umi TTTAGTGTCG = 251 reads: +388 validated
umi TTTTTCGCGT = 243 reads: +388 validated

UMI info for barcode CATATGGAGGGATCTG-1 contig 2 = GCTGAAGAAA...
umi AATGTACGAC = 123 reads: +398 -1 +36 -1 +3 non-validated
umi CCCGGCGGAG = 240 reads: -399X +3 -2XX +9 -1XX +2 -1XX +3 -2XX +17 invalidated
umi CCTCCGTCCG = 264 reads: +431 -8 non-validated
umi CTCCATAGAG = 235 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=4)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 56 umis using 2248 reads
cdr3 = CQQYNSFPWTF at 354, score = 8 + 8
umis assigned: [0, 5, 13, 20, 22, 26, 31, 32, 45, 52] and 49 others
of which 58 are surviving nonsolos
reads assigned: 15406
start codons at 27, 33, 89, 102, 334, 457
confident = true

TIG 2[bases=642]
0-101 ==> 135-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=0)
101-454 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=1)
477-540 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
540-642 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 2 umis using 31 reads
cdr3 = CARALVGARSPNLYYYYGMDVW at 443, score = 9 + 7
umis assigned: [29, 140, 153, 175]
of which 4 are surviving nonsolos
reads assigned: 837
start codons at 101, 257, 318, 404, 497, 558, 619
confident = true
now this is a cell
paired!

TACTGTGCAAGAGCCCTAGTGGGAGCTAGGAGTCCAAATCTTTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTTCCCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.655 = CATATGGAGGGTTTCT-1

using 392 reads

====================================================================================

graph has 228 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 10[2, 3, 5, 7^2, 8^2, 11^2, 326]
surviving nonsolo ucounts = 1[326]
ids = [8]

====================================================================================

UMI info for barcode CATATGGAGGGTTTCT-1 contig 1 = GATCAGGACT...
umi GTGAGTATGC = 315 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=500]
0-30 ==> 0-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=8)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
427-500 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CMQGTHWPWTF at 366, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 30, 63, 91, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.660 = CATATGGAGTACGACG-1

using 268 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[4, 7, 249]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.670 = CATATGGCAAGCGCTC-1

using 278 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[278]
surviving nonsolo ucounts = 1[278]
ids = [0]

====================================================================================

UMI info for barcode CATATGGCAAGCGCTC-1 contig 1 = ATACTTTCTG...
umi CTTCTCATTT = 279 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=526]
0-37 ==> 27-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=2)
37-390 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=10)
407-455 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
455-526 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARVEGFDDLYFDYW at 379, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 16, 37, 81, 156, 401
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.671 = CATATGGCAAGCTGAG-1

using 74 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[74]
surviving nonsolo ucounts = 1[74]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.673 = CATATGGCAATCAGAA-1

using 46 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[5^2, 9^2, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.684 = CATATGGCAGAAGCAC-1

using 28919 reads

====================================================================================

graph has 9770 edges initially, 152 edges after simplification

total ucounts = 678
nonsolo ucounts = 369[2^88, 3^44, 4^46, 5^26, 6^22, 7^14, 8^12, 9^9, 10^4, 11^4, 12^4, 13^2, 14^2, 15^2, 17, 19^3, 29, 70, 73, 88, 89, 94, 96, 101, 106, 111, 119, 132, 136, 142, 143, 149, 159, 167, 169, 172, 185, 197, 210, 217, 221, 226, 247, 252, 266, 267, 269, 274, 275, 287^2, 290, 293, 298, 305^2, 306, 307, 308, 311, 312, 319^2, 332, 334, 338, 339, 344^3, 345, 346^3, 347, 349, 356, 359, 365, 368, 369, 374, 375, 377, 381^2, 392, 397, 399, 403, 406, 412, 457, 463, 471, 489, 508, 554, 612, 784, 932, 1755]
surviving nonsolo ucounts = 82[70, 73, 88, 94, 101, 106, 111, 119, 132, 136, 142, 143, 149, 159, 167, 169, 172, 185, 197, 210, 217, 221, 226, 247, 266, 267, 269, 274, 275, 287^2, 290, 293, 298, 305^2, 306, 307, 308, 311, 312, 319^2, 332, 334, 338, 339, 344^3, 345, 346^3, 347, 349, 356, 359, 365, 368, 369, 374, 375, 377, 381^2, 392, 397, 399, 403, 406, 412, 457, 463, 471, 489, 508, 554, 612, 784, 932, 1755]
ids = [58, 192, 623, 378, 641, 537, 620, 575, 612, 663, ...]

====================================================================================

UMI info for barcode CATATGGCAGAAGCAC-1 contig 1 = ATACTTTCTG...
umi ACGGGTCACA = 318 reads: +418 validated
umi CACAAGCTAT = 168 reads: +418 validated
umi CTTTGTTGCC = 175 reads: +415 -1 +2 non-validated
umi GGCGGGTCAC = 32 reads: -146X +5 -3XX +1 -6XX +2 -2XX +12 -1XX +1 -1XX +21 -1XX +1 -5XX +1 -1XX +2 -2XX +2 -4XX +2 -1XX +1 -1XX +2 -3XX +2 -1X +4 -181 invalidated
umi GGCTCACTCG = 270 reads: +418 validated
umi GGTTTGTCCC = 340 reads: +418 validated
umi GTCCTCATAG = 269 reads: +418 validated
umi TGGTGTGGGG = 270 reads: +418 validated
umi TGTCCGTCTA = 119 reads: +418 validated
umi TGTTACTCAG = 112 reads: +414 -4 non-validated
umi TTACAACATT = 187 reads: +418 validated
umi TTCACTACCA = 265 reads: +418 validated
umi TTCCCTGACA = 102 reads: +357 -1 +10 -23 +27 non-validated

UMI info for barcode CATATGGCAGAAGCAC-1 contig 2 = GGGGAGGAAC...
umi AAAAGACCTC = 1 reads: -370 non-validated
umi AAACCAGTAT = 309 reads: +370 validated
umi AACGGCGTCC = 346 reads: +370 validated
umi AACTTCCAGG = 406 reads: +201 -1XX +168 invalidated
umi AAGGGCGACG = 288 reads: +370 validated
umi AAGTGCCTAA = 304 reads: +370 validated
umi AATCTTCATC = 408 reads: +370 validated
umi AATTCTTCAA = 367 reads: +370 validated
umi ACAAGCGCCA = 322 reads: +370 validated
umi ACAGTGTTTT = 297 reads: +370 validated
umi ACATGACCAC = 462 reads: +370 validated
umi ACTTGGGCCT = 297 reads: +370 validated
umi AGATCATTTT = 620 reads: +370 validated
umi AGCGTTATCG = 401 reads: +370 validated
umi AGCTAACTGG = 312 reads: +370 validated
umi AGCTACTCTC = 241 reads: +370 validated
umi AGTACCTCAG = 263 reads: +370 validated
umi ATTGTTTGCG = 351 reads: +370 validated
umi CAAGGGGATT = 378 reads: +370 validated
umi CACATCCCTC = 328 reads: +370 validated
umi CCATCTCCAG = 213 reads: +370 validated
umi CCCTCACTTT = 168 reads: +370 validated
umi CCGTGATCCT = 303 reads: +370 validated
umi CGACACGGCC = 309 reads: +370 validated
umi CGTTATTCCA = 340 reads: +370 validated
umi CGTTGTGAAA = 493 reads: +370 validated
umi CTATGCCTTA = 357 reads: +370 validated
umi CTGCACCGGT = 374 reads: +370 validated
umi GCGATAATCT = 142 reads: +370 validated
umi GCGCTCCTTT = 340 reads: +370 validated
umi GCGTACTCTA = 389 reads: +370 validated
umi GCTTTTTTTA = 280 reads: +370 validated
umi GGCAACCTCA = 306 reads: +370 validated
umi GGCATATCCA = 346 reads: +370 validated
umi GGCTCGAACC = 362 reads: +370 validated
umi GTATGGCCTG = 203 reads: +370 validated
umi GTCCAACAGG = 204 reads: -322 +1 -2X +1 -9XX +2 -1XX +32 invalidated
umi GTTTATAGGT = 350 reads: +370 validated
umi TACGTTACAG = 393 reads: +370 validated
umi TACTCCGACG = 561 reads: +370 validated
umi TACTGTCAAT = 342 reads: +370 validated
umi TATGAGCAGT = 371 reads: +370 validated
umi TCCATATATT = 465 reads: +370 validated
umi TCGGTTTCTA = 291 reads: +370 validated
umi TCGTTATCAG = 302 reads: +370 validated
umi TCTTACTCCA = 810 reads: +88 -1XX +1 -5XX +1 -5XX +3 -1XX +1 -6XX +2 -245X +1 -1XX +1 -2XX +1 -5XX invalidated
umi TGCAACCCGT = 336 reads: +370 validated
umi TGGCGTCGTT = 139 reads: +370 validated
umi TTGAAGTCCA = 371 reads: +370 validated
umi TTTACATCTA = 135 reads: +370 validated
umi TTTTACACCA = 349 reads: +370 validated

GOOD CONTIGS

TIG 1[bases=526]
0-37 ==> 27-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=2)
37-390 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=10)
407-455 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
455-526 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 10 umis using 243 reads
cdr3 = CARVEGFDDLYFDYW at 379, score = 9 + 7
umis assigned: [82, 182, 328, 402, 404, 427, 445, 606, 612, 620] and 3 others
of which 12 are surviving nonsolos
reads assigned: 2595
start codons at 16, 37, 81, 156, 401
confident = true

TIG 2[bases=542]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-370 ==> 0-334 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
367-406 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
406-542 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 48 umis using 2826 reads
cdr3 = CQQRNTF at 357, score = 9 + 8
umis assigned: [5, 9, 23, 26, 33, 37, 45, 51, 54, 62] and 41 others
of which 51 are surviving nonsolos
reads assigned: 16705
start codons at 36, 241, 244, 448
confident = true

REJECT CONTIGS

TIG 1[bases=376]
56-213 ==> 0-157 on rc of segment before IGHJ3P exon 1 [len=157] (mis=0)
211-274 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
274-376 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [545]
of which 1 are surviving nonsolos
reads assigned: 335
start codons at 63, 97, 136, 191, 231, 292, 353
confident = false
did not find CDR3
now this is a cell
paired!

GCCGCGGACACGGCCGTGTATTACTGTGCGAGAGTGGAGGGGTTCGATGATTTATATTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> TTCACTCTCACCATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.689 = CATATGGCAGCCACCA-1

using 326 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[24, 300]
surviving nonsolo ucounts = 2[24, 300]
ids = [2, 0]

====================================================================================

UMI info for barcode CATATGGCAGCCACCA-1 contig 1 = GGGGAGGAAC...
umi CGATAGCCCT = 299 reads: +382 validated
umi TCGGAGACCG = 20 reads: -382 non-validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=2)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYNNWQWTF at 357, score = 9 + 8
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 316
start codons at 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.698 = CATATGGCATCCTAGA-1

using 254 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[251]
surviving nonsolo ucounts = 1[251]
ids = [0]

====================================================================================

UMI info for barcode CATATGGCATCCTAGA-1 contig 1 = TGGGGAGACT...
umi CTCGTATCCC = 238 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=484]
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-484 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYNSYPLTF at 352, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 25, 31, 87, 100, 236, 239, 332, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.704 = CATATGGCATTAACCG-1

using 197 reads

====================================================================================

graph has 83 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 191]
surviving nonsolo ucounts = 1[191]
ids = [3]

====================================================================================

UMI info for barcode CATATGGCATTAACCG-1 contig 1 = GGGGGGTCTC...
umi GGCAGTGATG = 190 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=510]
40-401 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
390-428 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
428-510 ==> 0-82 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CSSYTSSSTLVF at 364, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 40, 197, 241, 248, 251
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.707 = CATATGGGTACGACCC-1

using 41 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[41]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.721 = CATATGGGTCTCGTTC-1

using 321 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[318]
surviving nonsolo ucounts = 1[318]
ids = [2]

====================================================================================

UMI info for barcode CATATGGGTCTCGTTC-1 contig 1 = GTCAGTCTCA...
umi TGGGTTGTAG = 313 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=504]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-504 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQSYSTLPLTF at 350, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 23, 29, 85, 98, 234, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.729 = CATATGGGTGTAATGA-1

using 162 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[6, 153]
surviving nonsolo ucounts = 1[153]
ids = [1]

====================================================================================

UMI info for barcode CATATGGGTGTAATGA-1 contig 1 = AGCTTCAGCT...
umi ACTCATATTC = 146 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=522]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-355 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-522 ==> 0-87 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CVAWDDSLYAWVF at 368, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 146
start codons at 47, 351, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.730 = CATATGGGTGTATGGG-1

using 20739 reads

====================================================================================

graph has 7758 edges initially, 88 edges after simplification

total ucounts = 1290
nonsolo ucounts = 581[2^197, 3^118, 4^54, 5^40, 6^25, 7^18, 8^19, 9^7, 10^7, 11^2, 12^3, 14, 15, 16, 18, 27, 36, 37, 46, 59, 70, 79, 90, 94, 101, 113, 114, 120, 125, 127, 135, 139, 151, 154, 158, 159, 163, 175, 180, 185, 187^2, 191, 192, 194^2, 195, 196, 199, 200^2, 203, 205, 206, 208, 209^2, 216, 220, 224^2, 226, 227, 231^2, 232^2, 233, 234, 235^2, 236, 240, 241, 242, 244, 245, 247, 248^2, 250, 251, 253, 256, 263, 264, 265, 267, 270, 271, 274^2, 276, 283, 284, 292, 294, 298, 304, 322, 487, 583]
surviving nonsolo ucounts = 76[59, 79, 94, 101, 113, 120, 127, 135, 139, 154, 158, 159, 163, 175, 180, 185, 187^2, 191, 192, 194^2, 195, 196, 199, 200^2, 203, 205, 206, 208, 209^2, 216, 220, 224^2, 226, 227, 231^2, 232^2, 233, 234, 235^2, 236, 240, 241, 242, 244, 245, 247, 248^2, 250, 251, 253, 256, 263, 264, 265, 267, 270, 271, 274^2, 276, 283, 284, 292, 294, 298, 304, 583]
ids = [38, 839, 536, 207, 873, 105, 1286, 1176, 542, 724, ...]

====================================================================================

UMI info for barcode CATATGGGTGTATGGG-1 contig 1 = GCTGTGGGTC...
umi AATAGGTGCA = 58 reads: +391 validated
umi ACACCGTACC = 271 reads: +391 validated
umi ACATATATCA = 211 reads: +391 validated
umi ACCTGGCGCT = 276 reads: +391 validated
umi ACGATTATCG = 198 reads: +391 validated
umi ACTGATTTGG = 201 reads: +196 -1XX +2 -1XX +191 invalidated
umi AGCCGTATAA = 247 reads: +391 validated
umi AGTCATCGCC = 274 reads: +391 validated
umi ATATGTCATC = 231 reads: +391 validated
umi ATCATAACTG = 189 reads: +391 validated
umi ATCATCTTCG = 243 reads: +391 validated
umi ATCGAAGAGT = 300 reads: +391 validated
umi ATTTTCCGGG = 228 reads: +391 validated
umi CAGTCTGTCT = 193 reads: +391 validated
umi CCCCTTGAAC = 281 reads: +391 validated
umi CCGTCGAGGT = 233 reads: +391 validated
umi CCTTTTTGGC = 181 reads: +391 validated
umi CGCTATTTCC = 270 reads: +391 validated
umi CGGTTCCCTT = 235 reads: +391 validated
umi CGTGTTCCCT = 197 reads: +391 validated
umi CTGGTGCCCG = 297 reads: +391 validated
umi CTTAGTTCCT = 204 reads: +391 validated
umi GAGTTCACTA = 234 reads: +391 validated
umi GCATTATGGC = 232 reads: +391 validated
umi GCCCAGTAAT = 302 reads: +391 validated
umi GCCTGATCCT = 225 reads: +391 validated
umi GCGGGAAGAC = 205 reads: +391 validated
umi GGGGGTGGGT = 245 reads: +391 validated
umi GTCGTCTAGC = 78 reads: +6 -1 +384 non-validated
umi GTTTGCCCCC = 115 reads: +391 validated
umi TAAACTACCC = 285 reads: +391 validated
umi TACCCATCGT = 247 reads: +391 validated
umi TAGAATATCC = 241 reads: +391 validated
umi TAGGTGCCTA = 191 reads: +391 validated
umi TCCAGCGGGA = 195 reads: +391 validated
umi TCGAACGGTA = 165 reads: +391 validated
umi TCTAACACCT = 295 reads: +391 validated
umi TCTAAGTATG = 158 reads: +391 validated
umi TCTCCGTGTA = 187 reads: +391 validated
umi TTCACCATAG = 133 reads: +391 validated
umi TTCTGCCCCC = 583 reads: +391 validated
umi TTTCACGGTC = 270 reads: +391 validated

UMI info for barcode CATATGGGTGTATGGG-1 contig 2 = TGGGGATGCT...
umi AAATCGCCCG = 268 reads: +457 validated
umi AAATTCTGCC = 234 reads: +457 validated
umi AAGACCCTCG = 206 reads: +457 validated
umi AATAGGTTCA = 226 reads: +457 validated
umi ACAATCTCTC = 242 reads: +457 validated
umi ACCTTAACCG = 254 reads: +457 validated
umi ACTCATTAAC = 118 reads: +457 validated
umi AGTCATTCGT = 208 reads: -2X +455 invalidated
umi ATCGACTCAA = 99 reads: +457 validated
umi CACGCTACGC = 253 reads: +457 validated
umi CATCTCATCC = 673 reads: -421X +1 -2XX +1 -5XX +1 -2XX +1 -1XX +1 -13XX +1 -2XX +1 -3XX +1 invalidated
umi CCACAGTTCG = 255 reads: +457 validated
umi CCAGACCGTC = 228 reads: +457 validated
umi CCCGGGAACT = 201 reads: +457 validated
umi CGTCTTTGTA = 186 reads: +457 validated
umi CGTTTCCACC = 95 reads: +12 -1 +444 non-validated
umi CTAATCGGAG = 139 reads: -2X +455 invalidated
umi CTTGCTTCTA = 266 reads: +457 validated
umi GCATTTTATA = 226 reads: +457 validated
umi GCCGTCATTC = 157 reads: +457 validated
umi GGGAACCACC = 255 reads: +457 validated
umi GGTGTGCGGT = 223 reads: +457 validated
umi GTCACATTGG = 243 reads: +457 validated
umi TAAATTCGTC = 266 reads: +457 validated
umi TAAATTTATC = 237 reads: +457 validated
umi TAACAAATTC = 209 reads: +457 validated
umi TCCTTTGCTG = 186 reads: +457 validated
umi TCTGCCGTTT = 216 reads: +457 validated
umi TGAGTCGACA = 488 reads: -435X +1 -13X +1 -2XX +1 -3XX +1 invalidated
umi TGGTACCCGG = 234 reads: +457 validated
umi TTCACTTGGC = 185 reads: +457 validated
umi TTCCACCATC = 270 reads: +457 validated
umi TTCTATCTTC = 157 reads: +457 validated
umi TTTGTGTCTG = 183 reads: +457 validated
umi TTTTTATCAA = 128 reads: +457 validated

GOOD CONTIGS

TIG 1[bases=640]
0-38 ==> 5-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
38-375 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=17)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
429-640 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 41 umis using 1326 reads
cdr3 = CQSADSSGTYRGVVAF at 353, score = 8 + 8
umis assigned: [38, 49, 58, 82, 88, 112, 137, 162, 187, 192] and 32 others
of which 42 are surviving nonsolos
reads assigned: 9457
start codons at 38, 168
confident = true

TIG 2[bases=660]
21-398 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=20)
430-478 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
478-660 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 33 umis using 793 reads
cdr3 = CARHWVGYNYGHYRNYFDSW at 387, score = 8 + 6
umis assigned: [3, 5, 28, 39, 47, 84, 105, 163, 207, 294] and 25 others
of which 33 are surviving nonsolos
reads assigned: 7493
start codons at 5, 21, 30, 42, 86, 309, 415
confident = true
now this is a cell
paired!

GTTTATTACTGTGCGAGACATTGGGTAGGATACAACTATGGCCACTACAGGAACTACTTTGACTCCTGGGGCCAGGGAACCCTGGTCATTGTCTCCTCAG <==> GCAGAAGACGAGGCTGACTATTACTGTCAATCAGCAGACAGCAGTGGTACTTATCGGGGAGTGGTGGCATTCGGCGGAGGGACCAAGCTGACCGTCCTAA

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.736 = CATATGGGTTATCGGT-1

using 550 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[240, 308]
surviving nonsolo ucounts = 2[240, 308]
ids = [3, 2]

====================================================================================

UMI info for barcode CATATGGGTTATCGGT-1 contig 1 = GTCAGTCCCA...
umi TGGAGGTGAA = 312 reads: +388 validated
umi TGGAGTTGAA = 239 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 69 reads
cdr3 = CQQYDNLLLTF at 350, score = 9 + 9
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 541
start codons at 23, 29, 85, 98, 237, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.737 = CATATGGGTTCAACCA-1

using 640 reads

====================================================================================

graph has 212 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 16, 619]
surviving nonsolo ucounts = 1[619]
ids = [2]

====================================================================================

UMI info for barcode CATATGGGTTCAACCA-1 contig 1 = GAGCTACAAC...
umi ATGCAGATGA = 616 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=569]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
396-433 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
433-569 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 68 reads
cdr3 = CQQYYSTPPLTF at 369, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 608
start codons at 30, 99, 352, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.743 = CATATGGTCAACACTG-1

using 307 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 3, 297]
surviving nonsolo ucounts = 1[297]
ids = [5]

====================================================================================

UMI info for barcode CATATGGTCAACACTG-1 contig 1 = GAGGAACTGC...
umi TTTCGCATCT = 297 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=9)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQFNKWPPTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 33, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.750 = CATATGGTCATTATCC-1

using 182 reads

====================================================================================

graph has 70 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[4, 55, 118]
surviving nonsolo ucounts = 2[55, 118]
ids = [1, 2]

====================================================================================

UMI info for barcode CATATGGTCATTATCC-1 contig 1 = GGGGCTTTCT...
umi CGAATTCCTC = 112 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=465]
17-394 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=27)
417-465 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
junction support: 1 umis using 20 reads
cdr3 = CARRDYYGSERVDFDYW at 383, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 111
start codons at 17, 26, 38, 82, 98, 186, 305, 402
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.761 = CATATGGTCCTCCTAG-1

using 12 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.766 = CATATGGTCGGAAATA-1

using 71 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[71]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.775 = CATATGGTCTTGCAAG-1

using 312 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[4, 302]
surviving nonsolo ucounts = 1[302]
ids = [2]

====================================================================================

UMI info for barcode CATATGGTCTTGCAAG-1 contig 1 = AGCTGTGGGC...
umi CGACTTCGTC = 294 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=588]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
422-588 ==> 0-166 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CNSRDSSGNHVVF at 355, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 40, 159, 188, 239, 338, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.779 = CATATTCAGAAGGGTA-1

using 577 reads

====================================================================================

graph has 212 edges initially, 12 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3, 275, 293]
surviving nonsolo ucounts = 2[275, 293]
ids = [2, 1]

====================================================================================

UMI info for barcode CATATTCAGAAGGGTA-1 contig 1 = CTGATCAGGA...
umi CCGTCTCGGA = 291 reads: +397 validated

UMI info for barcode CATATTCAGAAGGGTA-1 contig 2 = GGAGTCAGTC...
umi CTTGGGATAC = 282 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=565]
0-32 ==> 4-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
32-392 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=0)
391-429 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CMQALQTPPTF at 368, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 32, 65, 101, 189, 351, 371, 471
confident = false

TIG 2[bases=550]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQYDNLPRTF at 353, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 26, 32, 88, 101, 240, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.799 = CATATTCAGGCTCAGA-1

using 331 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[328]
surviving nonsolo ucounts = 1[328]
ids = [0]

====================================================================================

UMI info for barcode CATATTCAGGCTCAGA-1 contig 1 = AGGAATCAGT...
umi AATCTGCGTC = 335 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.810 = CATATTCAGTCCTCCT-1

using 25 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[3^2, 6, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.811 = CATATTCAGTCTCGGC-1

using 311 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 306]
surviving nonsolo ucounts = 1[306]
ids = [3]

====================================================================================

UMI info for barcode CATATTCAGTCTCGGC-1 contig 1 = AAAAACCACA...
umi TATTCCGTAC = 297 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=533]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-533 ==> 0-47 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.813 = CATATTCAGTTGAGAT-1

using 274 reads

====================================================================================

graph has 138 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 11[2^2, 3^2, 4^3, 5, 8, 16, 219]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.817 = CATATTCCAAACGTGG-1

using 44 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2, 3^2, 4^2, 5, 7, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.818 = CATATTCCAAAGCGGT-1

using 326 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 323]
surviving nonsolo ucounts = 1[323]
ids = [2]

====================================================================================

UMI info for barcode CATATTCCAAAGCGGT-1 contig 1 = AGTCTCAGTC...
umi TTAAATTTCA = 326 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQSYSTPRAF at 347, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 320
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.821 = CATATTCCAAGAAGAG-1

using 209 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[35, 170]
surviving nonsolo ucounts = 1[170]
ids = [4]

====================================================================================

UMI info for barcode CATATTCCAAGAAGAG-1 contig 1 = GTCAGACTCA...
umi TCACCTTCCG = 160 reads: +388 validated
umi TTCTGATAAA = 3 reads: -360X +1 -1X +1 -3X +2 -4X +1 -2X +2 -1X +2 -2X +4 -1X +1 invalidated

GOOD CONTIGS

TIG 1[bases=486]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
411-486 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYNGQSRAF at 350, score = 8 + 7
umis assigned: [4, 5]
of which 1 are surviving nonsolos
reads assigned: 159
start codons at 23, 29, 98, 234, 237, 330, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.824 = CATATTCCAAGTTAAG-1

using 291 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[287]
surviving nonsolo ucounts = 1[287]
ids = [1]

====================================================================================

UMI info for barcode CATATTCCAAGTTAAG-1 contig 1 = AGGAGTCAGA...
umi CCCCATTTAT = 289 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYNSYPYTF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 27, 33, 89, 102, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.830 = CATATTCCACATTTCT-1

using 876 reads

====================================================================================

graph has 308 edges initially, 4 edges after simplification

total ucounts = 22
nonsolo ucounts = 10[2, 4, 5, 6^2, 9, 13, 16, 312, 491]
surviving nonsolo ucounts = 2[312, 491]
ids = [17, 4]

====================================================================================

UMI info for barcode CATATTCCACATTTCT-1 contig 1 = GGGGAGGAAT...
umi TAGGTCCAGC = 281 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=479]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-479 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [17]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.835 = CATATTCCACGACTCG-1

using 262 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 258]
surviving nonsolo ucounts = 1[258]
ids = [2]

====================================================================================

UMI info for barcode CATATTCCACGACTCG-1 contig 1 = GCTCTGCTTC...
umi CGCTCTTTCG = 253 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=557]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=22)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=6)
442-557 ==> 0-115 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 38 reads
cdr3 = CQSYDSILTGWAF at 375, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 51, 205, 358, 385, 521
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.847 = CATATTCCAGATGGCA-1

using 143 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 9[3^2, 4^2, 6, 8^2, 11, 91]
surviving nonsolo ucounts = 1[91]
ids = [2]

====================================================================================

UMI info for barcode CATATTCCAGATGGCA-1 contig 1 = AGTCCCAGTC...
umi ATGTCGGCTT = 81 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=427]
0-20 ==> 38-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
20-360 ==> 0-340 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=0)
362-399 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
399-427 ==> 0-28 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CQQLTLTF at 347, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 80
start codons at 20, 26, 82, 231
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.849 = CATATTCCAGGCAGTA-1

using 338 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 18, 311]
surviving nonsolo ucounts = 1[311]
ids = [8]

====================================================================================

UMI info for barcode CATATTCCAGGCAGTA-1 contig 1 = AGAAGAGCTG...
umi GGTGCAGTCG = 313 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 18-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
34-382 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYGTSRTF at 358, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 34, 242, 368, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.855 = CATATTCCATGTTCCC-1

using 784 reads

====================================================================================

graph has 322 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[4, 7, 26, 239, 503]
surviving nonsolo ucounts = 3[26, 239, 503]
ids = [8, 7, 2]

====================================================================================

UMI info for barcode CATATTCCATGTTCCC-1 contig 1 = AGCTTCAGCT...
umi TACAATCGCA = 242 reads: +388 validated

UMI info for barcode CATATTCCATGTTCCC-1 contig 2 = AGCTCTGAGA...
umi AGCCTCTGGA = 507 reads: -126 +298 non-validated
umi TCGCTCCAAT = 27 reads: +199 -1 +1 -43 +112 -40 +28 non-validated

GOOD CONTIGS

TIG 1[bases=642]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-642 ==> 0-207 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=685]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-685 ==> 0-182 on |43|IGHG2|C-REGION| [len=977] (mis=1)
junction support: 1 umis using 172 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [2, 8]
of which 2 are surviving nonsolos
reads assigned: 524
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.856 = CATATTCCATTAACCG-1

using 210 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[207]
surviving nonsolo ucounts = 1[207]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.859 = CATATTCGTAACGTTC-1

using 132 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[129]
surviving nonsolo ucounts = 1[129]
ids = [2]

====================================================================================

UMI info for barcode CATATTCGTAACGTTC-1 contig 1 = GGAGTCAGAC...
umi CCGGAGTACT = 110 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=438]
0-32 ==> 21-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
32-377 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
386-414 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
414-438 ==> 0-24 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQYYSYPRTF at 353, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 109
start codons at 26, 32, 88, 101, 237
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.860 = CATATTCGTAAGGGCT-1

using 546 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[14, 530]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.868 = CATATTCGTCCGTCAG-1

using 445 reads

====================================================================================

graph has 177 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^4, 8, 426]
surviving nonsolo ucounts = 1[426]
ids = [0]

====================================================================================

UMI info for barcode CATATTCGTCCGTCAG-1 contig 1 = GTCAGACCCA...
umi AGAGCGCCAG = 429 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 24-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=14)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 70 reads
cdr3 = CQQANSFPLTF at 350, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 419
start codons at 23, 29, 85, 98, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.875 = CATATTCGTGGGTATG-1

using 312 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 8, 38, 261]
surviving nonsolo ucounts = 2[38, 261]
ids = [3, 4]

====================================================================================

UMI info for barcode CATATTCGTGGGTATG-1 contig 1 = AGCTTCAGCT...
umi GTAAGGACGG = 35 reads: +388 validated
umi TACTGCAGTC = 257 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-355 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-554 ==> 0-119 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 46 reads
cdr3 = CVAWDDSLYAWVF at 368, score = 8 + 7
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 288
start codons at 47, 351, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.878 = CATATTCGTGGTCTCG-1

using 355 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[5, 346]
surviving nonsolo ucounts = 1[346]
ids = [3]

====================================================================================

UMI info for barcode CATATTCGTGGTCTCG-1 contig 1 = GAGGAACTGC...
umi ATCGAATGTT = 348 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=548]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQRSNWPTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 342
start codons at 33, 238, 241, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.879 = CATATTCGTGTATGGG-1

using 152 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[7, 143]
surviving nonsolo ucounts = 1[143]
ids = [0]

====================================================================================

UMI info for barcode CATATTCGTGTATGGG-1 contig 1 = GCTGGGGTCT...
umi ACAACCCAGA = 141 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=512]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-385 ==> 0-344 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
385-423 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
423-512 ==> 0-89 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CSSYTSSWVF at 365, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 139
start codons at 41, 198, 242, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.895 = CATATTCTCAGGATCT-1

using 190 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[6, 180]
surviving nonsolo ucounts = 1[180]
ids = [2]

====================================================================================

UMI info for barcode CATATTCTCAGGATCT-1 contig 1 = GATCAGGACT...
umi CACCGTGCAC = 169 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=511]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-511 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 168
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.897 = CATATTCTCATCTGTT-1

using 385 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[381]
surviving nonsolo ucounts = 1[381]
ids = [1]

====================================================================================

UMI info for barcode CATATTCTCATCTGTT-1 contig 1 = GTCAGACCCA...
umi ACACGTCTCG = 362 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
411-495 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 69 reads
cdr3 = CQQYNSYPYTF at 350, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 356
start codons at 23, 29, 85, 98, 330, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.899 = CATATTCTCATGGTCA-1

using 315 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 5, 301]
surviving nonsolo ucounts = 1[301]
ids = [1]

====================================================================================

UMI info for barcode CATATTCTCATGGTCA-1 contig 1 = AGAGCTCTGG...
umi CACATATTTG = 282 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=521]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
390-429 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
429-521 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYNNWPPYTF at 365, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 44, 113, 249, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.901 = CATATTCTCATGTGGT-1

using 153 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3^2, 141]
surviving nonsolo ucounts = 1[141]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.902 = CATATTCTCATTCACT-1

using 2212 reads

====================================================================================

graph has 1876 edges initially, 14 edges after simplification

total ucounts = 524
nonsolo ucounts = 233[2^91, 3^57, 4^33, 5^16, 6^11, 7^7, 8^3, 9^4, 10^3, 11^2, 12^2, 14^2, 343, 734]
surviving nonsolo ucounts = 2[343, 734]
ids = [470, 333]

====================================================================================

UMI info for barcode CATATTCTCATTCACT-1 contig 1 = GAGGAACTGC...
umi TGTTGCATCC = 328 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=510]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-510 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 69 reads
cdr3 = CQQRSNWPPLTF at 354, score = 9 + 9
umis assigned: [470]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 33, 238, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.904 = CATATTCTCCAGAAGG-1

using 262 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[255]
surviving nonsolo ucounts = 1[255]
ids = [7]

====================================================================================

UMI info for barcode CATATTCTCCAGAAGG-1 contig 1 = GAGTCAGGAC...
umi TGAAATCCTG = 257 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=539]
15-366 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=10)
366-403 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
403-539 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQANSFPLTF at 342, score = 9 + 9
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 15, 21, 77, 90, 229, 247, 445
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.911 = CATATTCTCCTTTCTC-1

using 390 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 3, 5^2, 36, 334]
surviving nonsolo ucounts = 2[36, 334]
ids = [8, 2]

====================================================================================

UMI info for barcode CATATTCTCCTTTCTC-1 contig 1 = GAGAAGAGCT...
umi AGATTTGGGA = 332 reads: +385 validated
umi GGCGCTTCGC = 35 reads: -332 +1 -8X +2 -4X +1 -3X +20 -1X +13 invalidated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=9)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYGSSPGTF at 359, score = 8 + 8
umis assigned: [2, 8]
of which 2 are surviving nonsolos
reads assigned: 364
start codons at 35, 243, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.914 = CATATTCTCGTTGCCT-1

using 160 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[155]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.917 = CATATTCTCTCCGGTT-1

using 96 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 3, 84]
surviving nonsolo ucounts = 1[84]
ids = [2]

====================================================================================

UMI info for barcode CATATTCTCTCCGGTT-1 contig 1 = ACCCAAAAAC...
umi CCAGGGGGTT = 1 reads: -291 +4 -1 +12 -1 +1 -1 +19 -1 +16 -89 non-validated
umi CCAGTGGGGT = 82 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=490]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=21)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 6 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [1, 2]
of which 1 are surviving nonsolos
reads assigned: 81
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.923 = CATATTCTCTTCGAGA-1

using 733 reads

====================================================================================

graph has 486 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^2, 323, 399]
surviving nonsolo ucounts = 2[323, 399]
ids = [6, 1]

====================================================================================

UMI info for barcode CATATTCTCTTCGAGA-1 contig 1 = GATCAGGACT...
umi ATTCATGGTC = 404 reads: +394 validated
umi TACTTGACAA = 323 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=560]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=6)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 119 reads
cdr3 = CMQGLQTYTF at 366, score = 9 + 8
umis assigned: [1, 6]
of which 2 are surviving nonsolos
reads assigned: 709
start codons at 30, 63, 99, 187, 349, 369, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.934 = CATCAAGAGAGTCTGG-1

using 343 reads

====================================================================================

graph has 433 edges initially, 4 edges after simplification

total ucounts = 136
nonsolo ucounts = 65[2^20, 3^14, 4^9, 5^11, 6^2, 8^4, 9, 11^3, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.936 = CATCAAGAGATCCCGC-1

using 134 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 4, 120]
surviving nonsolo ucounts = 1[120]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.942 = CATCAAGAGCTCTCGG-1

using 265 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[5, 6, 251]
surviving nonsolo ucounts = 1[251]
ids = [1]

====================================================================================

UMI info for barcode CATCAAGAGCTCTCGG-1 contig 1 = ACAAGAGGCA...
umi GATGTCTCGT = 243 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=558]
0-32 ==> 130-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
32-372 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=23)
389-417 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
417-558 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 42 reads
cdr3 = CFSYGSSGRTF at 356, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 32, 240, 366
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.945 = CATCAAGAGGACATTA-1

using 61 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 7, 45]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.950 = CATCAAGAGGTCGGAT-1

using 114 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 4, 107]
surviving nonsolo ucounts = 1[107]
ids = [0]

====================================================================================

UMI info for barcode CATCAAGAGGTCGGAT-1 contig 1 = CTCAGTCAGG...
umi CGTATATGCA = 103 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=420]
17-368 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=1)
367-405 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 12 reads
cdr3 = CQKYNSAPWTF at 344, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 102
start codons at 17, 23, 79, 92, 228, 327
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.951 = CATCAAGAGGTGATAT-1

using 12 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.952 = CATCAAGAGGTGCTAG-1

using 1929 reads

====================================================================================

graph has 2304 edges initially, 22 edges after simplification

total ucounts = 723
nonsolo ucounts = 297[2^115, 3^68, 4^43, 5^23, 6^10, 7^16, 8^7, 9^3, 10^5, 11, 12^2, 13, 16, 162, 251]
surviving nonsolo ucounts = 2[162, 251]
ids = [36, 133]

====================================================================================

UMI info for barcode CATCAAGAGGTGCTAG-1 contig 1 = CAGGAAGCAG...
umi AGTCTCCACT = 242 reads: +376 validated

UMI info for barcode CATCAAGAGGTGCTAG-1 contig 2 = GATCTGGGGG...
umi AATAAGCCGG = 158 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=517]
0-29 ==> 23-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
29-369 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
367-405 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
405-517 ==> 0-112 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQAWDSSTVVF at 344, score = 6 + 8
umis assigned: [133]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 29, 34, 90, 177, 323, 327
confident = false

TIG 2[bases=563]
0-63 ==> 51-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
63-416 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=10)
413-451 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
451-563 ==> 0-112 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CAVWDDSLNGVVF at 384, score = 8 + 8
umis assigned: [36]
of which 1 are surviving nonsolos
reads assigned: 156
start codons at 63, 274, 367, 392, 397, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.954 = CATCAAGAGGTGGGTT-1

using 293 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 3, 4^2, 278]
surviving nonsolo ucounts = 1[278]
ids = [3]

====================================================================================

UMI info for barcode CATCAAGAGGTGGGTT-1 contig 1 = GGTAGCTCAG...
umi CTTTCAGCGG = 274 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=590]
0-36 ==> 50-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
36-389 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=10)
389-427 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
427-590 ==> 0-163 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 42 reads
cdr3 = CQSYDSSNQAVF at 363, score = 6 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 36, 99, 190, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.961 = CATCAAGAGTCGTTTG-1

using 179 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[175]
surviving nonsolo ucounts = 1[175]
ids = [0]

====================================================================================

UMI info for barcode CATCAAGAGTCGTTTG-1 contig 1 = TGGGCCTCAG...
umi CGCGATAATG = 169 reads: +379 validated
umi CGCGATAATT = 1 reads: -330 +1 -1X +6 -1 +1 -1X +7 -1 +3 -1 +5 -1 +11 -2 +7 invalidated

GOOD CONTIGS

TIG 1[bases=580]
0-36 ==> 16-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
36-376 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
377-415 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
415-580 ==> 0-165 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQAWDSSTGVVF at 351, score = 6 + 8
umis assigned: [0, 1]
of which 1 are surviving nonsolos
reads assigned: 166
start codons at 36, 41, 97, 184, 330, 334
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.963 = CATCAAGAGTGAAGTT-1

using 272 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 6[2^2, 3^2, 7, 243]
surviving nonsolo ucounts = 1[243]
ids = [10]

====================================================================================

UMI info for barcode CATCAAGAGTGAAGTT-1 contig 1 = ACCCAAAAAC...
umi GTCTGTCACA = 242 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=571]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-571 ==> 0-81 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.965 = CATCAAGAGTTACCCA-1

using 71 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 67]
surviving nonsolo ucounts = 1[67]
ids = [3]

====================================================================================

UMI info for barcode CATCAAGAGTTACCCA-1 contig 1 = AGCTCTGAGA...
umi CTTCCGTCAT = 69 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=536]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-536 ==> 0-33 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 7 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 67
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.974 = CATCAAGCAAGAAAGG-1

using 244 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 1[236]
surviving nonsolo ucounts = 1[236]
ids = [4]

====================================================================================

UMI info for barcode CATCAAGCAAGAAAGG-1 contig 1 = GAAGAGCTGC...
umi GACCCCTAGT = 225 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=471]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-471 ==> 0-50 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQYGSSPPWSF at 357, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 33, 241, 367, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.975 = CATCAAGCAAGACACG-1

using 433 reads

====================================================================================

graph has 202 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 200, 227]
surviving nonsolo ucounts = 2[200, 227]
ids = [1, 2]

====================================================================================

UMI info for barcode CATCAAGCAAGACACG-1 contig 1 = GGGAGAGCCC...
umi AGACTCATGA = 187 reads: +388 validated

UMI info for barcode CATCAAGCAAGACACG-1 contig 2 = TGGGGGCTTT...
umi CATACAAACC = 225 reads: +457 validated

GOOD CONTIGS

TIG 1[bases=508]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
397-435 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
435-508 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQRSNWPPAWTF at 368, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 47, 252, 255, 477
confident = false

TIG 2[bases=563]
19-396 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=35)
423-476 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=6)
476-563 ==> 0-87 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 39 reads
cdr3 = CARPILARAGGMPAYFFDLW at 385, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 19, 28, 40, 84, 164, 181, 418
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.981 = CATCAAGCAATGGTCT-1

using 168 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 160]
surviving nonsolo ucounts = 1[160]
ids = [1]

====================================================================================

UMI info for barcode CATCAAGCAATGGTCT-1 contig 1 = GTGGGCACAA...
umi ATACCACTTC = 153 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=467]
0-37 ==> 14-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
37-393 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
393-431 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
431-467 ==> 0-36 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQSYDSSLSGLYVF at 361, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 150
start codons at 37, 191, 194, 245, 344, 371, 395
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.994 = CATCAAGCAGATAATG-1

using 359 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 351]
surviving nonsolo ucounts = 1[351]
ids = [4]

====================================================================================

UMI info for barcode CATCAAGCAGATAATG-1 contig 1 = AGCTTCAGCT...
umi TTAGGATAGC = 347 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=589]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-589 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 341
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1001 = CATCAAGCATCCGGGT-1

using 470 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[8, 462]
surviving nonsolo ucounts = 1[462]
ids = [0]

====================================================================================

UMI info for barcode CATCAAGCATCCGGGT-1 contig 1 = TGGGAGGAGT...
umi ACCACTAGGC = 463 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=22)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 80 reads
cdr3 = CQQSNIPPRMF at 358, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 458
start codons at 31, 37, 93, 106, 242, 385, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1003 = CATCAAGCATCGATTG-1

using 661 reads

====================================================================================

graph has 226 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 651]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1006 = CATCAAGCATGCTGGC-1

using 41 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[37]
surviving nonsolo ucounts = 1[37]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1008 = CATCAAGCATGTCCTC-1

using 67 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 14[2^7, 3, 5, 6, 7^2, 9, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1013 = CATCAAGCATTTCAGG-1

using 682 reads

====================================================================================

graph has 200 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^3, 334, 338]
surviving nonsolo ucounts = 2[334, 338]
ids = [2, 7]

====================================================================================

UMI info for barcode CATCAAGCATTTCAGG-1 contig 1 = GAGCTGCTCA...
umi CTCAGGTCAC = 46 reads: -319 +10 -1XX +7 -2XX +2 -4XX +2 -4XX +21 -1XX +5 -1XX +6 invalidated
umi TAGCCTAGGG = 342 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=551]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQQYGSSPRTF at 354, score = 9 + 8
umis assigned: [2, 7]
of which 2 are surviving nonsolos
reads assigned: 380
start codons at 30, 238, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1023 = CATCAAGGTCAAGCGA-1

using 445 reads

====================================================================================

graph has 419 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[6, 439]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1028 = CATCAAGGTCCGTTAA-1

using 225 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[225]
surviving nonsolo ucounts = 1[225]
ids = [0]

====================================================================================

UMI info for barcode CATCAAGGTCCGTTAA-1 contig 1 = TGAGCGCAGA...
umi TTATTGCCCC = 216 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=520]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-170 ==> 0-134 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=3)
170-356 ==> 140-326 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=17)
386-424 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
424-520 ==> 0-96 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CGTWDGSLRTGHYVF at 351, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 36, 184, 364, 388
confident = false
see deletion of 6 bases at pos 134 on |331|IGLV1-51|L-REGION+V-REGION|
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1031 = CATCAAGGTCTCGTTC-1

using 146 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 5, 136]
surviving nonsolo ucounts = 1[136]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=449]
0-356 ==> 2-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=12)
387-437 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
cdr3 = CAHRLSGALVWEYVKDTFDIW at 343, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 122
start codons at 42, 221, 224, 304, 313, 380, 418
confident = false
VJ delta = 12
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1046 = CATCAAGGTTTACTCT-1

using 656 reads

====================================================================================

graph has 232 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[46, 602]
surviving nonsolo ucounts = 1[602]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=466]
3-217 ==> 142-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=8)
217-255 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
255-466 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 185, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 596
start codons at 15, 18, 69, 168, 195, 219, 387
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1061 = CATCAAGTCCGCGCAA-1

using 181 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[7, 173]
surviving nonsolo ucounts = 1[173]
ids = [0]

====================================================================================

UMI info for barcode CATCAAGTCCGCGCAA-1 contig 1 = CTCCCTCACT...
umi ACTGGAAACC = 173 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=504]
0-54 ==> 5-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=20)
430-478 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
478-504 ==> 0-26 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARILSFRDSSGYFDNW at 396, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 54, 228, 252, 387
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1066 = CATCAAGTCGCCCTTA-1

using 323 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[27, 294]
surviving nonsolo ucounts = 1[294]
ids = [1]

====================================================================================

UMI info for barcode CATCAAGTCGCCCTTA-1 contig 1 = GGAACACTTA...
umi GCAGACCACG = 288 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=534]
16-384 ==> 0-368 on |390|IGLV8-61|L-REGION+V-REGION| [len=368] (mis=26)
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
419-534 ==> 0-115 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CVLFMGRGIWEF at 355, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 16, 31, 40, 43, 68, 248, 335, 338, 342, 367
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1073 = CATCAAGTCTGACCTC-1

using 222 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 218]
surviving nonsolo ucounts = 1[218]
ids = [1]

====================================================================================

UMI info for barcode CATCAAGTCTGACCTC-1 contig 1 = AAGCATCATC...
umi ACCTCGGCTG = 211 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=569]
0-62 ==> 242-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
62-415 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=8)
432-480 ==> 15-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
480-569 ==> 0-89 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 21 reads
cdr3 = CARVHTVVEDGMDVW at 404, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 62, 218, 260, 326, 359, 437
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1076 = CATCAAGTCTTCAACT-1

using 5379 reads

====================================================================================

graph has 5262 edges initially, 116 edges after simplification

total ucounts = 1319
nonsolo ucounts = 635[2^258, 3^140, 4^88, 5^57, 6^33, 7^21, 8^17, 9^3, 10^5, 11^2, 13, 14^2, 15, 21, 75, 248, 252, 314, 597, 979]
surviving nonsolo ucounts = 6[75, 248, 252, 314, 597, 979]
ids = [729, 64, 523, 389, 923, 213]

====================================================================================

UMI info for barcode CATCAAGTCTTCAACT-1 contig 1 = GTGGGTCCAG...
umi CATCTTTTGT = 309 reads: -320X +2 -2XX +1 -2XX +55 invalidated
umi CGAGGTGGGT = 254 reads: +382 validated
umi GATGTACATT = 75 reads: +309 -1 +1 -1 +12 -1 +11 -1 +45 non-validated

GOOD CONTIGS

TIG 1[bases=628]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
379-417 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
417-628 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQSADSSGTYVVF at 350, score = 8 + 8
umis assigned: [389, 523, 729]
of which 3 are surviving nonsolos
reads assigned: 627
start codons at 35, 96, 165, 183, 378
confident = true

REJECT CONTIGS

TIG 1[bases=638]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
10-65 ==> 5937-5992 on segment before IGLV2-5 exon 1 [len=6137] (mis=2)
19-85 ==> 5809-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=3)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=2)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
427-638 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [64, 213]
of which 2 are surviving nonsolos
reads assigned: 1215
start codons at 38, 177, 239, 246, 372
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1077 = CATCAAGTCTTGTCAT-1

using 163 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 3, 157]
surviving nonsolo ucounts = 1[157]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1079 = CATCAGAAGAACAACT-1

using 384 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[382]
surviving nonsolo ucounts = 1[382]
ids = [2]

====================================================================================

UMI info for barcode CATCAGAAGAACAACT-1 contig 1 = GGAGGAACTG...
umi GTCTTCATCG = 383 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CLQYYNWPRTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 376
start codons at 34, 89, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1082 = CATCAGAAGACAATAC-1

using 422 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^4, 412]
surviving nonsolo ucounts = 1[412]
ids = [0]

====================================================================================

UMI info for barcode CATCAGAAGACAATAC-1 contig 1 = GAAGAGCTGC...
umi AAATTCTCCT = 377 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=507]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=14)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-507 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYGRSPGTF at 357, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 370
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1083 = CATCAGAAGACACGAC-1

using 530 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[528]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode CATCAGAAGACACGAC-1 contig 1 = GGGAACCACA...
umi TGATCACCTG = 531 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=531]
51-404 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=12)
422-460 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=1)
460-531 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CATGLLGGPIYW at 393, score = 9 + 7
umis assigned: [2]
of which 0 are surviving nonsolos
reads assigned: 522
start codons at 51, 202, 249, 254, 258, 286, 315, 333, 348
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1084 = CATCAGAAGACGCAAC-1

using 1377 reads

====================================================================================

graph has 448 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 8, 1361]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1091 = CATCAGAAGAGTTGGC-1

using 314 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 4, 304]
surviving nonsolo ucounts = 1[304]
ids = [2]

====================================================================================

UMI info for barcode CATCAGAAGAGTTGGC-1 contig 1 = GGAGTCAGAC...
umi CGCCTTATCT = 308 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYNSYALSF at 353, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 301
start codons at 26, 32, 88, 101, 237, 240, 333, 372, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1092 = CATCAGAAGATATGCA-1

using 72 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 10[2^2, 3, 4, 7, 8, 9, 10, 11^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1093 = CATCAGAAGATCCTGT-1

using 9925 reads

====================================================================================

graph has 4566 edges initially, 42 edges after simplification

total ucounts = 619
nonsolo ucounts = 300[2^79, 3^69, 4^38, 5^24, 6^25, 7^8, 8^5, 9^4, 11, 12^2, 13^2, 14, 15^2, 18, 21, 88, 92, 99, 105, 124, 152, 170, 171, 187, 188^2, 195, 196, 197, 202, 204, 207, 211, 212, 216^2, 227, 228, 235, 236, 241, 250, 253, 255, 256, 261, 307, 312^2, 335, 336, 419, 460]
surviving nonsolo ucounts = 38[88, 92, 99, 105, 124, 152, 170, 171, 187, 188^2, 195, 196, 197, 202, 204, 207, 211, 212, 216^2, 227, 228, 235, 236, 241, 250, 253, 255, 256, 261, 307, 312^2, 335, 336, 419, 460]
ids = [337, 11, 114, 284, 558, 448, 239, 161, 372, 75, ...]

====================================================================================

UMI info for barcode CATCAGAAGATCCTGT-1 contig 1 = GGAGTCTCCC...
umi ACACCATGCG = 229 reads: +420 -4 non-validated
umi ACCTGGCAGC = 246 reads: +419 -5 non-validated
umi ACTCCAATAG = 261 reads: +424 validated
umi ACTCTTAATC = 210 reads: +424 validated
umi ACTGCTGTTC = 187 reads: +420 -4 non-validated
umi ACTGGCTCCT = 418 reads: +424 validated
umi AGACGGTGTA = 192 reads: +424 validated
umi AGACGGTGTC = 211 reads: +408 -2 +2 -1 +1 -10 non-validated
umi ATCGTATCAG = 89 reads: +409 -1 +2 -1 +11 non-validated
umi CACGTTCCAG = 311 reads: +424 validated
umi CATTGCATGA = 252 reads: +424 validated
umi CCGAAACGAC = 205 reads: +424 validated
umi CGCTTTGGGC = 253 reads: +424 validated
umi CGTAGCCACC = 170 reads: +424 validated
umi CTGGGTCCGT = 262 reads: +424 validated
umi CTTTAATTTA = 309 reads: +407 -17 non-validated
umi GACCGATTTC = 237 reads: +424 validated
umi GCACCACTCG = 217 reads: +424 validated
umi GCCCGATACT = 88 reads: +411 -13 non-validated
umi GCTTGGCTAT = 196 reads: +424 validated
umi GGACCACCTG = 201 reads: +424 validated
umi GGTGAACGCA = 216 reads: +424 validated
umi GTACTGTCTG = 195 reads: +424 validated
umi TAAACCCCTC = 250 reads: +424 validated
umi TACGATTGTT = 217 reads: +424 validated
umi TATATCCAAG = 155 reads: +424 validated
umi TGGTATTGTA = 208 reads: +424 validated

UMI info for barcode CATCAGAAGATCCTGT-1 contig 2 = AGGAGTCAGA...
umi ATTATATCAT = 334 reads: +391 validated
umi CATTAGCCCT = 169 reads: +391 validated
umi CTGTTGCATA = 99 reads: -367 +24 non-validated
umi GATATGCTAC = 447 reads: -357X +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi TATACATCGG = 315 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=554]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=3)
435-483 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
483-554 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 20 umis using 317 reads
cdr3 = CARTPVRGVPINYFDYW at 401, score = 8 + 7
umis assigned: [42, 58, 73, 74, 75, 76, 83, 84, 114, 149] and 17 others
of which 27 are surviving nonsolos
reads assigned: 5881
start codons at 59, 233, 257, 392
confident = true

TIG 2[bases=554]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=5)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 149 reads
cdr3 = CQQYNSYSPYTF at 354, score = 8 + 8
umis assigned: [120, 161, 284, 316, 445]
of which 5 are surviving nonsolos
reads assigned: 1341
start codons at 27, 33, 89, 102, 238, 241, 334, 460
confident = true

REJECT CONTIGS

TIG 1[bases=636]
2-122 ==> 5880-6000 on rc of segment after IGHV3-20 exon 1 [len=6000] (mis=3)
2-122 ==> 1950-2070 on rc of segment before IGHVII-43-1 exon 1 [len=2070] (mis=3)
7-130 ==> 6423-6546 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=11)
122-477 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=30)
488-534 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
534-636 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [11, 372, 383, 495, 558, 590]
of which 6 are surviving nonsolos
reads assigned: 972
start codons at 14, 122, 267, 273, 278, 357, 425, 472, 492, 552, 613
confident = false
full length stopped transcript of length 636
frameshifted full length stopped transcript of length 636
did not find CDR3
now this is a cell
paired!

GACACCGCCATGTATTACTGTGCGAGAACCCCCGTTCGGGGAGTCCCTATAAACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTCTCCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1099 = CATCAGAAGCGATATA-1

using 343 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 6, 8, 324]
surviving nonsolo ucounts = 1[324]
ids = [5]

====================================================================================

UMI info for barcode CATCAGAAGCGATATA-1 contig 1 = AGGACTCCTC...
umi CTTATTAGAG = 316 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=507]
0-26 ==> 4-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
26-386 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
388-426 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
426-507 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 53 reads
cdr3 = CMQALQTPLFTF at 362, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 26, 59, 95, 183, 345, 365, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1100 = CATCAGAAGCGATCCC-1

using 191 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 188]
surviving nonsolo ucounts = 1[188]
ids = [0]

====================================================================================

UMI info for barcode CATCAGAAGCGATCCC-1 contig 1 = AGGTTCCAGC...
umi AGGACACCTT = 188 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=550]
0-58 ==> 43-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=1)
58-414 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=12)
428-479 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
479-550 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARDLHSSGKWFDPW at 403, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 186
start codons at 14, 58, 102
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1103 = CATCAGAAGCTAAGAT-1

using 162 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[3, 4, 8, 141]
surviving nonsolo ucounts = 1[141]
ids = [6]

====================================================================================

UMI info for barcode CATCAGAAGCTAAGAT-1 contig 1 = GGGGATCAGT...
umi GTGCCTCTAC = 128 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=482]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-482 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1109 = CATCAGAAGGCTATCT-1

using 244 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[242]
surviving nonsolo ucounts = 1[242]
ids = [0]

====================================================================================

UMI info for barcode CATCAGAAGGCTATCT-1 contig 1 = GCTCTGCTTC...
umi ACCGTTTCCG = 242 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=575]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=22)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=6)
442-575 ==> 0-133 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 40 reads
cdr3 = CQSYDSILTGWAF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 51, 205, 358, 385, 521
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1112 = CATCAGAAGGTAAACT-1

using 258 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 6[2^2, 4, 5, 9, 227]
surviving nonsolo ucounts = 1[227]
ids = [6]

====================================================================================

UMI info for barcode CATCAGAAGGTAAACT-1 contig 1 = GCAGGAGTCA...
umi CCTGCACTCG = 215 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=512]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-512 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CLQDYTYPFSF at 356, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 29, 35, 91, 104, 186, 189, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1114 = CATCAGAAGTACGTTC-1

using 288 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 284]
surviving nonsolo ucounts = 1[284]
ids = [1]

====================================================================================

UMI info for barcode CATCAGAAGTACGTTC-1 contig 1 = GAATCAGTCC...
umi TGCTTACCCT = 285 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1115 = CATCAGAAGTAGGCCA-1

using 10750 reads

====================================================================================

graph has 5878 edges initially, 52 edges after simplification

total ucounts = 1181
nonsolo ucounts = 507[2^192, 3^84, 4^68, 5^41, 6^29, 7^13, 8^14, 9^6, 10^3, 11^5, 12^4, 13, 15^2, 16, 20, 21, 32, 36, 74, 77, 99, 105, 110, 111, 124, 145, 147, 161, 162, 169, 180, 181, 187, 194, 196, 202, 214, 215, 216, 220, 221, 229, 233, 236, 246, 249^2, 251, 257, 261, 263^2, 272, 279, 290, 293, 308, 342]
surviving nonsolo ucounts = 39[74, 77, 99, 105, 110, 111, 124, 147, 161, 162, 169, 180, 181, 187, 194, 196, 202, 214, 215, 216, 220, 221, 229, 233, 236, 246, 249^2, 251, 257, 261, 263^2, 272, 279, 290, 293, 308, 342]
ids = [463, 411, 1021, 788, 880, 616, 1075, 902, 6, 115, ...]

====================================================================================

UMI info for barcode CATCAGAAGTAGGCCA-1 contig 1 = AGAGCTCTGG...
umi ATTGGCAGTG = 170 reads: +385 validated
umi CCACGCGTTC = 269 reads: +385 validated
umi CCCGGTTGCT = 341 reads: +385 validated
umi TCACTCCGAT = 201 reads: +385 validated
umi TTTCATACCG = 251 reads: +385 validated

UMI info for barcode CATCAGAAGTAGGCCA-1 contig 2 = GGAGTCTCCC...
umi AAAACTGGGG = 249 reads: +399 -1 +4 -23 non-validated
umi AAACACTTAC = 155 reads: +380 -12 +35 non-validated
umi ACCCCATTCT = 163 reads: +427 validated
umi ACGATCTTCT = 185 reads: +421 -1XX +5 invalidated
umi ACTCCTTTGT = 173 reads: +427 validated
umi ACTTAAGCAG = 220 reads: +427 validated
umi AGATAAGCGG = 315 reads: +427 validated
umi ATGGTTGTAA = 208 reads: +427 validated
umi CACCTTGACC = 278 reads: +427 validated
umi CATTAGACCG = 252 reads: +427 validated
umi CCACTGTATG = 65 reads: -402 +2 -1X +3 -2X +6 -1X +10 invalidated
umi CCCGTATCTG = 216 reads: +389 -1 +37 non-validated
umi CCGGGACCGA = 73 reads: +405 -22 non-validated
umi CGCTAGCGCA = 216 reads: +388 -12 +27 non-validated
umi CTCCAATGCC = 139 reads: -393X +1 -1X +1 -4X +1 -16XX +1 -1XX +1 -6XX +1 invalidated
umi CTTAATTCGC = 259 reads: +427 validated
umi CTTCCAAGCG = 107 reads: +425 -2 non-validated
umi CTTGTTATGT = 232 reads: +427 validated
umi GAGACTGTTG = 251 reads: +427 validated
umi GGACCTCGAT = 236 reads: +418 -9 non-validated
umi GGGTACCTAT = 105 reads: +373 -1 +2 -1 +32 -18 non-validated
umi TAAAACACAC = 192 reads: +427 validated
umi TAATATAGTT = 109 reads: +378 -1X +5 -43 invalidated
umi TACGTTGCCG = 146 reads: +357 -28 +42 non-validated
umi TAGTTCTCTT = 277 reads: +427 validated
umi TATCACCCTG = 239 reads: +427 validated
umi TCCCGTCCGT = 195 reads: +427 validated
umi TCCGCCCGGC = 292 reads: +427 validated
umi TGAACGGGTA = 98 reads: +388 -1 +2 -36 non-validated
umi TGATATATTG = 219 reads: +427 validated
umi TGTCTTCATT = 119 reads: +427 validated
umi TGTTGCGCGC = 228 reads: +391 -1 +22 -13 non-validated
umi TTCAGTGTAT = 182 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 5 umis using 173 reads
cdr3 = CQQYGSSSLTF at 368, score = 9 + 9
umis assigned: [295, 409, 440, 941, 1149]
of which 5 are surviving nonsolos
reads assigned: 1219
start codons at 44, 252, 378, 471
confident = true

TIG 2[bases=557]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=2)
433-486 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=3)
486-557 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 18 umis using 242 reads
cdr3 = CARLGGFVVVPAWYFDLW at 401, score = 8 + 7
umis assigned: [4, 6, 115, 135, 152, 159, 175, 276, 335, 389] and 23 others
of which 33 are surviving nonsolos
reads assigned: 6289
start codons at 59, 233, 257, 392
confident = true
now this is a cell
paired!

ACCGCCATGTATTACTGTGCGAGACTCGGGGGGTTTGTAGTAGTACCAGCCTGGTACTTCGATCTCTGGGGCCGTGGCACCCTGGTCACTGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCTTCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1116 = CATCAGAAGTATTGGA-1

using 263 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[6, 256]
surviving nonsolo ucounts = 1[256]
ids = [2]

====================================================================================

UMI info for barcode CATCAGAAGTATTGGA-1 contig 1 = AGTGCTTTCT...
umi TTCAATATAG = 255 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=539]
17-247 ==> 0-230 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=7)
259-400 ==> 230-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=15)
422-468 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
468-539 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARGAALSGTVIIDYW at 389, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 17, 38, 82, 168
confident = false
see insertion of CAGTCAGACTGA at pos 230 on |186|IGHV4-34|L-REGION+V-REGION|
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1119 = CATCAGAAGTCTCGGC-1

using 532 reads

====================================================================================

graph has 190 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[5, 9, 228, 283]
surviving nonsolo ucounts = 2[228, 283]
ids = [2, 10]

====================================================================================

UMI info for barcode CATCAGAAGTCTCGGC-1 contig 1 = GGGAGGAATC...
umi CATGTGTGTT = 209 reads: +388 validated
umi TTGCTGCGCC = 255 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=511]
30-381 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-511 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 71 reads
cdr3 = CLQYSSSPWTF at 357, score = 9 + 8
umis assigned: [2, 10]
of which 2 are surviving nonsolos
reads assigned: 461
start codons at 30, 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1142 = CATCAGACAGCTGTTA-1

using 757 reads

====================================================================================

graph has 276 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[256, 498]
surviving nonsolo ucounts = 2[256, 498]
ids = [3, 4]

====================================================================================

UMI info for barcode CATCAGACAGCTGTTA-1 contig 1 = AGCTTCAGCT...
umi TTACACGGTT = 496 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=594]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-594 ==> 0-159 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 81 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 484
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1143 = CATCAGACAGGACCCT-1

using 171 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[168]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=481]
2-350 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=15)
379-414 ==> 11-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
414-481 ==> 0-67 on |40|IGHG1|C-REGION| [len=884] (mis=0)
cdr3 = CASMVQGVIKIW at 347, score = 9 + 8
umis assigned: [3]
of which 0 are surviving nonsolos
reads assigned: 148
start codons at 46, 356
confident = false
VJ delta = -2
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1145 = CATCAGACAGGTCCAC-1

using 665 reads

====================================================================================

graph has 228 edges initially, 28 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 311, 346]
surviving nonsolo ucounts = 2[311, 346]
ids = [5, 2]

====================================================================================

UMI info for barcode CATCAGACAGGTCCAC-1 contig 1 = GAGGAGTCAG...
umi CAGAGGATTC = 348 reads: +391 validated
umi TGCTTTCCTC = 264 reads: +41 -1XX +10 -1XX +8 -1XX +27 -1XX +3 -1XX +16 -1XX +29 -1XX +2 -1XX +2 -1XX +1 -2XX +5 -1XX +1 -1XX +2 -2XX +2 -4XX +32 -1XX +8 -1XX +4 -1XX +3 -1XX +4 -1XX +4 -1XX +25 -1XX +18 -1XX +22 -1XX +5 -1XX +5 -1XX +14 -1XX +5 -1XX +2 -32 +2 -3X +5 -1XX +3 -1XX +5 -1XX +6 invalidated

GOOD CONTIGS

TIG 1[bases=555]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQSYSTLSYTF at 355, score = 9 + 8
umis assigned: [2, 5]
of which 2 are surviving nonsolos
reads assigned: 608
start codons at 28, 34, 90, 103, 239, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1153 = CATCAGACATCGTCGG-1

using 40776 reads

====================================================================================

graph has 14635 edges initially, 190 edges after simplification

total ucounts = 1948
nonsolo ucounts = 993[2^331, 3^208, 4^123, 5^55, 6^45, 7^28, 8^13, 9^8, 10^9, 11^4, 12^8, 13^3, 14^2, 15, 16^3, 17, 18, 20, 23, 36, 43, 45^2, 50, 57^2, 65, 68^2, 71, 74, 79, 84, 92, 98, 99, 102, 106, 108, 117, 119, 130, 138^2, 139, 141, 142, 143, 147, 150, 153, 157, 160^2, 163, 170, 176, 177, 178^4, 180^2, 183^2, 184, 185, 186, 188, 189, 190^3, 191, 192, 197, 200, 201, 202, 203, 206^2, 207, 208, 211, 212, 214^3, 215, 218, 221, 222, 223^2, 224, 227^2, 228, 231, 232, 234^2, 237, 239, 240, 241, 242^3, 243, 244, 245, 246, 248, 251, 252^2, 255^3, 260, 261^2, 263^2, 265, 269^2, 270^2, 271, 273, 275^2, 276, 279, 280, 281, 285, 287, 288, 291, 302, 303, 306, 311, 324, 332, 342, 343, 350, 358, 364, 388, 461, 520, 525, 585, 621, 685, 821, 873, 1047, 1063, 1379]
surviving nonsolo ucounts = 142[57, 65, 68^2, 71, 74, 79, 84, 92, 98, 99, 102, 106, 108, 117, 119, 130, 138^2, 139, 141, 142, 143, 147, 150, 153, 157, 160^2, 163, 170, 176, 177, 178^4, 180^2, 183^2, 184, 185, 186, 188, 189, 190^3, 191, 192, 197, 200, 201, 202, 203, 206^2, 207, 208, 211, 212, 214^3, 215, 218, 221, 222, 223^2, 224, 227^2, 228, 231, 232, 234^2, 237, 239, 240, 241, 242^3, 243, 244, 245, 246, 248, 251, 252^2, 255^3, 260, 261^2, 263^2, 265, 269^2, 270^2, 271, 273, 275^2, 276, 279, 280, 281, 285, 287, 288, 291, 302, 303, 306, 311, 324, 332, 342, 343, 350, 358, 364, 388, 461, 520, 525, 585, 621, 685, 821, 873, 1047, 1063, 1379]
ids = [222, 1671, 420, 1522, 830, 808, 1115, 1299, 1300, 1664, ...]

====================================================================================

UMI info for barcode CATCAGACATCGTCGG-1 contig 1 = GGGGCTCCAA...
umi AACCAGCAAT = 191 reads: +388 validated
umi AAGGGTTAGA = 192 reads: +388 validated
umi AATAGTTGCA = 284 reads: -23 +365 non-validated
umi ACATACATTA = 221 reads: +388 validated
umi ACTTATAGCC = 8 reads: -388 non-validated
umi ACTTGTGGCA = 212 reads: +388 validated
umi AGCATGTCCG = 240 reads: +388 validated
umi AGCATTCAGT = 240 reads: +388 validated
umi AGCTCTTGGC = 282 reads: +388 validated
umi AGGATAGTGC = 250 reads: +388 validated
umi AGTATCCCGC = 1066 reads: -306X +1 -1XX +80 invalidated
umi ATAATTTTTA = 234 reads: +388 validated
umi ATAGACCTAG = 203 reads: +388 validated
umi ATCGTTGGTG = 294 reads: +388 validated
umi ATCTGTATCG = 198 reads: +388 validated
umi ATGGAAAAGC = 142 reads: +388 validated
umi ATGTCTCTCT = 330 reads: +388 validated
umi CAATTTACCC = 275 reads: +388 validated
umi CATACCTCCG = 369 reads: -59 +329 non-validated
umi CCCCGCCGTG = 177 reads: +388 validated
umi CCCGATACCC = 1052 reads: -308 +80 non-validated
umi CCGTCTATCG = 224 reads: +388 validated
umi CCGTTGGCAT = 234 reads: +388 validated
umi CCTCTGTTGT = 187 reads: +388 validated
umi CCTTAACGTG = 263 reads: +388 validated
umi CGACTCAGCT = 253 reads: +388 validated
umi CGCATACTTG = 19 reads: -388 non-validated
umi CGCCACTAGG = 248 reads: +388 validated
umi CGGTAGTAGT = 20 reads: -388 non-validated
umi CGTCATCAGT = 100 reads: +388 validated
umi CTTAGTTACA = 270 reads: +388 validated
umi GAAAGACCTG = 271 reads: +388 validated
umi GAGCGTCCGA = 21 reads: -388 non-validated
umi GAGGGTACGG = 230 reads: +388 validated
umi GCCACCCTCC = 620 reads: -165 +1 -2X +3 -8X +14 -1 +194 invalidated
umi GCCTGTATGG = 265 reads: +388 validated
umi GCGAAAAGGG = 161 reads: +388 validated
umi GCTGTGTCCT = 236 reads: +388 validated
umi GGGCCCGTTA = 278 reads: +388 validated
umi GGGGGTCCTC = 243 reads: +342 -3X +43 invalidated
umi GTGCTAGCTT = 516 reads: -147X +1 -2X +238 invalidated
umi GTTGTATGTC = 109 reads: +388 validated
umi TAAAACTGTT = 169 reads: +388 validated
umi TAAACTTTTG = 270 reads: +388 validated
umi TAACAGAGCC = 15 reads: -388 non-validated
umi TAAGATGTTG = 174 reads: +388 validated
umi TACGTTAGGT = 182 reads: -388 non-validated
umi TACGTTATCG = 190 reads: +388 validated
umi TACTAACTCC = 260 reads: +388 validated
umi TATCGTAGTA = 899 reads: +177 -5XX +3 -2XX +1 -5XX +3 -2XX +1 -189X invalidated
umi TCATAATACC = 266 reads: +388 validated
umi TCCATGGTGC = 828 reads: -256 +132 non-validated
umi TCCTCCGCTC = 224 reads: +388 validated
umi TCGAGTGGAG = 176 reads: +388 validated
umi TCTGCGTGCT = 246 reads: +388 validated
umi TCTGTTGCTA = 99 reads: -388 non-validated
umi TCTTCAAGGC = 105 reads: +388 validated
umi TGCCCTCAAC = 105 reads: -388 non-validated
umi TTGAGTGTCT = 196 reads: +388 validated
umi TTGTCTAGCA = 244 reads: +388 validated
umi TTGTGTTTCT = 175 reads: +388 validated
umi TTTCTCTCAC = 289 reads: +388 validated
umi TTTTTACCCT = 306 reads: +388 validated

UMI info for barcode CATCAGACATCGTCGG-1 contig 2 = GAGCTCTGGG...
umi AAAACGGTGT = 283 reads: +364 -42 non-validated
umi AAGATTTATG = 224 reads: +387 -19 non-validated
umi AATGTTCGTG = 130 reads: +406 validated
umi ACACAACACC = 201 reads: +406 validated
umi ACTCATTGTC = 57 reads: +287 -119 non-validated
umi ATAATAAATC = 244 reads: +406 validated
umi ATACCGATTC = 176 reads: +406 validated
umi ATCATAGCAT = 208 reads: +398 -1X +7 invalidated
umi ATGAAATCGA = 189 reads: +396 -10 non-validated
umi ATGGTCTGGC = 227 reads: +406 validated
umi ATTCCACTCT = 143 reads: +406 validated
umi ATTTCCCGCT = 174 reads: +377 -29 non-validated
umi CAAGGGTTGC = 255 reads: +406 validated
umi CATTACTGCT = 185 reads: +406 validated
umi CCATATATCC = 155 reads: +378 -28 non-validated
umi CCATCGGGGT = 157 reads: -219 +187 non-validated
umi CGGGATTGGA = 227 reads: +406 validated
umi CGTACACCAG = 72 reads: +306 -4X +2 -1 +2 -1 +1 -1 +4 -2 +6 -1 +1 -74 invalidated
umi CGTTACGTCC = 138 reads: +406 validated
umi CTCATTCCCT = 191 reads: +406 validated
umi CTGTACTTCG = 212 reads: +402 -2 +2 non-validated
umi CTTGATATAC = 283 reads: +406 validated
umi GAGGTCGCTA = 209 reads: +406 validated
umi GCAGCTGTGT = 234 reads: +406 validated
umi GCTCGGGCCT = 175 reads: +406 validated
umi GCTTATTGTG = 147 reads: +375 -31 non-validated
umi GGCACTTTGT = 206 reads: +406 validated
umi GGCTATCCAT = 185 reads: +367 -27 +11 -1 non-validated
umi GGCTTTCTCC = 203 reads: +406 validated
umi GGTTATTCCA = 147 reads: +34 -1XX +371 invalidated
umi GTACTCCACT = 191 reads: +400 -6 non-validated
umi GTAGGGAATC = 84 reads: +346 -8 +52 non-validated
umi GTATAATGGG = 87 reads: +396 -1 +9 non-validated
umi GTTGGACTAT = 183 reads: +406 validated
umi TACTCCATAT = 211 reads: +406 validated
umi TATTGCGCGC = 150 reads: +379 -1 +13 -13 non-validated
umi TCCAACTTAG = 216 reads: +406 validated
umi TCTCAGGCTT = 225 reads: +406 validated
umi TCTTCACAAA = 206 reads: +406 validated
umi TCTTGCGGGG = 62 reads: -220 +156 -1X +29 invalidated
umi TGATGTCGGG = 209 reads: +406 validated
umi TGCTCCAGTC = 138 reads: +377 -1 +9 -19 non-validated
umi TGTTCTGTCT = 680 reads: -220 +186 non-validated
umi TTTCGCGTTC = 226 reads: +398 -8 non-validated
umi TTTTAACTGG = 292 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=644]
45-397 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=19)
395-433 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
433-644 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 52 umis using 2281 reads
cdr3 = CSAWDSSLNVWVF at 366, score = 7 + 8
umis assigned: [39, 64, 76, 143, 243, 250, 279, 281, 296, 311] and 53 others
of which 63 are surviving nonsolos
reads assigned: 16359
start codons at 45, 184, 374, 391
confident = true

TIG 2[bases=557]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=22)
436-486 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
486-557 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 29 umis using 483 reads
cdr3 = CVKEEDAFDIW at 422, score = 9 + 8
umis assigned: [1, 61, 94, 126, 222, 372, 382, 412, 440, 459] and 35 others
of which 45 are surviving nonsolos
reads assigned: 8669
start codons at 80, 231, 236, 297, 383, 438, 467
confident = true

REJECT CONTIGS

TIG 1[bases=319]
30-187 ==> 0-157 on rc of segment before IGHJ3P exon 1 [len=157] (mis=0)
185-248 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
248-319 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [583, 1257]
of which 2 are surviving nonsolos
reads assigned: 612
start codons at 37, 71, 110, 165, 205
confident = false
did not find CDR3

TIG 2[bases=571]
5-81 ==> 5532-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
36-396 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=5)
397-435 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWGLLLHASSINSSITF at 356, score = 4 + 8
umis assigned: [230, 307, 308, 352, 387, 411, 420, 613, 924, 981] and 11 others
of which 21 are surviving nonsolos
reads assigned: 5169
start codons at 36, 69, 105, 156, 193, 355, 375, 477
confident = false
not full
frameshifted full length stopped transcript of length 571
VJ delta = 30
not full
now this is a cell
paired!

AACAGCCTGAGAGCTGAGGACACGGCTCTTTATTACTGTGTTAAAGAGGAGGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> GGACTCCAGCCTGACGACGAGGCTGACTATTACTGCTCAGCATGGGACAGCAGCCTCAATGTTTGGGTGTTCGGCGGAGGGACCAAACTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1157 = CATCAGACATGGTCTA-1

using 294 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 288]
surviving nonsolo ucounts = 1[288]
ids = [4]

====================================================================================

UMI info for barcode CATCAGACATGGTCTA-1 contig 1 = TGAGCGCAGA...
umi CTTCTGTAAG = 283 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-361 ==> 0-325 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=10)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
430-554 ==> 0-124 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CAVWDDSLDTGRGVF at 357, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 36, 190, 241, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1158 = CATCAGACATTAGGCT-1

using 187 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[187]
surviving nonsolo ucounts = 1[187]
ids = [0]

====================================================================================

UMI info for barcode CATCAGACATTAGGCT-1 contig 1 = GTCTCAGGAG...
umi CCTTCTTCTA = 187 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=492]
0-35 ==> 6-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=3)
35-379 ==> 0-344 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=20)
385-423 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
423-492 ==> 0-69 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CSSYISSTTLGF at 359, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 35, 243, 246
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1161 = CATCAGAGTAAATGTG-1

using 318 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[317]
surviving nonsolo ucounts = 1[317]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1164 = CATCAGAGTAATTGGA-1

using 29 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 26]
surviving nonsolo ucounts = 1[26]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1166 = CATCAGAGTACCGTAT-1

using 228 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[228]
surviving nonsolo ucounts = 1[228]
ids = [0]

====================================================================================

UMI info for barcode CATCAGAGTACCGTAT-1 contig 1 = TCAGTTAGGA...
umi TACAATCGCA = 215 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=499]
0-23 ==> 29-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
23-355 ==> 0-332 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=15)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
408-499 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQYDVSPCSF at 347, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 23, 119, 357, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1174 = CATCAGAGTAGTAGTA-1

using 182 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[181]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1175 = CATCAGAGTATTCGTG-1

using 253 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 245]
surviving nonsolo ucounts = 1[245]
ids = [3]

====================================================================================

UMI info for barcode CATCAGAGTATTCGTG-1 contig 1 = GGGAGTCAGG...
umi CAAGATACCG = 246 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=529]
17-356 ==> 0-339 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=5)
355-393 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
393-529 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYETF at 344, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 17, 23, 79, 92, 228, 231, 324, 354, 435
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1183 = CATCAGAGTCTCGTTC-1

using 47 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[47]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1184 = CATCAGAGTCTGATCA-1

using 188 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[184]
surviving nonsolo ucounts = 1[184]
ids = [0]

====================================================================================

UMI info for barcode CATCAGAGTCTGATCA-1 contig 1 = TGGGGTCACA...
umi AATAGCGGTC = 176 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=486]
0-39 ==> 123-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
39-379 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=6)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
424-486 ==> 0-62 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CCSYAGNTWVF at 363, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 173
start codons at 39, 178, 240, 247, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1186 = CATCAGAGTGCGGTAA-1

using 246 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 238]
surviving nonsolo ucounts = 1[238]
ids = [4]

====================================================================================

UMI info for barcode CATCAGAGTGCGGTAA-1 contig 1 = GGGGGACTCC...
umi GGGTATTCTG = 225 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=555]
21-379 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
404-454 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
454-555 ==> 0-101 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 26 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 366, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 21, 65, 244, 247, 250, 336, 406
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1204 = CATCAGAGTTGGTAAA-1

using 327 reads

====================================================================================

graph has 470 edges initially, 4 edges after simplification

total ucounts = 129
nonsolo ucounts = 71[2^26, 3^15, 4^12, 5^3, 6^5, 7^4, 8^4, 9, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1214 = CATCAGATCACTGGGC-1

using 45 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[45]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1222 = CATCAGATCCACGTGG-1

using 222 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[216]
surviving nonsolo ucounts = 1[216]
ids = [1]

====================================================================================

UMI info for barcode CATCAGATCCACGTGG-1 contig 1 = CTCCCTCACT...
umi CCGCGGTTGT = 2 reads: -109 +13 -1 +5 -1 +12 -1X +23 -259 invalidated
umi CCGCGTATGT = 209 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=492]
0-54 ==> 5-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=16)
430-478 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
junction support: 1 umis using 12 reads
cdr3 = CARRMVTSDDEDYFDSW at 396, score = 8 + 7
umis assigned: [0, 1]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 54, 228, 252, 408
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1227 = CATCAGATCCCTCTTT-1

using 25 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[25]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1231 = CATCAGATCCGTTGCT-1

using 445 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2, 3, 6, 7, 97, 323]
surviving nonsolo ucounts = 2[97, 323]
ids = [11, 5]

====================================================================================

UMI info for barcode CATCAGATCCGTTGCT-1 contig 1 = GGGGAGGAAC...
umi ATTCCTCTTT = 300 reads: +388 validated
umi TGTGGACCGT = 91 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
386-424 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
424-503 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 71 reads
cdr3 = CQQYNNWPPAITF at 357, score = 9 + 8
umis assigned: [5, 11]
of which 2 are surviving nonsolos
reads assigned: 385
start codons at 36, 105, 241, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1234 = CATCAGATCCTCAACC-1

using 296 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 290]
surviving nonsolo ucounts = 1[290]
ids = [2]

====================================================================================

UMI info for barcode CATCAGATCCTCAACC-1 contig 1 = GGTGACTCCT...
umi GTATATAATC = 282 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=505]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=1)
20-371 ==> 0-351 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=26)
390-438 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
438-505 ==> 0-67 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CAVSSRADGYFDSW at 365, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 20, 64, 246, 326, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1243 = CATCAGATCGCGTTTC-1

using 201 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 5, 192]
surviving nonsolo ucounts = 1[192]
ids = [4]

====================================================================================

UMI info for barcode CATCAGATCGCGTTTC-1 contig 1 = GAGATTCCCA...
umi GCCCTGATCA = 190 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=555]
54-409 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=34)
462-505 ==> 20-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
505-555 ==> 0-50 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CAKDIGPTYYNVLTEYLSDYYAMDVW at 396, score = 9 + 6
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 54, 199, 205, 210, 289, 357, 427, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1256 = CATCAGATCTGGCGAC-1

using 224 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 218]
surviving nonsolo ucounts = 1[218]
ids = [2]

====================================================================================

UMI info for barcode CATCAGATCTGGCGAC-1 contig 1 = GCTCTGCTTC...
umi TTGAATTGTG = 214 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=533]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-533 ==> 0-88 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1261 = CATCAGATCTTATCTG-1

using 235 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 227]
surviving nonsolo ucounts = 1[227]
ids = [7]

====================================================================================

UMI info for barcode CATCAGATCTTATCTG-1 contig 1 = CTTCAGCTGT...
umi TCACTTCCAT = 222 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=521]
0-45 ==> 69-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
45-398 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=5)
395-433 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
433-521 ==> 0-88 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CASWDDSLNGPVF at 366, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 45, 349, 374, 391
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1262 = CATCAGATCTTGCCGT-1

using 36 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[9, 27]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1266 = CATCCACAGAAGGCCT-1

using 345 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[5, 11, 327]
surviving nonsolo ucounts = 1[327]
ids = [3]

====================================================================================

UMI info for barcode CATCCACAGAAGGCCT-1 contig 1 = GGGGAGGAAC...
umi GACCTCAAGC = 326 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=560]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQRSNWPPSYTF at 357, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 36, 241, 244, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1283 = CATCCACAGCGTAATA-1

using 82 reads

====================================================================================

graph has 46 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[3, 5, 19, 54]
surviving nonsolo ucounts = 2[19, 54]
ids = [0, 1]

====================================================================================

UMI info for barcode CATCCACAGCGTAATA-1 contig 1 = GGCCTCAGGA...
umi CATCCCTAAT = 48 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=470]
0-34 ==> 18-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
34-368 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
372-410 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
410-470 ==> 0-60 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CQAWDSTEVVF at 349, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 48
start codons at 34, 39, 328, 332
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1287 = CATCCACAGCTGGAAC-1

using 281 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[279]
surviving nonsolo ucounts = 1[279]
ids = [0]

====================================================================================

UMI info for barcode CATCCACAGCTGGAAC-1 contig 1 = GCTCTGCTTC...
umi ATTCTCCATC = 256 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=577]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-577 ==> 0-135 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1293 = CATCCACAGGCATGTG-1

using 332 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[327]
surviving nonsolo ucounts = 1[327]
ids = [1]

====================================================================================

UMI info for barcode CATCCACAGGCATGTG-1 contig 1 = AGTCAGACTC...
umi CCGTCAGCCA = 329 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 157-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
24-375 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYNGQSRAF at 351, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 325
start codons at 24, 30, 99, 235, 238, 331, 364, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1296 = CATCCACAGGGCATGT-1

using 197 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 10, 182]
surviving nonsolo ucounts = 1[182]
ids = [3]

====================================================================================

UMI info for barcode CATCCACAGGGCATGT-1 contig 1 = TCCACCATGG...
umi GGTTTTCCTC = 172 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=522]
6-346 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=8)
362-400 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
400-522 ==> 0-122 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CCSYAGSSTLPYVF at 330, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 6, 207, 214, 340, 364
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1297 = CATCCACAGGGTGTGT-1

using 333 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 8[2^5, 4, 6, 303]
surviving nonsolo ucounts = 1[303]
ids = [9]

====================================================================================

UMI info for barcode CATCCACAGGGTGTGT-1 contig 1 = GTCAGTCCCA...
umi CTTTGACGAA = 306 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=21)
373-411 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYEHLPVTF at 350, score = 9 + 7
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 23, 29, 85, 98, 237, 360, 404, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1302 = CATCCACAGTAAGTAC-1

using 1383 reads

====================================================================================

graph has 2000 edges initially, 14 edges after simplification

total ucounts = 561
nonsolo ucounts = 278[2^114, 3^59, 4^36, 5^25, 6^14, 7^8, 8^7, 9^5, 10^3, 11^2, 12^2, 19, 42, 48]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1307 = CATCCACAGTGCCAGA-1

using 46 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[46]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1322 = CATCCACCAATAGCGG-1

using 12725 reads

====================================================================================

graph has 8968 edges initially, 252 edges after simplification

total ucounts = 1405
nonsolo ucounts = 1043[2^171, 3^114, 4^101, 5^82, 6^76, 7^80, 8^65, 9^51, 10^51, 11^55, 12^30, 13^31, 14^30, 15^21, 16^19, 17^15, 18^7, 19^6, 20^9, 21^2, 22^2, 24, 25, 26^3, 27, 94, 104, 112, 137, 143, 182, 205, 218, 232, 261, 264, 267, 279, 285, 297^2, 450, 466, 744]
surviving nonsolo ucounts = 17[112, 137, 143, 182, 205, 218, 232, 261, 264, 267, 279, 285, 297^2, 450, 466, 744]
ids = [457, 921, 770, 1030, 365, 276, 540, 924, 539, 81, ...]

====================================================================================

UMI info for barcode CATCCACCAATAGCGG-1 contig 1 = GGGGTCACAA...
umi ACAAGTGGCC = 270 reads: +388 validated
umi ATCCTCTCTC = 218 reads: +388 validated
umi CCATGTCCCG = 112 reads: +388 validated
umi CCTTTTTCTA = 264 reads: +388 validated
umi CGAAAAGCAT = 235 reads: +388 validated
umi CGGTAGGGTG = 288 reads: +388 validated
umi CTTCGCATCG = 299 reads: +388 validated
umi GAGTGGCATG = 135 reads: +388 validated
umi GTAAAGGCCC = 264 reads: +388 validated
umi TCCATATCCG = 743 reads: -368 +20 non-validated
umi TGCTTCGGTT = 302 reads: +388 validated
umi TTCCCCGGCT = 470 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=637]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=6)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
426-637 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 11 umis using 438 reads
cdr3 = CCSYAVSSTWVF at 362, score = 8 + 8
umis assigned: [81, 276, 457, 539, 540, 594, 709, 770, 924, 1126] and 2 others
of which 12 are surviving nonsolos
reads assigned: 3533
start codons at 38, 177, 239, 246, 372
confident = true

REJECT CONTIGS

TIG 1[bases=762]
2-226 ==> 4-228 on segment before IGLV3-24 exon 2 [len=317] (mis=0)
2-226 ==> 7328-7552 on segment before IGLV3-15 exon 1 [len=7632] (mis=3)
218-367 ==> 40-189 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=20)
401-517 ==> 0-116 on segment before IGLV2-23 exon 1 [len=2836] (mis=1)
520-551 ==> 39-70 on |316|IGLJ6|J-REGION| [len=70] (mis=0)
551-762 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=8)
umis assigned: [921, 1030, 1349]
of which 3 are surviving nonsolos
reads assigned: 566
start codons at 105, 149, 176, 283, 333, 377, 683
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1323 = CATCCACCAATCCGAT-1

using 546 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[545]
surviving nonsolo ucounts = 1[545]
ids = [1]

====================================================================================

UMI info for barcode CATCCACCAATCCGAT-1 contig 1 = AGCTGTGGGC...
umi GATAAAGATG = 539 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=18)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
428-548 ==> 0-120 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 82 reads
cdr3 = CNSRDSSGNHLSWVF at 355, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 532
start codons at 40, 159, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1324 = CATCCACCAATGACCT-1

using 613 reads

====================================================================================

graph has 240 edges initially, 14 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 255, 350]
surviving nonsolo ucounts = 2[255, 350]
ids = [5, 2]

====================================================================================

UMI info for barcode CATCCACCAATGACCT-1 contig 1 = AGGAGTCAGA...
umi GAAGATGTGC = 361 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=25)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQGNSFPYTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 346
start codons at 27, 33, 89, 102, 457
confident = false

REJECT CONTIGS

TIG 1[bases=534]
3-78 ==> 5665-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
27-380 ==> 0-353 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=2)
359-398 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=17)
398-534 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 27, 33, 89, 102, 165, 238, 440
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1337 = CATCCACCACGACGAA-1

using 102 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[5, 95]
surviving nonsolo ucounts = 1[95]
ids = [3]

====================================================================================

UMI info for barcode CATCCACCACGACGAA-1 contig 1 = GAGAAGAGCT...
umi TTATCAAGCC = 91 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=471]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
388-420 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
420-471 ==> 0-51 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CQQYGSSPQTF at 359, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 88
start codons at 35, 243, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1338 = CATCCACCACGACTCG-1

using 19 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[7, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1341 = CATCCACCACGTAAGG-1

using 181 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 3^2, 166]
surviving nonsolo ucounts = 1[166]
ids = [9]

====================================================================================

UMI info for barcode CATCCACCACGTAAGG-1 contig 1 = AGCCATGGCA...
umi TGGTTTCCTC = 137 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=507]
4-338 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
342-380 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
380-507 ==> 0-127 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CQAWDSTEVVF at 319, score = 6 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 135
start codons at 4, 9, 298, 302
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1347 = CATCCACCAGCCTTGG-1

using 15 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1349 = CATCCACCAGGCTCAC-1

using 266 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 3, 260]
surviving nonsolo ucounts = 1[260]
ids = [3]

====================================================================================

UMI info for barcode CATCCACCAGGCTCAC-1 contig 1 = GGTCTCAGGA...
umi CTACGAGTCG = 254 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=511]
36-181 ==> 0-145 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=2)
190-395 ==> 145-350 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=1)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
442-511 ==> 0-69 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CSSYTSSSTTVEVVF at 369, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 36, 202, 246, 253, 256
confident = false
see insertion of GTGGTTATA at pos 145 on |339|IGLV2-14|L-REGION+V-REGION|
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1355 = CATCCACCAGTAGAGC-1

using 191 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[187]
surviving nonsolo ucounts = 1[187]
ids = [1]

====================================================================================

UMI info for barcode CATCCACCAGTAGAGC-1 contig 1 = GCTCTGCTTC...
umi GAATAGACTT = 182 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=518]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-518 ==> 0-73 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1359 = CATCCACCATATACGC-1

using 118 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 114]
surviving nonsolo ucounts = 1[114]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1362 = CATCCACCATGACATC-1

using 359 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2^4, 5, 6, 14, 322]
surviving nonsolo ucounts = 1[322]
ids = [5]

====================================================================================

UMI info for barcode CATCCACCATGACATC-1 contig 1 = GGGGTCACAA...
umi GCCAGACTTA = 309 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=563]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=5)
394-432 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
432-563 ==> 0-131 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 38 reads
cdr3 = CCSYAGSRTPNWVF at 362, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 38, 177, 239, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1363 = CATCCACCATGCAACT-1

using 12847 reads

====================================================================================

graph has 4542 edges initially, 82 edges after simplification

total ucounts = 354
nonsolo ucounts = 160[2^49, 3^28, 4^14, 5^6, 6^7, 7^4, 8^7, 11, 22, 57, 77, 142, 174, 178, 179, 183, 189, 202, 221, 235, 236, 246, 260, 266, 271^2, 280^2, 281, 282, 289, 293^2, 294, 302, 311, 315, 316^2, 321, 323, 328, 334, 350, 352, 363, 376, 385, 386, 398, 406, 665]
surviving nonsolo ucounts = 41[57, 142, 178, 179, 183, 189, 202, 221, 235, 236, 246, 260, 266, 271^2, 280^2, 281, 282, 289, 293^2, 294, 302, 311, 315, 316^2, 321, 323, 328, 334, 350, 352, 363, 376, 385, 386, 398, 406, 665]
ids = [255, 250, 234, 59, 122, 75, 23, 335, 142, 262, ...]

====================================================================================

UMI info for barcode CATCCACCATGCAACT-1 contig 1 = TGGGAGGAGT...
umi ATTGCAAGGT = 263 reads: +388 validated
umi CATTCAGTTA = 271 reads: +388 validated
umi CGGTTATAAC = 271 reads: +388 validated
umi GGGTACATCA = 318 reads: +388 validated
umi GTCAACGCCC = 303 reads: +388 validated
umi TACTTATATT = 391 reads: +388 validated
umi TCACTGGCCT = 321 reads: +388 validated

UMI info for barcode CATCCACCATGCAACT-1 contig 2 = AGCTCTGAGA...
umi ATGTATTTCT = 294 reads: +415 validated
umi ATTAGAGAGA = 179 reads: +415 validated
umi CAAGTCAGGC = 272 reads: +415 validated
umi CAGCTCCGGT = 191 reads: +415 validated
umi CGGTCGGGTT = 182 reads: +415 validated
umi CTCTAGGCTT = 273 reads: +325 -1XX +89 invalidated
umi CTTCGCACTA = 321 reads: +415 validated
umi GAGGTCGCTT = 282 reads: +18 -1XX +396 invalidated
umi GCCAGCTATA = 263 reads: +415 validated
umi GGTCTTTCGG = 299 reads: +415 validated
umi GTATAGTCGG = 356 reads: +415 validated
umi GTCCAATCAT = 253 reads: +415 validated
umi GTGGATGGCA = 319 reads: +415 validated
umi TACGATCAGT = 280 reads: +415 validated
umi TACGGTTTAG = 338 reads: +415 validated
umi TACGTCGTTG = 58 reads: +366 -49 non-validated
umi TAGTCGTGTC = 234 reads: +415 validated
umi TCAAGCGCCC = 644 reads: -256X +159 invalidated
umi TGTTATGTGT = 316 reads: +415 validated
umi TTAATATGCG = 397 reads: +11 -1XX +403 invalidated
umi TTCATATGTT = 223 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=555]
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
381-419 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 7 umis using 371 reads
cdr3 = CQQSYSTPITF at 358, score = 9 + 8
umis assigned: [61, 86, 124, 203, 219, 258, 276]
of which 7 are surviving nonsolos
reads assigned: 2097
start codons at 31, 37, 93, 106, 242, 461
confident = true

TIG 2[bases=565]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=1)
446-494 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
494-565 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 20 umis using 479 reads
cdr3 = CARGVVPNHYFDYW at 421, score = 9 + 7
umis assigned: [55, 59, 67, 75, 122, 146, 152, 166, 178, 207] and 11 others
of which 21 are surviving nonsolos
reads assigned: 5827
start codons at 79, 235, 382
confident = true

REJECT CONTIGS

TIG 1[bases=566]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-44 ==> 5956-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
393-430 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [20, 23, 56, 113, 135, 208, 234, 235, 250, 343]
of which 10 are surviving nonsolos
reads assigned: 2954
start codons at 44, 252, 378, 472
confident = false
did not find CDR3
now this is a cell
paired!

AGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGGAGTAGTCCCGAACCACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCTATCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1376 = CATCCACGTACATCCA-1

using 234 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[230]
surviving nonsolo ucounts = 1[230]
ids = [3]

====================================================================================

UMI info for barcode CATCCACGTACATCCA-1 contig 1 = ATCATCCAAC...
umi ATTCCCAATC = 222 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=522]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
440-488 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
488-522 ==> 0-34 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 400, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 58, 214, 256, 322, 355, 445
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1384 = CATCCACGTCAAAGAT-1

using 221 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[221]
surviving nonsolo ucounts = 1[221]
ids = [0]

====================================================================================

UMI info for barcode CATCCACGTCAAAGAT-1 contig 1 = ATCACACAAC...
umi CCTCTTGTCC = 216 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=605]
0-57 ==> 3-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=0)
57-410 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=7)
418-466 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
466-605 ==> 0-139 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 35 reads
cdr3 = CVTDLATTVDYW at 399, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 57, 213, 255, 277, 292, 321, 354
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1386 = CATCCACGTCACAAGG-1

using 355 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 348]
surviving nonsolo ucounts = 1[348]
ids = [5]

====================================================================================

UMI info for barcode CATCCACGTCACAAGG-1 contig 1 = AGTCAGTCCC...
umi TCTTAGCAGA = 349 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=545]
0-24 ==> 7-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
24-375 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=3)
371-409 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
409-545 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYDNLFTF at 351, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 341
start codons at 24, 30, 86, 99, 238, 361, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1401 = CATCCACGTCGCGGTT-1

using 157 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[4, 7^2, 139]
surviving nonsolo ucounts = 1[139]
ids = [0]

====================================================================================

UMI info for barcode CATCCACGTCGCGGTT-1 contig 1 = GGAGTCTCCC...
umi ACATTTGCTA = 135 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=530]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=2)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=27)
455-507 ==> 0-52 on |50|IGHJ2|J-REGION| [len=52] (mis=17)
507-530 ==> 0-23 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CARLSEQMISRYYGSGAYPGHFDYW at 401, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 134
start codons at 59, 233, 282, 422, 438
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1413 = CATCCACGTGGTTTCA-1

using 254 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 247]
surviving nonsolo ucounts = 1[247]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=486]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
0-54 ==> 11310-11364 on rc of segment before IGHV3-19 exon 1 [len=11364] (mis=1)
40-72 ==> 10108-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-486 ==> 12-42 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 54, 252, 257, 274, 318, 351
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1421 = CATCCACGTTAAGAAC-1

using 142 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 137]
surviving nonsolo ucounts = 1[137]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1427 = CATCCACGTTCCCTTG-1

using 290 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[290]
surviving nonsolo ucounts = 1[290]
ids = [0]

====================================================================================

UMI info for barcode CATCCACGTTCCCTTG-1 contig 1 = AGCTACAACA...
umi GGCGGCCGGA = 288 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=565]
0-29 ==> 146-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
29-392 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
390-429 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYYGSPRTF at 368, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 286
start codons at 26, 29, 84, 98, 351, 381, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1429 = CATCCACGTTGAACTC-1

using 885 reads

====================================================================================

graph has 326 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 420, 458]
surviving nonsolo ucounts = 2[420, 458]
ids = [4, 6]

====================================================================================

UMI info for barcode CATCCACGTTGAACTC-1 contig 1 = TGGGGTCTCA...
umi CCCCGCTACC = 407 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=580]
0-39 ==> 124-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
39-354 ==> 0-315 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=12)
389-427 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
427-580 ==> 0-153 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 79 reads
cdr3 = CTSYAGGSNVVF at 363, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 402
start codons at 39, 247, 346, 373, 388
confident = false

REJECT CONTIGS

TIG 1[bases=462]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
0-23 ==> 10883-10906 on rc of segment before IGKV2-18 exon 2 [len=10906] (mis=2)
15-289 ==> 77-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=18)
288-326 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
326-462 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 265, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 456
start codons at 149, 368
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1431 = CATCCACGTTTACTCT-1

using 328 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[325]
surviving nonsolo ucounts = 1[325]
ids = [0]

====================================================================================

UMI info for barcode CATCCACGTTTACTCT-1 contig 1 = GAAGAGCTGC...
umi AACATATATA = 295 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=516]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=9)
380-418 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
418-516 ==> 0-98 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYGSSLTTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 292
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1439 = CATCCACTCACCGGGT-1

using 90 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 4, 77]
surviving nonsolo ucounts = 1[77]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=418]
0-330 ==> 21-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
334-373 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
373-418 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYDNLPPMYTF at 306, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 72
start codons at 41, 54, 193, 316, 333
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1442 = CATCCACTCAGGTAAA-1

using 31 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[31]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1455 = CATCCACTCCATGAGT-1

using 405 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 3, 399]
surviving nonsolo ucounts = 1[399]
ids = [2]

====================================================================================

UMI info for barcode CATCCACTCCATGAGT-1 contig 1 = AGAGCTCTGG...
umi GTTTCTCTGT = 399 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=562]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
388-426 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYNNWPLTF at 365, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 391
start codons at 44, 113, 249, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 23.1462 = CATCCACTCGCCTGAG-1

using 1854 reads

====================================================================================

graph has 2528 edges initially, 12 edges after simplification

total ucounts = 783
nonsolo ucounts = 359[2^140, 3^96, 4^45, 5^26, 6^17, 7^10, 8^8, 9^4, 10, 11^5, 12, 14, 16^2, 19, 28, 110]
surviving nonsolo ucounts = 1[110]
ids = [1]

====================================================================================

UMI info for barcode CATCCACTCGCCTGAG-1 contig 1 = AGGAGTCAGA...
umi AAAACCACCG = 104 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=508]
0-27 ==> 2-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
27-378 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-508 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CLQDYTYPFSF at 354, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 104
start codons at 27, 33, 89, 102, 184, 187, 457
confident = false
NOT paired!
sorting bam, mem = 0.10
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk023-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk023-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

72.933 seconds used processing barcodes, peak mem = 0.27
