[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.32 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk022-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk022-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk022.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.0 = CACTCCACAGCCAGAA-1

using 16112 reads

====================================================================================

graph has 7748 edges initially, 78 edges after simplification

total ucounts = 1159
nonsolo ucounts = 624[2^207, 3^122, 4^81, 5^56, 6^29, 7^19, 8^16, 9^15, 10^8, 11^5, 12^7, 13^2, 14, 15, 16^3, 18, 19, 22, 23, 43, 74, 90, 93, 104, 109, 123, 154, 156, 180, 184, 194, 202, 225, 227, 234, 235, 244, 248, 255, 258, 268, 280, 288, 293^2, 297, 300, 304, 311, 315, 321, 322, 325, 327, 333, 334, 338, 341, 344, 349, 358, 363, 372, 385, 417, 702, 707]
surviving nonsolo ucounts = 47[43, 74, 90, 93, 109, 123, 154, 156, 180, 184, 194, 202, 225, 227, 234, 235, 244, 248, 255, 258, 268, 280, 288, 293^2, 297, 300, 304, 311, 315, 321, 322, 325, 327, 333, 334, 338, 341, 344, 349, 358, 363, 372, 385, 417, 702, 707]
ids = [278, 738, 801, 750, 31, 530, 670, 1126, 612, 686, ...]

====================================================================================

UMI info for barcode CACTCCACAGCCAGAA-1 contig 1 = AGGAGTCAGT...
umi AGAACTAACC = 298 reads: +388 validated
umi AGTTAACATC = 322 reads: +388 validated
umi CAAGTAGGCA = 195 reads: +388 validated
umi CACACGGATA = 370 reads: +388 validated
umi CCAGCTCCAT = 304 reads: +388 validated
umi CGGCTCGTAT = 363 reads: +388 validated
umi CGTCATTCCA = 293 reads: +388 validated
umi CTAAAAGATT = 324 reads: +388 validated
umi CTGCTCGCTG = 339 reads: +388 validated
umi CTGTTTTGCA = 312 reads: +388 validated
umi CTGTTTTGCT = 300 reads: +388 validated
umi CTTAAACATC = 329 reads: +388 validated
umi CTTAGTCCTC = 349 reads: +388 validated
umi CTTCTACGCT = 366 reads: +388 validated
umi GCTAGGTAAT = 260 reads: +388 validated
umi GGCGCGGGGT = 709 reads: -267X +121 invalidated
umi GGTCGTCGTA = 157 reads: +388 validated
umi GTAGACTTAT = 186 reads: +388 validated
umi GTCCTTTGCC = 309 reads: +388 validated
umi GTGCATAGGC = 283 reads: +388 validated
umi GTTCAGTCTT = 332 reads: +388 validated
umi TAAACCCATT = 327 reads: +388 validated
umi TATAAAGGAC = 432 reads: +56 -1XX +1 -1XX +4 -5XX +4 -3XX +1 -18XX +1 -1XX +3 -11XX +278 invalidated
umi TATCTGATCG = 385 reads: +388 validated
umi TCGAAGCTCG = 351 reads: +388 validated
umi TGCTGATTTC = 333 reads: +388 validated
umi TTACGTGTCG = 247 reads: +388 validated
umi TTAGTCCCGC = 314 reads: +388 validated
umi TTTACGCTTC = 156 reads: +388 validated

UMI info for barcode CACTCCACAGCCAGAA-1 contig 2 = AGATCTCAGA...
umi AGTATCGGGC = 231 reads: +389 -32 non-validated
umi CCTAAGGTAT = 39 reads: +318 -1X +3 -99 invalidated
umi CGCACAGGTC = 247 reads: +421 validated
umi CTCAGACCTG = 236 reads: +421 validated
umi GAGCGCAGGC = 124 reads: +421 validated
umi GCTCATCCTG = 184 reads: +421 validated
umi GTTCTTCAGA = 76 reads: +389 -1 +2 -2 +7 -20 non-validated
umi TAAATCACAA = 86 reads: +421 validated
umi TAGACTCCCG = 91 reads: +421 validated
umi TAGTAGGGTA = 28 reads: -380X +1 -11X +2 -1XX +1 -7XX +2 -2XX +1 -3XX +1 -2XX +7 invalidated
umi TGGATTCGTC = 229 reads: +406 -1 +14 non-validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 31-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
27-378 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=15)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 29 umis using 1462 reads
cdr3 = CQQLNAYPLTF at 354, score = 9 + 9
umis assigned: [50, 70, 108, 117, 216, 346, 362, 376, 459, 474] and 19 others
of which 29 are surviving nonsolos
reads assigned: 9074
start codons at 27, 33, 89, 238, 367, 457
confident = true

TIG 2[bases=571]
0-79 ==> 0-79 on |158|IGHV3-7|5'UTR| [len=79] (mis=2)
79-432 ==> 0-353 on |159|IGHV3-7|L-REGION+V-REGION| [len=353] (mis=28)
447-500 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=6)
500-571 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 82 reads
cdr3 = CVKPLGIVGTWNFDVW at 421, score = 9 + 7
umis assigned: [67, 278, 329, 410, 530, 612, 738, 750, 801, 811] and 1 others
of which 11 are surviving nonsolos
reads assigned: 1536
start codons at 79, 235, 314, 382, 461
confident = true

REJECT CONTIGS

TIG 1[bases=571]
0-62 ==> 2-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
0-80 ==> 10060-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=10)
62-191 ==> 0-129 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=3)
352-378 ==> 268-294 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=1) [SHIFT!]
500-571 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [31, 270, 323, 484]
of which 4 are surviving nonsolos
reads assigned: 792
start codons at 62, 215, 227, 288, 381, 421
confident = false
did not find CDR3
now this is a cell
paired!

GAAGACACGGCTGTGTATTACTGTGTGAAGCCCCTGGGGATCGTCGGTACGTGGAACTTCGATGTCTGGGGCCGTGGCACCCTGGTCACTGTCTCCTCAG <==> ATCAACAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCAACAACTTAATGCTTATCCTCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.11 = CACTCCACAGTCAGCC-1

using 66 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 10[2, 4^4, 5, 6, 9^2, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.13 = CACTCCACAGTCTTCC-1

using 396 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[6, 388]
surviving nonsolo ucounts = 1[388]
ids = [2]

====================================================================================

UMI info for barcode CACTCCACAGTCTTCC-1 contig 1 = GGAGGAGTCA...
umi TGTCACAGGT = 386 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=1)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=16)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CLQDYNFPFTF at 356, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 383
start codons at 29, 35, 91, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.15 = CACTCCACAGTTAACC-1

using 253 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 247]
surviving nonsolo ucounts = 1[247]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=582]
18-256 ==> 0-238 on |94|IGHV2-26|L-REGION+V-REGION| [len=357] (mis=4)
256-333 ==> 254-331 on |94|IGHV2-26|L-REGION+V-REGION| [len=357] (mis=0) [SHIFT!]
371-422 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
422-582 ==> 0-160 on |3|IGHA2|C-REGION| [len=1019] (mis=0)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 18, 166, 174, 241, 308, 317, 339, 364, 476, 495
confident = false
frameshifted full length stopped transcript of length 582
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.24 = CACTCCACATCGTCGG-1

using 51 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 7[2, 5^2, 6, 7, 8^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.31 = CACTCCACATTAGGCT-1

using 193 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[191]
surviving nonsolo ucounts = 1[191]
ids = [1]

====================================================================================

UMI info for barcode CACTCCACATTAGGCT-1 contig 1 = GGGGGCTGGG...
umi TTAAAACCTG = 188 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=519]
45-389 ==> 0-344 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=20)
395-433 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
433-519 ==> 0-86 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CSSYISSTTLGF at 369, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 186
start codons at 45, 253, 256
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.47 = CACTCCAGTACTTCTT-1

using 914 reads

====================================================================================

graph has 387 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^2, 4, 7, 294, 601]
surviving nonsolo ucounts = 2[294, 601]
ids = [5, 8]

====================================================================================

UMI info for barcode CACTCCAGTACTTCTT-1 contig 1 = GTCAGTCTCA...
umi GTGGCAATAA = 279 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=488]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
411-488 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQSYSTPYTF at 350, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.49 = CACTCCAGTATAAACG-1

using 306 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[3, 4, 291]
surviving nonsolo ucounts = 1[291]
ids = [5]

====================================================================================

UMI info for barcode CACTCCAGTATAAACG-1 contig 1 = CTGGGCCTCA...
umi TAGGTCATAT = 280 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=554]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-383 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=5)
378-416 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
416-554 ==> 0-138 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQAWDSSTGVVF at 352, score = 6 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 37, 42, 98, 185, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.57 = CACTCCAGTCAATGTC-1

using 161 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[160]
surviving nonsolo ucounts = 1[160]
ids = [0]

====================================================================================

UMI info for barcode CACTCCAGTCAATGTC-1 contig 1 = CCCTCCCCTA...
umi TGGCTATTTA = 151 reads: +409 validated
umi TGTCTATATA = 1 reads: -382 +1 -1 +1 -1 +1 -3 +2 -5X +5 -2 +5 invalidated

GOOD CONTIGS

TIG 1[bases=515]
0-39 ==> 21-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=0)
39-392 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=7)
400-448 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
448-515 ==> 0-67 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CVTDLATTVDYW at 381, score = 9 + 7
umis assigned: [0, 1]
of which 1 are surviving nonsolos
reads assigned: 152
start codons at 39, 195, 237, 259, 274, 303, 336
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.60 = CACTCCAGTCAGAAGC-1

using 1278 reads

====================================================================================

graph has 400 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 10[2, 3^2, 4, 5^2, 7, 10, 311, 925]
surviving nonsolo ucounts = 2[311, 925]
ids = [7, 4]

====================================================================================

UMI info for barcode CACTCCAGTCAGAAGC-1 contig 1 = ACCCAAAAAC...
umi CGCACCCCGT = 307 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=584]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-584 ==> 0-94 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.62 = CACTCCAGTCATCCCT-1

using 45 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^2, 5, 8, 11, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.66 = CACTCCAGTCCCGACA-1

using 491 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 211, 275]
surviving nonsolo ucounts = 2[211, 275]
ids = [0, 4]

====================================================================================

UMI info for barcode CACTCCAGTCCCGACA-1 contig 1 = AGCTTCAGCT...
umi CGGGTACTTT = 208 reads: +388 validated
umi TCCCTTCACA = 275 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=530]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-530 ==> 0-95 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 74 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0, 4]
of which 2 are surviving nonsolos
reads assigned: 475
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.68 = CACTCCAGTCCTCCAT-1

using 25 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.84 = CACTCCAGTGGGTCAA-1

using 209 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2^2, 4^2, 5, 185]
surviving nonsolo ucounts = 1[185]
ids = [0]

====================================================================================

UMI info for barcode CACTCCAGTGGGTCAA-1 contig 1 = GCTCTGCTTC...
umi AGAGCGCTTT = 181 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=508]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-508 ==> 0-63 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 179
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.89 = CACTCCAGTGTCAATC-1

using 256 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 3, 5, 241]
surviving nonsolo ucounts = 1[241]
ids = [0]

====================================================================================

UMI info for barcode CACTCCAGTGTCAATC-1 contig 1 = CTCTCTCAGT...
umi AATAGTACTC = 245 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=545]
0-21 ==> 10-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=0)
21-372 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=1)
372-409 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
409-545 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQKYNSAPLTF at 348, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 21, 27, 83, 96, 232, 331, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.96 = CACTCCAGTTCAACCA-1

using 64 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2, 3^3, 52]
surviving nonsolo ucounts = 1[52]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=387]
0-287 ==> 39-326 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=12)
314-352 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
352-387 ==> 0-35 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CCSYAGGNIFHVF at 285, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 45
start codons at 118, 169, 178, 268, 316
confident = false
not full
VJ delta = 20
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.99 = CACTCCAGTTCCACAA-1

using 309 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 3^3, 294]
surviving nonsolo ucounts = 1[294]
ids = [3]

====================================================================================

UMI info for barcode CACTCCAGTTCCACAA-1 contig 1 = GGAGTCAGAC...
umi CACCTATCAT = 275 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=442]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
414-442 ==> 0-28 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYNGQSRAF at 353, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 26, 32, 101, 237, 240, 333, 366
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.127 = CACTCCATCACTTACT-1

using 87 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[87]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.134 = CACTCCATCATCGGAT-1

using 156 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[3, 146]
surviving nonsolo ucounts = 1[146]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.148 = CACTCCATCCTAGGGC-1

using 332 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 3, 319]
surviving nonsolo ucounts = 1[319]
ids = [9]

====================================================================================

UMI info for barcode CACTCCATCCTAGGGC-1 contig 1 = GGAGAAGAGC...
umi TGTATATTGC = 299 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=504]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
421-504 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYGSSPGTF at 360, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 36, 244, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.152 = CACTCCATCCTGCTTG-1

using 321 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2, 6^2, 10, 296]
surviving nonsolo ucounts = 1[296]
ids = [0]

====================================================================================

UMI info for barcode CACTCCATCCTGCTTG-1 contig 1 = AGAGCTCTGG...
umi AGGGTTTTCA = 283 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=508]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
391-429 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
429-508 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYGSSPWAF at 368, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 44, 252, 378, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.170 = CACTCCATCTACCTGC-1

using 224 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2^4, 3, 8, 202]
surviving nonsolo ucounts = 1[202]
ids = [5]

====================================================================================

UMI info for barcode CACTCCATCTACCTGC-1 contig 1 = GGACTCCTGT...
umi TACATTCTGT = 194 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=561]
18-376 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
401-451 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
451-561 ==> 0-110 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 27 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 363, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 18, 62, 241, 244, 247, 333, 403
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.175 = CACTCCATCTCACATT-1

using 426 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 3, 8, 407]
surviving nonsolo ucounts = 1[407]
ids = [4]

====================================================================================

UMI info for barcode CACTCCATCTCACATT-1 contig 1 = TGGGGAGGAG...
umi CGTGGTCGGA = 410 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=553]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 68 reads
cdr3 = CQQSYSTPSF at 359, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 402
start codons at 32, 38, 94, 107, 243, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.180 = CACTCCATCTCTGCTG-1

using 283 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 3, 271]
surviving nonsolo ucounts = 1[271]
ids = [8]

====================================================================================

UMI info for barcode CACTCCATCTCTGCTG-1 contig 1 = GCTGTGCTGT...
umi TTTAGTCCTT = 265 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=580]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
425-580 ==> 0-155 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQSADSSGTYVVF at 358, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 43, 104, 173, 191, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.203 = CAGAATCAGAGGTTAT-1

using 473 reads

====================================================================================

graph has 672 edges initially, 4 edges after simplification

total ucounts = 222
nonsolo ucounts = 90[2^28, 3^28, 4^10, 5^11, 6^6, 7, 9^3, 10, 11, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.221 = CAGAATCAGGCACATG-1

using 307 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[304]
surviving nonsolo ucounts = 1[304]
ids = [3]

====================================================================================

UMI info for barcode CAGAATCAGGCACATG-1 contig 1 = GGAGTCAGTC...
umi TCCTAGCGGT = 293 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=480]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-480 ==> 0-66 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 26, 32, 88, 101, 237, 336, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.226 = CAGAATCAGGTCATCT-1

using 24 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.229 = CAGAATCAGGTTACCT-1

using 242 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[5, 232]
surviving nonsolo ucounts = 1[232]
ids = [5]

====================================================================================

UMI info for barcode CAGAATCAGGTTACCT-1 contig 1 = GGAGGAATCA...
umi TCCCCGCGAC = 237 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
29-380 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CLQYSSSPWTF at 356, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 29, 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.235 = CAGAATCAGTCGATAA-1

using 311 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 306]
surviving nonsolo ucounts = 1[306]
ids = [1]

====================================================================================

UMI info for barcode CAGAATCAGTCGATAA-1 contig 1 = GGAGTCAGTC...
umi AAACACCTGC = 306 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQSYSTPRTF at 353, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.236 = CAGAATCAGTCGTTTG-1

using 287 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 280]
surviving nonsolo ucounts = 1[280]
ids = [5]

====================================================================================

UMI info for barcode CAGAATCAGTCGTTTG-1 contig 1 = GGAGGAGTCA...
umi TTAGAACTCG = 280 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=1)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CLQDYTYPFSF at 356, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 29, 35, 91, 104, 186, 189, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.240 = CAGAATCAGTGCTGCC-1

using 374 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 6, 361]
surviving nonsolo ucounts = 1[361]
ids = [2]

====================================================================================

UMI info for barcode CAGAATCAGTGCTGCC-1 contig 1 = TGATCAGGAC...
umi AGTGTGTCTG = 344 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=465]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
393-431 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
431-465 ==> 0-34 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CMQALQTPLFTF at 367, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 342
start codons at 31, 64, 100, 188, 350, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.243 = CAGAATCAGTTGCAGG-1

using 248 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3^3, 235]
surviving nonsolo ucounts = 1[235]
ids = [7]

====================================================================================

REJECT CONTIGS

TIG 1[bases=523]
0-20 ==> 27-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
0-20 ==> 789-809 on rc of segment before IGKV2-23 exon 2 [len=809] (mis=0)
0-20 ==> 9990-10010 on rc of segment before IGKV2-40 exon 1 [len=10010] (mis=0)
0-20 ==> 793-813 on segment before IGKV1D-22 exon 1 [len=813] (mis=0)
5-77 ==> 5674-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
20-336 ==> 0-316 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=0)
349-387 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
387-523 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 20, 26, 82, 95, 231, 429
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.246 = CAGAATCCAAATTGCC-1

using 255 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 3, 249]
surviving nonsolo ucounts = 1[249]
ids = [0]

====================================================================================

UMI info for barcode CAGAATCCAAATTGCC-1 contig 1 = AGAGCTCTGG...
umi CGAGTGTGGA = 245 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=534]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
396-435 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
435-534 ==> 0-99 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYGSSPPMYTF at 368, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 44, 252, 378, 395, 477
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.248 = CAGAATCCAACGCACC-1

using 56 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 10[2^3, 3^2, 4, 7, 8, 9, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.261 = CAGAATCCACCATGTA-1

using 49 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 45]
surviving nonsolo ucounts = 1[45]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.267 = CAGAATCCAGACAAGC-1

using 288 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 280]
surviving nonsolo ucounts = 1[280]
ids = [1]

====================================================================================

UMI info for barcode CAGAATCCAGACAAGC-1 contig 1 = CTCTCTCAGT...
umi ACTCTATGCA = 261 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=469]
0-21 ==> 10-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=0)
21-372 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=2)
371-409 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
409-469 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQKYNSAPFTF at 348, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 21, 27, 83, 96, 232, 331, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.271 = CAGAATCCAGCTGCTG-1

using 1221 reads

====================================================================================

graph has 498 edges initially, 18 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 4, 9, 328, 873]
surviving nonsolo ucounts = 2[328, 873]
ids = [4, 2]

====================================================================================

UMI info for barcode CAGAATCCAGCTGCTG-1 contig 1 = GAGGAACTGC...
umi CTTCCCTCGA = 335 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=9)
380-418 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQRSNGPRFTF at 354, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 33, 238, 460
confident = false

REJECT CONTIGS

TIG 1[bases=320]
3-144 ==> 207-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
145-184 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
184-320 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYGSSPPYTF at 120, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 855
start codons at 4, 103, 130, 226
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.278 = CAGAATCCATCACAAC-1

using 258 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 253]
surviving nonsolo ucounts = 1[253]
ids = [0]

====================================================================================

UMI info for barcode CAGAATCCATCACAAC-1 contig 1 = GCTCTGCTTC...
umi AATAGTCTGT = 244 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=539]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-539 ==> 0-97 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.280 = CAGAATCCATGAGCGA-1

using 334 reads

====================================================================================

graph has 250 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3^2, 323]
surviving nonsolo ucounts = 1[323]
ids = [6]

====================================================================================

UMI info for barcode CAGAATCCATGAGCGA-1 contig 1 = TGGGGGATCA...
umi TGTTAGGTCT = 322 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=474]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
394-432 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
432-474 ==> 0-42 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CMQALQTRETF at 371, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 35, 68, 104, 192, 354, 374
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.284 = CAGAATCGTAAACGCG-1

using 45 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 5, 34]
surviving nonsolo ucounts = 1[34]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.295 = CAGAATCGTCGGCATC-1

using 278 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[275]
surviving nonsolo ucounts = 1[275]
ids = [0]

====================================================================================

UMI info for barcode CAGAATCGTCGGCATC-1 contig 1 = CTGGGCCTCA...
umi CCTCGTTGCT = 270 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=546]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-375 ==> 0-338 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
378-416 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
416-546 ==> 0-130 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQAWDSSTLYVF at 352, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 37, 42, 98, 185, 331, 335, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.310 = CAGAATCGTGCGGTAA-1

using 8155 reads

====================================================================================

graph has 3172 edges initially, 24 edges after simplification

total ucounts = 488
nonsolo ucounts = 178[2^58, 3^27, 4^19, 5^15, 6^7, 7^6, 8^7, 10^2, 11, 12^2, 13, 14^3, 15, 20, 122, 152, 162, 183, 185, 192, 196, 202, 205, 214, 224, 236, 251, 276, 283, 288, 294, 296, 304, 305, 308, 316^2, 318, 340^2, 341, 362]
surviving nonsolo ucounts = 28[122, 152, 162, 183, 185, 192, 196, 202, 205, 214, 224, 236, 251, 276, 283, 288, 294, 296, 304, 305, 308, 316^2, 318, 340^2, 341, 362]
ids = [268, 438, 258, 141, 39, 240, 453, 57, 411, 229, ...]

====================================================================================

UMI info for barcode CAGAATCGTGCGGTAA-1 contig 1 = AGCTCTGAGA...
umi GCCCTACTAC = 161 reads: +400 validated
umi GCTAGTATTG = 121 reads: +400 validated

UMI info for barcode CAGAATCGTGCGGTAA-1 contig 2 = TTATGGGGGA...
umi AAATCCGGTG = 342 reads: +400 validated
umi AACTATAGGC = 291 reads: +400 validated
umi ACACAGGGCG = 185 reads: +400 validated
umi ACACCACTTT = 342 reads: +400 validated
umi ACATATCTGC = 309 reads: +400 validated
umi ACATGGGAGT = 318 reads: +400 validated
umi ACGATGCGTC = 201 reads: +400 validated
umi CATGCAATAC = 184 reads: +400 validated
umi CCCGCGGAGG = 366 reads: +400 validated
umi CCTATCCTGC = 255 reads: +400 validated
umi CCTCCGTGCA = 293 reads: +400 validated
umi CCTCCTTCTA = 238 reads: +400 validated
umi CTCCGGGCAA = 275 reads: +400 validated
umi CTTCAATTTG = 214 reads: +400 validated
umi GACTGGATAA = 191 reads: +400 validated
umi GCTAGGCCGC = 286 reads: +400 validated
umi GGATTTTGTG = 347 reads: +52 -3XX +1 -11XX +1 -1XX +331 invalidated
umi TAGTCGTCCG = 223 reads: +400 validated
umi TATTTGGGGG = 308 reads: +400 validated
umi TCAACATAGA = 313 reads: +400 validated
umi TGCAACAATT = 205 reads: +400 validated
umi TGCGCCGGGC = 304 reads: +400 validated
umi TGGTGTGGGG = 286 reads: +400 validated
umi TTAACTACCC = 150 reads: +400 validated
umi TTCAGCGACC = 322 reads: +400 validated
umi TTCGCCCAGT = 196 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=545]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=22)
445-479 ==> 15-49 on |52|IGHJ3|J-REGION| [len=49] (mis=0)
479-545 ==> 0-66 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 2 umis using 45 reads
cdr3 = CARPQGKSW at 421, score = 8 + 7
umis assigned: [258, 268]
of which 2 are surviving nonsolos
reads assigned: 277
start codons at 79, 235, 314, 382, 460
confident = true

TIG 2[bases=574]
38-403 ==> 0-365 on |734|IGKV2D-40|L-REGION+V-REGION| [len=365] (mis=13)
400-438 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
438-574 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 26 umis using 992 reads
cdr3 = CMQRLDFPITF at 377, score = 8 + 8
umis assigned: [9, 16, 39, 40, 48, 51, 57, 141, 163, 174] and 16 others
of which 26 are surviving nonsolos
reads assigned: 6833
start codons at 2, 38, 71, 107, 198, 210, 360, 380, 480
confident = true
now this is a cell
paired!

CAAATGAACAGCCTGAGAGTCGAGGACACGGCTGTGTATTACTGTGCGAGACCCCAGGGGAAGAGTTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> ATCAGCAGGGTGGAGGCTGACGATGTTGGAGTTTATTACTGCATGCAACGTTTAGACTTTCCCATCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.314 = CAGAATCGTTATTCTC-1

using 7572 reads

====================================================================================

graph has 3710 edges initially, 38 edges after simplification

total ucounts = 558
nonsolo ucounts = 295[2^94, 3^46, 4^45, 5^28, 6^11, 7^15, 8^10, 9^8, 10^7, 11^2, 12^4, 14, 31, 33, 114, 153, 161, 186, 193, 211, 214, 220, 243, 261, 268, 279, 282, 288, 295, 301, 318, 329, 348, 378, 391, 689]
surviving nonsolo ucounts = 22[114, 153, 161, 186, 193, 211, 214, 220, 243, 261, 268, 279, 282, 288, 295, 301, 318, 329, 348, 378, 391, 689]
ids = [34, 100, 505, 419, 176, 178, 472, 487, 361, 157, ...]

====================================================================================

UMI info for barcode CAGAATCGTTATTCTC-1 contig 1 = AGTGCTTTCT...
umi AAGGTCCTTC = 105 reads: -17 +428 non-validated
umi AGAAATCTGG = 369 reads: +445 validated
umi AGCCGGAACC = 149 reads: +443 -2 non-validated
umi AGTGGTGAGC = 256 reads: +445 validated
umi CACAATTGAG = 263 reads: +442 -3 non-validated
umi CATGTAATAT = 198 reads: +445 validated
umi CCCGAGGGCA = 292 reads: +445 validated
umi CCGTGAACTA = 293 reads: +445 validated
umi CGCTTCACTT = 293 reads: +445 validated
umi GAAGGTAGTA = 362 reads: +445 validated
umi GGAAGACTAG = 231 reads: +445 validated
umi TACATACTTG = 349 reads: +445 validated
umi TATCGAACAC = 65 reads: -363 +1 -3XX +3 -2XX +2 -2XX +1 -1XX +4 -1XX +1 -3XX +1 -1XX +2 -1XX +1 -1XX +1 -3XX +47 invalidated
umi TCCTACAATA = 212 reads: +445 validated
umi TCTGGAGGCC = 221 reads: +445 validated
umi TGATTACCAT = 156 reads: +445 validated
umi TGGGATCATA = 317 reads: +445 validated
umi TTAAATCGGG = 324 reads: +445 validated

UMI info for barcode CAGAATCGTTATTCTC-1 contig 2 = GAGTCAGACC...
umi CTGGCCGCTG = 281 reads: +382 validated
umi GTTACGGCTA = 188 reads: +382 validated
umi TTGCGTGCCT = 277 reads: -314X +1 -4X +1 -5X +1 -5XX +1 -14XX +36 invalidated

GOOD CONTIGS

TIG 1[bases=533]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=1)
412-462 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
462-533 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 15 umis using 311 reads
cdr3 = CARGGSGSYYPSRAFDIW at 377, score = 9 + 8
umis assigned: [34, 85, 100, 127, 157, 178, 182, 194, 226, 272] and 8 others
of which 18 are surviving nonsolos
reads assigned: 4402
start codons at 17, 38, 82, 168, 443
confident = true

TIG 2[bases=549]
0-31 ==> 22-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
31-376 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=2)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 84 reads
cdr3 = CQQYYSYPRTF at 352, score = 9 + 8
umis assigned: [255, 419, 545]
of which 3 are surviving nonsolos
reads assigned: 737
start codons at 25, 31, 87, 100, 236, 455
confident = true

REJECT CONTIGS

TIG 1[bases=533]
1-114 ==> 5887-6000 on segment before IGLV3-10 exon 1 [len=6000] (mis=0)
99-195 ==> 11247-11343 on segment before IGLV3-6 exon 1 [len=11502] (mis=4)
149-496 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=0)
496-533 ==> 0-37 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
cdr3 = CYSTDSSGNHRGVF at 464, score = 7 + 8
umis assigned: [175, 176]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 12, 41, 149, 210, 279, 297, 348, 410, 447
confident = false
not full
VJ delta = 22
not full
now this is a cell
paired!

ACGGCTGTGTATTACTGTGCGAGGGGGGGTTCGGGGAGTTATTACCCGAGCCGTGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> ATCAGCTGCCTGCAGTCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTTACCCCCGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.320 = CAGAATCGTTGATTCG-1

using 320 reads

====================================================================================

graph has 98 edges initially, 6 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 313]
surviving nonsolo ucounts = 2[2, 313]
ids = [2, 3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=559]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-36 ==> 5964-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
385-423 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 315
start codons at 36, 244, 370, 465
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.322 = CAGAATCGTTTAGGAA-1

using 241 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[239]
surviving nonsolo ucounts = 1[239]
ids = [0]

====================================================================================

UMI info for barcode CAGAATCGTTTAGGAA-1 contig 1 = GAGTCAGACC...
umi CAAATTCGCA = 229 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=475]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=5)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-475 ==> 0-62 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYDSYPLTF at 352, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 25, 31, 87, 100, 332, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.328 = CAGAATCTCACAAACC-1

using 383 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[4, 373]
surviving nonsolo ucounts = 1[373]
ids = [7]

====================================================================================

UMI info for barcode CAGAATCTCACAAACC-1 contig 1 = GGAGTCAGTC...
umi TCCAATACCC = 352 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=495]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=4)
373-411 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
411-495 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQYDNLFTF at 353, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 351
start codons at 26, 32, 88, 101, 240, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.330 = CAGAATCTCAGTGCAT-1

using 19 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.332 = CAGAATCTCCAAACAC-1

using 255 reads

====================================================================================

graph has 100 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[4, 80, 169]
surviving nonsolo ucounts = 2[80, 169]
ids = [3, 2]

====================================================================================

UMI info for barcode CAGAATCTCCAAACAC-1 contig 1 = GCTCTGCTTC...
umi GCGAGTCGTC = 167 reads: +394 validated
umi GCGAGTCGTG = 83 reads: +394 validated
umi TGCTCCGGTC = 2 reads: -394 non-validated

GOOD CONTIGS

TIG 1[bases=549]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-549 ==> 0-104 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 43 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2, 3, 4]
of which 2 are surviving nonsolos
reads assigned: 248
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.348 = CAGAATCTCGGCATCG-1

using 153 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3^2, 141]
surviving nonsolo ucounts = 1[141]
ids = [1]

====================================================================================

UMI info for barcode CAGAATCTCGGCATCG-1 contig 1 = GGCTGTGGGC...
umi CGTGTTAACA = 136 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=494]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=1)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
384-422 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
422-494 ==> 0-72 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CNSRDSSGNHLVF at 355, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 135
start codons at 40, 159, 188, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.362 = CAGAATCTCTTGCAAG-1

using 185 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[181]
surviving nonsolo ucounts = 1[181]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.366 = CAGAGAGAGAAGGACA-1

using 218 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[214]
surviving nonsolo ucounts = 1[214]
ids = [2]

====================================================================================

UMI info for barcode CAGAGAGAGAAGGACA-1 contig 1 = AATCAGTCCC...
umi TGTGGGCGCC = 213 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 3-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
24-375 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CLQYSSSPWTF at 351, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 24, 30, 99, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.373 = CAGAGAGAGATCGGGT-1

using 266 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[265]
surviving nonsolo ucounts = 1[265]
ids = [1]

====================================================================================

UMI info for barcode CAGAGAGAGATCGGGT-1 contig 1 = GGAGTCAGTC...
umi CTCTTGGTGG = 269 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYDNLPLTF at 353, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 26, 32, 88, 101, 240, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.377 = CAGAGAGAGCAGATCG-1

using 361 reads

====================================================================================

graph has 246 edges initially, 2 edges after simplification

total ucounts = 23
nonsolo ucounts = 19[2^2, 4^5, 5^2, 6, 7^3, 8^2, 9, 11, 13, 247]
surviving nonsolo ucounts = 1[247]
ids = [6]

====================================================================================

REJECT CONTIGS

TIG 1[bases=538]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
0-82 ==> 10058-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=10)
64-175 ==> 0-111 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=0)
176-418 ==> 111-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=30) [SHIFT!]
438-486 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
486-538 ==> 0-52 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARLSHFYRSGNSEYW at 407, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 64, 268, 285, 329, 362
confident = false
frameshifted full length stopped transcript of length 538
VJ delta = 7
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.381 = CAGAGAGAGCGCTTAT-1

using 18 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.386 = CAGAGAGAGGCAGGTT-1

using 312 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 305]
surviving nonsolo ucounts = 1[305]
ids = [4]

====================================================================================

UMI info for barcode CAGAGAGAGGCAGGTT-1 contig 1 = AGACCCAGTC...
umi CGTCGTCTTA = 278 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=450]
0-20 ==> 161-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
20-371 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=4)
367-405 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
405-450 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYNSFRTF at 347, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 20, 26, 82, 95, 327
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.406 = CAGAGAGCAATGGAAT-1

using 111 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^2, 3, 4, 8, 86]
surviving nonsolo ucounts = 1[86]
ids = [8]

====================================================================================

UMI info for barcode CAGAGAGCAATGGAAT-1 contig 1 = CCACACCCCT...
umi GCTTTTTTTT = 73 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=531]
0-45 ==> 14-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
45-398 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
447-481 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
481-531 ==> 0-50 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 7 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 387, score = 7 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 72
start codons at 45, 243, 248, 265, 309, 342
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.409 = CAGAGAGCACATCTTT-1

using 7049 reads

====================================================================================

graph has 3719 edges initially, 42 edges after simplification

total ucounts = 706
nonsolo ucounts = 317[2^146, 3^53, 4^33, 5^27, 6^15, 7^9, 8^6, 9^2, 10^3, 11, 12, 17, 109, 158, 201, 210, 236, 240, 242, 253, 257, 273, 283, 311, 317, 329^2, 348, 358, 365, 405, 429]
surviving nonsolo ucounts = 20[109, 158, 201, 210, 236, 240, 242, 253, 257, 273, 283, 311, 317, 329^2, 348, 358, 365, 405, 429]
ids = [31, 640, 141, 586, 577, 86, 177, 339, 423, 46, ...]

====================================================================================

UMI info for barcode CAGAGAGCACATCTTT-1 contig 1 = AAATACTTTC...
umi AAGGGTCTCG = 99 reads: +424 validated
umi CACTGCCAGT = 244 reads: +190 -1XX +233 invalidated
umi GTCCCCAGGT = 276 reads: +424 validated

UMI info for barcode CAGAGAGCACATCTTT-1 contig 2 = GAGCTACAAC...
umi ACAAATTTCA = 274 reads: +400 validated
umi ACTTCGTCCT = 329 reads: +400 validated
umi AGTCTCCGTA = 320 reads: +400 validated
umi ATCTAGCCTG = 136 reads: +327 -5 +47 -1X +8 -12 invalidated
umi CATACCCTCC = 411 reads: +400 validated
umi CTAGTCCTCT = 364 reads: +400 validated
umi CTTATGACCT = 256 reads: +400 validated
umi CTTTGAAGCT = 312 reads: +400 validated
umi GCCCAGGGTC = 359 reads: +400 validated
umi GCTCGAATCT = 261 reads: +400 validated
umi GGTCGGTCTC = 427 reads: +400 validated
umi GTTGCTTCGG = 331 reads: +400 validated
umi TCAAGACGGC = 354 reads: +400 validated
umi TCTCATGGCA = 209 reads: +400 validated
umi TGTATACCCT = 158 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=536]
0-39 ==> 62-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
39-395 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=27)
428-463 ==> 11-46 on |54|IGHJ4|J-REGION| [len=46] (mis=1)
463-536 ==> 0-73 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 3 umis using 75 reads
cdr3 = CARGRLYDSGRSIDLW at 384, score = 9 + 6
umis assigned: [31, 177, 466]
of which 3 are surviving nonsolos
reads assigned: 594
start codons at 39, 83, 403, 517
confident = true

TIG 2[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-359 ==> 0-329 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=16)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 14 umis using 649 reads
cdr3 = CLQYYSTPYTF at 369, score = 9 + 8
umis assigned: [46, 101, 124, 141, 184, 300, 339, 352, 404, 423] and 5 others
of which 15 are surviving nonsolos
reads assigned: 4416
start codons at 30, 99, 249, 352, 472
confident = true

REJECT CONTIGS

TIG 1[bases=621]
0-26 ==> 6796-6822 on rc of segment before IGKV3-34 exon 2 [len=6822] (mis=0)
15-78 ==> 5678-5741 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
26-360 ==> 0-334 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=43)
385-463 ==> 0-78 on rc of segment before IGKJ3 exon 1 [len=298] (mis=6)
485-621 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQRFDRSGHQTK at 353, score = 8 + 4
umis assigned: [86, 577]
of which 2 are surviving nonsolos
reads assigned: 469
start codons at 26, 32, 88, 101, 240, 527
confident = false
not full
not full
now this is a cell
paired!

GCGGACACGGCCGTCTATTACTGTGCGAGAGGACGCCTTTATGACAGTGGCCGATCAATAGACCTCTGGGGCCAGGGAATCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGGCTGAAGATGTGGCTCTTTATTACTGTCTACAATATTATAGTACACCCTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.411 = CAGAGAGCACCACGTG-1

using 647 reads

====================================================================================

graph has 234 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 644]
surviving nonsolo ucounts = 1[644]
ids = [1]

====================================================================================

UMI info for barcode CAGAGAGCACCACGTG-1 contig 1 = ACGGGTGATC...
umi CGTGTTAGTA = 644 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=569]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=4)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=4)
396-433 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
433-569 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 89 reads
cdr3 = CMQPLQTPPTF at 372, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 634
start codons at 36, 69, 105, 193, 355, 375, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.412 = CAGAGAGCAGAGCCAA-1

using 749 reads

====================================================================================

graph has 330 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[7, 15, 321, 403]
surviving nonsolo ucounts = 2[321, 403]
ids = [6, 1]

====================================================================================

UMI info for barcode CAGAGAGCAGAGCCAA-1 contig 1 = TGGGGACCCA...
umi CCTCTGGCAG = 394 reads: +436 validated
umi TTGCATACCG = 314 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=593]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=6)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
461-495 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
495-593 ==> 0-98 on |1|IGHA1|C-REGION| [len=1058] (mis=1)
junction support: 2 umis using 68 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 401, score = 7 + 7
umis assigned: [1, 6]
of which 2 are surviving nonsolos
reads assigned: 691
start codons at 59, 257, 262, 279, 323, 356, 549
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.416 = CAGAGAGCATGACGGA-1

using 1112 reads

====================================================================================

graph has 302 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[1111]
surviving nonsolo ucounts = 1[1111]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=378]
18-108 ==> 242-332 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
129-167 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
167-378 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CSSYTSSSAPWVF at 100, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 1093
start codons at 
confident = false
not full
VJ delta = 27
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.420 = CAGAGAGCATTATCTC-1

using 698 reads

====================================================================================

graph has 262 edges initially, 12 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[2^3, 3, 71, 284, 329]
surviving nonsolo ucounts = 3[71, 284, 329]
ids = [7, 5, 9]

====================================================================================

UMI info for barcode CAGAGAGCATTATCTC-1 contig 1 = GGGGGGGTCT...
umi GACGCAAACT = 276 reads: +388 validated
umi GTACGTATCA = 4 reads: +13 -2XX +2 -2XX +15 -1X +2 -351X invalidated

GOOD CONTIGS

TIG 1[bases=542]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=4)
41-402 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
429-542 ==> 0-113 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CSSYTSSSTLVF at 365, score = 8 + 9
umis assigned: [5, 7]
of which 2 are surviving nonsolos
reads assigned: 276
start codons at 41, 198, 242, 249, 252
confident = false

REJECT CONTIGS

TIG 1[bases=547]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
0-27 ==> 6795-6822 on rc of segment before IGKV3-34 exon 2 [len=6822] (mis=0)
16-79 ==> 5678-5741 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
27-343 ==> 0-316 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=22)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=5)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 325
start codons at 27, 33, 89, 102, 453
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.429 = CAGAGAGGTCATATGC-1

using 320 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[318]
surviving nonsolo ucounts = 1[318]
ids = [1]

====================================================================================

UMI info for barcode CAGAGAGGTCATATGC-1 contig 1 = AGGAGTCAGA...
umi CGCAAATTCG = 321 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=25)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQGNSFPYTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 27, 33, 89, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.430 = CAGAGAGGTCCGAATT-1

using 390 reads

====================================================================================

graph has 142 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 181, 201]
surviving nonsolo ucounts = 2[181, 201]
ids = [5, 7]

====================================================================================

UMI info for barcode CAGAGAGGTCCGAATT-1 contig 1 = AGGAATCAGT...
umi TTTCAACGTT = 199 reads: +388 validated

UMI info for barcode CAGAGAGGTCCGAATT-1 contig 2 = GGGGAGGAAC...
umi TTATTGTTTC = 179 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 27, 33, 102, 238, 457
confident = false

TIG 2[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
380-418 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=7)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQRRTWPPAF at 357, score = 9 + 6
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 36, 85, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.438 = CAGAGAGGTGAAAGAG-1

using 70 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 9[2^2, 4^2, 6, 8, 9, 12, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.447 = CAGAGAGGTGTTCTTT-1

using 8502 reads

====================================================================================

graph has 4490 edges initially, 64 edges after simplification

total ucounts = 779
nonsolo ucounts = 341[2^134, 3^63, 4^38, 5^28, 6^16, 7^21, 8^5, 9^2, 10^4, 11^2, 13, 16, 17, 18^2, 23, 137, 155, 161, 166, 170, 223, 224, 232, 233, 236, 240, 241, 247, 264, 271, 280^2, 289, 388, 670, 774, 966]
surviving nonsolo ucounts = 20[16, 137, 155, 170, 223, 224, 232, 233, 236, 240, 241, 247, 264, 271, 280^2, 289, 388, 774, 966]
ids = [741, 201, 337, 152, 347, 550, 313, 221, 452, 310, ...]

====================================================================================

UMI info for barcode CAGAGAGGTGTTCTTT-1 contig 1 = AGCTCTCAGA...
umi ACAGCCACAT = 285 reads: +424 validated
umi ATCCCTACAG = 290 reads: +424 validated
umi CTCATCCTAT = 189 reads: +424 validated
umi GCGCGCTTAT = 389 reads: +424 validated
umi GCGTTTCGAT = 229 reads: +424 validated
umi TAATGCATCC = 230 reads: +424 validated

UMI info for barcode CAGAGAGGTGTTCTTT-1 contig 2 = GTTATTTCAT...
umi ATGATGCATG = 263 reads: +394 validated
umi ATTGTGTATG = 774 reads: -343 +1 -5X +1 -1XX +2 -1XX +1 -1XX +38 invalidated
umi CACTCGGGGC = 137 reads: +394 validated
umi CATCAATCTA = 228 reads: +394 validated
umi CCTCCTGTCT = 246 reads: +394 validated
umi CGCATTCGAC = 240 reads: +394 validated
umi CGCCTCGCTG = 230 reads: +394 validated
umi CGCTAAGGGC = 972 reads: -346X +1 -2XX +1 -1XX +2 -1XX +1 -1XX +38 invalidated
umi CTACGCTACT = 153 reads: +394 validated
umi GCTCCTGCCT = 272 reads: +394 validated
umi TCCATGTCAC = 248 reads: +394 validated
umi TCCCTTACCG = 2 reads: -381X +1 -1XX +1 -3XX +1 -4XX +2 invalidated

GOOD CONTIGS

TIG 1[bases=605]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=8)
455-503 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
503-605 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 6 umis using 138 reads
cdr3 = CARDRCTSCYGAFFDYW at 421, score = 9 + 7
umis assigned: [72, 155, 347, 447, 452, 550]
of which 6 are surviving nonsolos
reads assigned: 1572
start codons at 79, 235, 356, 382, 449, 521, 582
confident = true

TIG 2[bases=677]
72-433 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=8)
428-466 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
466-677 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 9 umis using 329 reads
cdr3 = CSSYTSSSTLFYVF at 396, score = 8 + 8
umis assigned: [163, 182, 201, 221, 292, 310, 313, 314, 337, 457] and 2 others
of which 11 are surviving nonsolos
reads assigned: 3711
start codons at 72, 229, 273, 280, 283, 430, 598
confident = true
now this is a cell
paired!

GACACGGCTGTGTATTACTGTGCGAGAGATAGGTGTACCAGCTGCTATGGGGCATTCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> CTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTCTCTTTTATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.449 = CAGAGAGGTTGATTGC-1

using 4684 reads

====================================================================================

graph has 2845 edges initially, 32 edges after simplification

total ucounts = 437
nonsolo ucounts = 214[2^85, 3^36, 4^35, 5^13, 6^14, 7^5, 8^3, 9^2, 10^3, 12^2, 14, 99, 106, 126, 153, 199, 208, 224, 238, 245, 270, 272, 273, 321, 398, 617]
surviving nonsolo ucounts = 14[99, 106, 126, 153, 208, 224, 238, 245, 270, 272, 273, 321, 398, 617]
ids = [412, 243, 416, 172, 388, 136, 419, 301, 57, 288, ...]

====================================================================================

UMI info for barcode CAGAGAGGTTGATTGC-1 contig 1 = TGGGGAGCTC...
umi AGCTATTTGT = 256 reads: +415 validated
umi CCCACGGCGT = 360 reads: +415 validated
umi CGCGCGTACG = 161 reads: +245 -1XX +168 -1 invalidated
umi GATTTGCCGA = 106 reads: -218 +54 -1 +142 non-validated
umi GTTGACTGAC = 271 reads: +406 -6 +1 -2 non-validated
umi TAAGACATGC = 246 reads: +415 validated
umi TTAACACCCG = 186 reads: +415 validated
umi TTGTAGCCAT = 103 reads: +366 -1 +16 -18 +14 non-validated
umi TTTATAGCGC = 127 reads: +406 -9 non-validated

UMI info for barcode CAGAGAGGTTGATTGC-1 contig 2 = GAGCTACAAC...
umi CATGACCGGG = 227 reads: +400 validated
umi GTTACTGCTG = 271 reads: +400 validated
umi TTCGGTGTAG = 315 reads: +400 validated
umi TTTCGTCTTT = 241 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=570]
84-437 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=3)
451-499 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
499-570 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 103 reads
cdr3 = CARGKQLGWPFDYW at 426, score = 9 + 7
umis assigned: [57, 145, 172, 243, 291, 301, 388, 412, 416]
of which 9 are surviving nonsolos
reads assigned: 1769
start codons at 84, 235, 240, 298, 301, 387
confident = true

TIG 2[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
393-430 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 4 umis using 146 reads
cdr3 = CQQYYSTPLTF at 369, score = 9 + 9
umis assigned: [136, 288, 402, 419]
of which 4 are surviving nonsolos
reads assigned: 1038
start codons at 30, 99, 352, 472
confident = true
now this is a cell
paired!

AGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGGGAAGCAGCTGGGGTGGCCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.453 = CAGAGAGTCAAGGCTT-1

using 243 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 5, 234]
surviving nonsolo ucounts = 1[234]
ids = [1]

====================================================================================

UMI info for barcode CAGAGAGTCAAGGCTT-1 contig 1 = AGGAGTCAGA...
umi TATAACCTGC = 222 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=483]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-483 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.465 = CAGAGAGTCGATGAGG-1

using 560 reads

====================================================================================

graph has 198 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[7, 551]
surviving nonsolo ucounts = 1[551]
ids = [1]

====================================================================================

UMI info for barcode CAGAGAGTCGATGAGG-1 contig 1 = GGAGGAACTG...
umi CTGGCACCGC = 499 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=504]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
381-419 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
419-504 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 93 reads
cdr3 = CQQRSNWPPFTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 495
start codons at 34, 239, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.467 = CAGAGAGTCGCTAGCG-1

using 306 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[303]
surviving nonsolo ucounts = 1[303]
ids = [0]

====================================================================================

UMI info for barcode CAGAGAGTCGCTAGCG-1 contig 1 = GGAGTCAGAC...
umi AAACCAGGTT = 304 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=550]
0-32 ==> 21-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
32-377 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
386-414 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYYSYPRTF at 353, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.468 = CAGAGAGTCGGCCGAT-1

using 302 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 297]
surviving nonsolo ucounts = 1[297]
ids = [0]

====================================================================================

UMI info for barcode CAGAGAGTCGGCCGAT-1 contig 1 = GATCAGGACT...
umi ACCCCTCCTC = 278 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=520]
0-30 ==> 0-30 on |274|IGKV2D-29|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=0)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-520 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CMQSIQLPPFTF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 30, 63, 99, 187, 250, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.469 = CAGAGAGTCGGTCCGA-1

using 229 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 222]
surviving nonsolo ucounts = 1[222]
ids = [2]

====================================================================================

UMI info for barcode CAGAGAGTCGGTCCGA-1 contig 1 = AGGCAGCGCT...
umi TCAGGGCCCA = 217 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=542]
27-349 ==> 0-322 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=9)
380-418 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
418-542 ==> 0-124 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CCSFTVNTRSYVF at 351, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 27, 184, 228, 238, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.473 = CAGAGAGTCTGCAGTA-1

using 270 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[5, 10, 255]
surviving nonsolo ucounts = 1[255]
ids = [0]

====================================================================================

UMI info for barcode CAGAGAGTCTGCAGTA-1 contig 1 = GGGGTCTCAG...
umi AATAAACATG = 248 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=568]
0-38 ==> 4-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
38-381 ==> 0-343 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=7)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
429-568 ==> 0-139 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CCSYAGNYLRVVF at 362, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 38, 177, 195, 246, 249, 345, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.474 = CAGAGAGTCTGCTTGC-1

using 12779 reads

====================================================================================

graph has 4412 edges initially, 40 edges after simplification

total ucounts = 380
nonsolo ucounts = 160[2^50, 3^19, 4^15, 5^7, 6^5, 7^6, 8^2, 9^2, 10^2, 13^2, 16, 18, 28, 34, 51, 59, 64, 76, 83, 99, 112, 116, 122, 126, 136, 201, 202, 215, 222, 225^2, 237, 243, 261, 267, 272, 273^3, 276, 283, 287^2, 290, 292, 294, 312^2, 316, 324, 325, 344, 345, 390, 395, 401, 480, 500, 506, 667]
surviving nonsolo ucounts = 46[51, 59, 64, 76, 83, 99, 112, 116, 122, 126, 136, 201, 202, 215, 222, 225^2, 237, 243, 261, 267, 272, 273^3, 276, 283, 287^2, 290, 292, 294, 312^2, 316, 324, 325, 344, 345, 390, 395, 401, 480, 500, 506, 667]
ids = [151, 217, 193, 150, 50, 214, 208, 166, 54, 286, ...]

====================================================================================

UMI info for barcode CAGAGAGTCTGCTTGC-1 contig 1 = ATCACATAAC...
umi ACCGCGTTAC = 314 reads: +436 validated
umi ACTGCGGCAG = 193 reads: +436 validated
umi AGCGCCCTTT = 75 reads: +364 -8 +56 -8 non-validated
umi AGCTCTTGGG = 166 reads: +436 validated
umi AGCTTAGAAG = 283 reads: +436 validated
umi AGGTCCTGCC = 276 reads: +436 validated
umi CGAGGCGCGG = 209 reads: +436 validated
umi CGGCGATCTT = 63 reads: +436 validated
umi CTCGTGCGTT = 200 reads: +359 -10XX +67 invalidated
umi CTCGTGGGGC = 114 reads: +436 validated
umi GAGTATGGCA = 61 reads: +285 -6 +145 non-validated
umi GCTGTAGCCA = 62 reads: +327 -1 +6 -2 +5 -1 +94 non-validated
umi GGACGGGACT = 281 reads: +436 validated
umi GGCTACACTA = 426 reads: -373 +1 -4XX +1 -1XX +10 -3XX +15 -1XX +27 invalidated
umi GTTCCTGGCT = 399 reads: +436 validated
umi TAGCACCGGT = 673 reads: -204X +232 invalidated
umi TAGCCAGTCA = 346 reads: +436 validated
umi TCATACCCTG = 195 reads: +436 validated
umi TCCACATGCA = 181 reads: +436 validated
umi TCGGCGTGTG = 221 reads: +436 validated
umi TTTGCGTCCG = 138 reads: +36 -1XX +384 -15 invalidated

UMI info for barcode CAGAGAGTCTGCTTGC-1 contig 2 = GATCAGGACT...
umi AAGAGCGGCC = 266 reads: +397 validated
umi ACACCCCGCC = 273 reads: +397 validated
umi AGGCCTACTC = 125 reads: +397 validated
umi AGTAACTGGG = 331 reads: +397 validated
umi ATACCGCTAC = 263 reads: +397 validated
umi CACGAGCACG = 387 reads: +397 validated
umi CCACACGTGC = 293 reads: +397 validated
umi CCGAGGCAGA = 279 reads: +397 validated
umi CCTCCCCTTT = 514 reads: -104 +293 non-validated
umi CCTTGAGTCT = 285 reads: +397 validated
umi CGCGTCCTCC = 329 reads: +397 validated
umi CGGTCGTCGG = 51 reads: -14 +383 non-validated
umi CGGTCGTCTG = 482 reads: +397 validated
umi GAACTGTCGC = 280 reads: +397 validated
umi GACAATCGGC = 350 reads: +397 validated
umi GCATAGGCAG = 283 reads: +397 validated
umi GCCGCTTCGC = 113 reads: +397 validated
umi GCGTCTTAAT = 94 reads: -372 +25 non-validated
umi TAACGTTATG = 295 reads: +397 validated
umi TAGGATATTT = 123 reads: +397 validated
umi TCGTGAATAC = 314 reads: +397 validated
umi TGGCCCCACC = 400 reads: +397 validated
umi TGGCTCTTTC = 273 reads: +397 validated
umi TGTTCAGTAT = 297 reads: +397 validated
umi TTTAAGCCCA = 220 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=596]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=1)
431-494 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
494-596 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 18 umis using 444 reads
cdr3 = CARGDFIAAPVDYYYYGMDVW at 400, score = 9 + 7
umis assigned: [24, 41, 50, 52, 53, 57, 137, 150, 165, 166] and 11 others
of which 21 are surviving nonsolos
reads assigned: 4788
start codons at 58, 209, 256, 355, 451, 512, 573
confident = true

TIG 2[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 24 umis using 1036 reads
cdr3 = CMQALQTPLTF at 366, score = 9 + 9
umis assigned: [8, 19, 54, 59, 67, 94, 114, 125, 128, 134] and 15 others
of which 25 are surviving nonsolos
reads assigned: 6785
start codons at 30, 63, 99, 187, 349, 369, 469
confident = true
now this is a cell
paired!

TATTACTGTGCGAGAGGAGACTTTATAGCAGCTCCAGTTGACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACAAACTCCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.484 = CAGATCAAGCCACGCT-1

using 500 reads

====================================================================================

graph has 250 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 239, 254]
surviving nonsolo ucounts = 2[239, 254]
ids = [2, 1]

====================================================================================

UMI info for barcode CAGATCAAGCCACGCT-1 contig 1 = GAGAGAGGAG...
umi ATAGCCTTGC = 248 reads: +424 validated

UMI info for barcode CAGATCAAGCCACGCT-1 contig 2 = AGCTTCAGCT...
umi CAGTCATTAT = 231 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=630]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-630 ==> 0-133 on |43|IGHG2|C-REGION| [len=977] (mis=1)
junction support: 1 umis using 32 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 73, 224, 229, 376, 454
confident = false

TIG 2[bases=517]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-517 ==> 0-82 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.486 = CAGATCAAGCGATCCC-1

using 225 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[222]
surviving nonsolo ucounts = 1[222]
ids = [3]

====================================================================================

UMI info for barcode CAGATCAAGCGATCCC-1 contig 1 = GACTGATCAG...
umi TGTGTCCAAT = 207 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=509]
0-34 ==> 2-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
34-394 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
396-434 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
434-509 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CMQALQTPLFTF at 370, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 34, 67, 103, 191, 353, 373, 476
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.488 = CAGATCAAGGAGTAGA-1

using 340 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2, 3^2, 4, 321]
surviving nonsolo ucounts = 1[321]
ids = [7]

====================================================================================

UMI info for barcode CAGATCAAGGAGTAGA-1 contig 1 = GGAGTCAGAC...
umi TAGAAATAGG = 298 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=463]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-463 ==> 0-49 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQYDSFSWTF at 353, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 26, 32, 88, 101, 237, 240, 333, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.502 = CAGATCACAAACTGTC-1

using 295 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 287]
surviving nonsolo ucounts = 1[287]
ids = [4]

====================================================================================

UMI info for barcode CAGATCACAAACTGTC-1 contig 1 = AGAGCTCTGG...
umi GCTACCTTTC = 274 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-22 ==> 38-60 on |373|IGLV4-69|5'UTR| [len=60] (mis=0)
22-381 ==> 0-359 on |374|IGLV4-69|L-REGION+V-REGION| [len=359] (mis=20)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
419-563 ==> 0-144 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQTWGAGIEVVF at 355, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 22, 223, 236, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.506 = CAGATCACAAGAAGAG-1

using 41 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[41]
surviving nonsolo ucounts = 1[41]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.508 = CAGATCACACACTGCG-1

using 17615 reads

====================================================================================

graph has 5990 edges initially, 30 edges after simplification

total ucounts = 830
nonsolo ucounts = 380[2^125, 3^88, 4^48, 5^23, 6^14, 7^7, 8^9, 9^5, 10^4, 11, 14, 18, 20, 69, 85, 154, 156, 164, 182, 202, 204, 210, 212, 213, 234, 258, 261, 269, 271, 280, 284^2, 290, 291, 294, 295, 297, 302, 305, 306, 308, 309, 315, 322, 324, 326, 327, 332, 337, 338, 345, 351^3, 354, 360, 361, 369, 372, 392, 409, 417, 419, 425, 432, 673]
surviving nonsolo ucounts = 51[154, 156, 164, 182, 202, 204, 210, 212, 213, 234, 258, 261, 269, 271, 280, 284^2, 290, 291, 294, 295, 297, 302, 305, 306, 308, 309, 315, 322, 324, 326, 327, 332, 337, 338, 345, 351^3, 354, 360, 361, 369, 372, 392, 409, 417, 419, 425, 432, 673]
ids = [75, 14, 700, 780, 822, 23, 809, 787, 281, 638, ...]

====================================================================================

UMI info for barcode CAGATCACACACTGCG-1 contig 1 = AGAGCTCTGG...
umi AAAGACCTGG = 285 reads: +385 validated
umi AAATTATATG = 159 reads: +385 validated
umi AATATAATGT = 315 reads: +385 validated
umi ACAGACCCGC = 413 reads: +385 validated
umi ACCTAGCCAC = 352 reads: +385 validated
umi ACGCTCAAGC = 366 reads: +385 validated
umi ACGTCGTTCC = 394 reads: +385 validated
umi ACTGGGCTGG = 332 reads: +385 validated
umi AGCACTTCTC = 293 reads: +385 validated
umi AGTAGCCAGC = 264 reads: +385 validated
umi ATATATGGGC = 267 reads: +385 validated
umi ATTCACTCTT = 270 reads: +385 validated
umi ATTGACTGCA = 275 reads: +311 -2XX +72 invalidated
umi CATACTCCGC = 309 reads: +385 validated
umi CCCCTACAAT = 212 reads: +385 validated
umi CCCGGTCAGA = 352 reads: +385 validated
umi CCTCGTAGAC = 302 reads: +385 validated
umi CTCTCTCCGC = 326 reads: +385 validated
umi CTCTCTCTGT = 421 reads: +385 validated
umi CTCTGCCGGA = 617 reads: -342 +1 -5X +1 -2XX +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi CTGACGCCTT = 334 reads: +385 validated
umi CTTATCCTAG = 433 reads: +385 validated
umi GACAGAAGCT = 290 reads: +385 validated
umi GACCGACGCA = 358 reads: +385 validated
umi GATAATGCGC = 308 reads: +385 validated
umi GCGACCGAGT = 357 reads: +385 validated
umi GCTCCTGCGG = 354 reads: +385 validated
umi GGATGGCTGG = 282 reads: +385 validated
umi GGCGCATATG = 345 reads: +385 validated
umi GTACGACTGG = 290 reads: +385 validated
umi GTCACAAACA = 395 reads: +151 -1XX +233 invalidated
umi GTCATCTATT = 331 reads: +385 validated
umi GTTCCTTTGC = 327 reads: +385 validated
umi TAACCACCTA = 375 reads: +385 validated
umi TAACCGCCCC = 283 reads: +385 validated
umi TACCGGGAAC = 317 reads: +176 -1XX +208 invalidated
umi TCCGATCTTT = 336 reads: +385 validated
umi TCCTAATCTC = 308 reads: +385 validated
umi TCGGTTCTCT = 309 reads: +385 validated
umi TGTAAGCTTT = 326 reads: +385 validated
umi TTCACATTAG = 303 reads: +385 validated
umi TTGTTAATAT = 422 reads: +385 validated
umi TTTATGTCGT = 213 reads: +385 validated
umi TTTGTTATCT = 434 reads: +385 validated

UMI info for barcode CAGATCACACACTGCG-1 contig 2 = ATCATCCAGA...
umi AACGCTTGCT = 6 reads: -394X +2 -2XX +1 -12XX +1 -3XX +1 -5XX +1 -2XX +3 invalidated
umi ACCACCAGCT = 150 reads: +407 -1 +4 -3 +6 -1 +1 -1 +3 non-validated
umi TACTGTTTGC = 233 reads: +426 -1 non-validated
umi TCTAGTTCCG = 163 reads: +427 validated
umi TTCATAATGG = 11 reads: -394 +2 -2XX +1 -12XX +1 -3XX +1 -5XX +1 -2XX +3 invalidated
umi TTCGCTGGTA = 8 reads: -391 +1 -2XX +2 -2XX +1 -12XX +1 -3XX +1 -5XX +1 -2XX +3 invalidated
umi TTTGGGCGTC = 198 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
391-429 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 43 umis using 2080 reads
cdr3 = CQQYGNSPWTF at 368, score = 9 + 8
umis assigned: [6, 14, 42, 65, 84, 91, 98, 106, 124, 136] and 34 others
of which 44 are surviving nonsolos
reads assigned: 14264
start codons at 44, 252, 378, 471
confident = true

TIG 2[bases=627]
0-58 ==> 3-61 on |80|IGHV1-58|5'UTR| [len=61] (mis=0)
58-411 ==> 0-353 on |81|IGHV1-58|L-REGION+V-REGION| [len=353] (mis=13)
435-485 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
485-627 ==> 0-142 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 3 umis using 57 reads
cdr3 = CAAPHCNSTTCFDGFDLW at 400, score = 9 + 7
umis assigned: [23, 75, 638, 700, 780, 787, 822]
of which 7 are surviving nonsolos
reads assigned: 762
start codons at 58, 118, 261, 334, 355, 437, 466
confident = true
now this is a cell
paired!

ACGGCCGTGTATTACTGTGCGGCGCCCCATTGCAATAGCACCACCTGCTTCGATGGTTTTGATCTTTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAACTCACCCTGGACGTTCGGCCAAGGGACCAAGGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.513 = CAGATCACACGTTGGC-1

using 73 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 4, 64]
surviving nonsolo ucounts = 1[64]
ids = [0]

====================================================================================

UMI info for barcode CAGATCACACGTTGGC-1 contig 1 = GAGCCTTAGC...
umi CCTCGATGTT = 63 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=525]
0-66 ==> 13-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
66-419 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
443-490 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
490-525 ==> 0-35 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CARDRAATARLGGMDVW at 408, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 61
start codons at 66, 217, 222, 369, 447
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.519 = CAGATCACAGCCAATT-1

using 71 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 8[2^2, 7, 8^2, 11, 12, 19]
surviving nonsolo ucounts = 1[19]
ids = [9]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.524 = CAGATCACAGTTCATG-1

using 6725 reads

====================================================================================

graph has 4526 edges initially, 46 edges after simplification

total ucounts = 1033
nonsolo ucounts = 483[2^207, 3^95, 4^68, 5^31, 6^20, 7^13, 8^13, 9^4, 10^5, 11^4, 12, 16, 17, 18, 23, 61, 143, 187, 196, 209, 222, 237, 240, 251, 253, 260, 261, 273, 294, 298, 320, 330, 483]
surviving nonsolo ucounts = 17[61, 143, 187, 196, 209, 222, 237, 251, 253, 260, 261, 273, 294, 298, 320, 330, 483]
ids = [26, 717, 684, 100, 470, 938, 271, 267, 837, 63, ...]

====================================================================================

UMI info for barcode CAGATCACAGTTCATG-1 contig 1 = CCACATCCCT...
umi AAGTTTCTCT = 65 reads: +12 -1XX +408 -6 invalidated
umi GCGACGTGGG = 274 reads: +427 validated
umi TCCTGTTCCC = 251 reads: +427 validated
umi TGTTTGTACC = 198 reads: +427 validated

UMI info for barcode CAGATCACAGTTCATG-1 contig 2 = AGTCTGGGCC...
umi AAGATATTGT = 263 reads: +382 validated
umi ACATTAGTAT = 258 reads: +382 validated
umi ACTCAAAGGA = 201 reads: +382 validated
umi CACTGGGTGT = 254 reads: +382 validated
umi CACTTGTCGA = 238 reads: +382 validated
umi CGAGCGATGT = 29 reads: -317X +1 -2XX +1 -6XX +1 -2XX +1 -5XX +1 -6XX +1 -3XX +35 invalidated
umi CTCTTATCGG = 195 reads: +382 validated
umi GTCCACGAGC = 174 reads: +344 -17 +21 non-validated
umi GTTCGTTCTT = 137 reads: +382 validated
umi TCGTGTTGCC = 483 reads: -365 +17 non-validated
umi TGGTTCGGAA = 323 reads: -1XX +2 -1XX +1 -3XX +1 -4XX +2 -2XX +1 -1XX +2 -1XX +1 -1XX +358 invalidated
umi TTACTAGTAC = 295 reads: +382 validated
umi TTTCGTTGGC = 298 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=540]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
42-395 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=3)
395-422 ==> 0-27 on |22|IGHD3-9|D-REGION| [len=27] (mis=0)
423-469 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
469-540 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 3 umis using 68 reads
cdr3 = CARLYYDILTGYYALGYW at 384, score = 9 + 7
umis assigned: [26, 581, 837, 938]
of which 4 are surviving nonsolos
reads assigned: 772
start codons at 42, 193, 198, 240, 245, 262, 339, 421
confident = true

TIG 2[bases=633]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-391 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=3)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
422-633 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 10 umis using 424 reads
cdr3 = CQVWDSSSDHPVF at 355, score = 8 + 8
umis assigned: [16, 63, 100, 267, 271, 396, 470, 684, 717, 849] and 3 others
of which 12 are surviving nonsolos
reads assigned: 3107
start codons at 40, 101, 239, 242, 338
confident = true

REJECT CONTIGS

TIG 1[bases=555]
5-398 ==> 1093-1486 on rc of segment before IGHD5-12 exon 1 [len=1486] (mis=0)
416-453 ==> 9-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
453-555 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [221]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 108, 123, 147, 471, 532
confident = false
did not find CDR3
now this is a cell
paired!

ACGGCTGTGTATTACTGTGCGAGGTTGTATTACGATATTTTGACTGGTTATTATGCCTTAGGGTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGGGTCGAAGCCGGGGATGAGGCCGACTATTACTGTCAGGTGTGGGATAGTAGTAGTGATCATCCGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.526 = CAGATCACATCACCCT-1

using 272 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[269]
surviving nonsolo ucounts = 1[269]
ids = [0]

====================================================================================

UMI info for barcode CAGATCACATCACCCT-1 contig 1 = GATCAGGACT...
umi AATATTTGTC = 261 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=497]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
427-497 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CMQALQTPGTF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.527 = CAGATCACATCGGACC-1

using 237 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[6, 230]
surviving nonsolo ucounts = 1[230]
ids = [2]

====================================================================================

UMI info for barcode CAGATCACATCGGACC-1 contig 1 = TGAGCGCAGA...
umi TTTTGCTGTG = 223 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=3)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
424-552 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CGTWDSSLSAVVF at 357, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.536 = CAGATCAGTAGCGCTC-1

using 248 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[5, 242]
surviving nonsolo ucounts = 1[242]
ids = [2]

====================================================================================

UMI info for barcode CAGATCAGTAGCGCTC-1 contig 1 = AGAGCCCTGG...
umi GAAACCCGCC = 232 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=477]
0-44 ==> 3-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
44-389 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
394-432 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
432-477 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQRSNWPPTWTF at 365, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 44, 249, 252
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.537 = CAGATCAGTAGCTGCC-1

using 460 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[460]
surviving nonsolo ucounts = 1[460]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.540 = CAGATCAGTATGCTTG-1

using 851 reads

====================================================================================

graph has 246 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 206, 639]
surviving nonsolo ucounts = 2[206, 639]
ids = [3, 2]

====================================================================================

UMI info for barcode CAGATCAGTATGCTTG-1 contig 1 = CGGAATCAGT...
umi GACTTGAGAT = 634 reads: +388 validated
umi GATCGTCTCA = 209 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 130 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 834
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.543 = CAGATCAGTCAACATC-1

using 729 reads

====================================================================================

graph has 348 edges initially, 14 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 4, 152, 268, 297]
surviving nonsolo ucounts = 3[152, 268, 297]
ids = [3, 0, 4]

====================================================================================

UMI info for barcode CAGATCAGTCAACATC-1 contig 1 = GACTGATCAG...
umi CCCAGGCATG = 142 reads: +397 validated

UMI info for barcode CAGATCAGTCAACATC-1 contig 2 = GAGTCAGTCC...
umi GGCTACATGC = 271 reads: +388 validated

UMI info for barcode CAGATCAGTCAACATC-1 contig 3 = GCTCTGCTTC...
umi AACCCGACGA = 263 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=523]
34-394 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=14)
394-431 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
431-523 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CMQGTHWPLTF at 370, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 138
start codons at 34, 103, 191, 254, 353, 373, 473
confident = false

TIG 2[bases=505]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
413-505 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYDNLLWTF at 352, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 25, 31, 87, 100, 239, 362, 455
confident = false

TIG 3[bases=586]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-586 ==> 0-141 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.548 = CAGATCAGTCCTGCTT-1

using 580 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[6, 11, 560]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.550 = CAGATCAGTCGCGAAA-1

using 195 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 4, 8, 176]
surviving nonsolo ucounts = 1[176]
ids = [7]

====================================================================================

UMI info for barcode CAGATCAGTCGCGAAA-1 contig 1 = GAGTGCTTTC...
umi TTATTTGCCA = 1 reads: -20 +43 -1 +6 -1 +4 -361 non-validated
umi TTCCTTGGCC = 2 reads: -322 +2 -2 +2 -1 +9 -2 +3 -3 +1 -1X +10 -1 +3 -1 +15 -58 invalidated
umi TTCTTTGCCT = 171 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=554]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
406-454 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
454-554 ==> 0-100 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 24 reads
cdr3 = CARYFAFVNYYFDKW at 378, score = 9 + 7
umis assigned: [5, 6, 7]
of which 1 are surviving nonsolos
reads assigned: 172
start codons at 18, 39, 83
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.558 = CAGATCAGTGCCTGTG-1

using 144 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 135]
surviving nonsolo ucounts = 1[135]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.575 = CAGATCATCAATAAGG-1

using 2151 reads

====================================================================================

graph has 2481 edges initially, 54 edges after simplification

total ucounts = 823
nonsolo ucounts = 416[2^134, 3^65, 4^75, 5^49, 6^32, 7^19, 8^15, 9^13, 10^3, 11^3, 12^3, 13, 14^2, 15, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.593 = CAGATCATCGAGGTAG-1

using 188 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 1[178]
surviving nonsolo ucounts = 1[178]
ids = [6]

====================================================================================

REJECT CONTIGS

TIG 1[bases=482]
0-47 ==> 33-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
0-47 ==> 7099-7146 on rc of segment before IGHVII-30-1 exon 1 [len=7146] (mis=0)
0-47 ==> 7093-7140 on rc of segment before IGHVII-33-1 exon 1 [len=7140] (mis=0)
16-58 ==> 6507-6549 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=0)
47-398 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=5)
419-442 ==> 14-37 on |19|IGHD3-16|D-REGION| [len=37] (mis=4)
438-482 ==> 0-44 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
cdr3 = CARDIGPTVTFGGVIVTGFDYW at 389, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 47, 203, 256, 261, 264, 282, 350
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.603 = CAGATCATCTCTGCTG-1

using 286 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[286]
surviving nonsolo ucounts = 1[286]
ids = [0]

====================================================================================

UMI info for barcode CAGATCATCTCTGCTG-1 contig 1 = ACCCAGACGG...
umi TGGGTTATAT = 259 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=471]
14-359 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
358-396 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
396-471 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CLQYYNWPRTF at 335, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 14, 69, 83, 219, 438
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.605 = CAGATCATCTGGCGTG-1

using 43 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2, 3, 4, 5, 6, 10^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.609 = CAGCAGCAGACAAAGG-1

using 620 reads

====================================================================================

graph has 292 edges initially, 6 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[2, 3^2, 5, 22, 260, 320]
surviving nonsolo ucounts = 3[22, 260, 320]
ids = [4, 6, 3]

====================================================================================

UMI info for barcode CAGCAGCAGACAAAGG-1 contig 1 = AGGAATCAGT...
umi CACGTACGCC = 324 reads: +388 validated

UMI info for barcode CAGCAGCAGACAAAGG-1 contig 2 = GGGGGTCTCA...
umi GAACCTCATT = 259 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 27, 33, 102, 238, 457
confident = false

TIG 2[bases=561]
39-390 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=6)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
427-561 ==> 0-134 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CSSYTSSSTWVF at 363, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 39, 196, 240, 247, 250
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.621 = CAGCAGCAGCTAAACA-1

using 181 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[178]
surviving nonsolo ucounts = 1[178]
ids = [3]

====================================================================================

UMI info for barcode CAGCAGCAGCTAAACA-1 contig 1 = TCCCCTAGAT...
umi GTTGTACAAA = 173 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=483]
0-24 ==> 35-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
24-377 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
426-460 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
460-483 ==> 0-23 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 366, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 169
start codons at 24, 222, 227, 244, 288, 321
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.622 = CAGCAGCAGCTACCGC-1

using 20 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.631 = CAGCAGCAGGCTATCT-1

using 684 reads

====================================================================================

graph has 282 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[4, 37, 266, 372]
surviving nonsolo ucounts = 3[37, 266, 372]
ids = [8, 2, 4]

====================================================================================

UMI info for barcode CAGCAGCAGGCTATCT-1 contig 1 = GGAGTCAGAC...
umi AGACTTTTGA = 268 reads: +388 validated
umi CGGATTCTAT = 376 reads: +388 validated
umi TATTCTCGCG = 37 reads: -4 +384 non-validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=25)
383-414 ==> 8-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 125 reads
cdr3 = CQQYRSYSRDF at 353, score = 8 + 7
umis assigned: [2, 4, 8]
of which 3 are surviving nonsolos
reads assigned: 665
start codons at 26, 32, 88, 101, 152, 333, 456
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.633 = CAGCAGCAGGGTCGAT-1

using 233 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[230]
surviving nonsolo ucounts = 1[230]
ids = [3]

====================================================================================

UMI info for barcode CAGCAGCAGGGTCGAT-1 contig 1 = AGCTGTGGGC...
umi TTCTGATCCC = 224 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=19)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-554 ==> 0-132 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CNSRDSSGNEVVF at 355, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 40, 159, 188, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.634 = CAGCAGCAGGGTTTCT-1

using 188 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[182]
surviving nonsolo ucounts = 1[182]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.638 = CAGCAGCAGGTGATAT-1

using 841 reads

====================================================================================

graph has 236 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^2, 4, 8, 243, 578]
surviving nonsolo ucounts = 2[243, 578]
ids = [9, 4]

====================================================================================

UMI info for barcode CAGCAGCAGGTGATAT-1 contig 1 = GCTCTGCTTC...
umi TATCCCTACT = 236 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=565]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-384 ==> 0-333 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=11)
404-442 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
442-565 ==> 0-123 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQSNANNLDGFVF at 375, score = 8 + 7
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 51, 175, 205, 208, 358, 385, 400
confident = false

REJECT CONTIGS

TIG 1[bases=319]
7-41 ==> 5966-6000 on rc of segment after IGHV4-4 exon 1 [len=6000] (mis=0)
20-278 ==> 0-258 on |184|IGHV4-34|L-REGION+V-REGION| [len=369] (mis=0)
277-319 ==> 29-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 572
start codons at 20, 41, 85, 171
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.648 = CAGCAGCAGTGTGGCA-1

using 419 reads

====================================================================================

graph has 144 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 140, 269]
surviving nonsolo ucounts = 2[140, 269]
ids = [1, 5]

====================================================================================

UMI info for barcode CAGCAGCAGTGTGGCA-1 contig 1 = ATCAGTCCCA...
umi AGTTTATCGC = 255 reads: +388 validated

UMI info for barcode CAGCAGCAGTGTGGCA-1 contig 2 = AGCTTCAGCT...
umi ACCGTCAATA = 141 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=493]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-493 ==> 0-82 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 23, 29, 98, 234, 453
confident = false

TIG 2[bases=567]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-567 ==> 0-132 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 138
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.656 = CAGCAGCCAAGCCGCT-1

using 103 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 95]
surviving nonsolo ucounts = 1[95]
ids = [6]

====================================================================================

UMI info for barcode CAGCAGCCAAGCCGCT-1 contig 1 = GATCAGGACT...
umi TCTTTACTTT = 92 reads: +395 -1X +4 invalidated

GOOD CONTIGS

TIG 1[bases=505]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
430-505 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 91
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.661 = CAGCAGCCAATCCAAC-1

using 543 reads

====================================================================================

graph has 177 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[3, 230, 303]
surviving nonsolo ucounts = 2[230, 303]
ids = [7, 8]

====================================================================================

UMI info for barcode CAGCAGCCAATCCAAC-1 contig 1 = AGTCTGGGCC...
umi TAAGACAGGG = 1 reads: -146 +2 -1X +1 -3 +2 -1 +2 -2 +7 -1 +2 -1X +1 -1X +1 -3X +2 -1 +3 -1X +2 -1 +9 -1 +5 -183 invalidated
umi TCAGCCAGGG = 220 reads: +385 validated

UMI info for barcode CAGCAGCCAATCCAAC-1 contig 2 = GGGGAGGAGT...
umi TCAGCTTCCG = 292 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=504]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-385 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=0)
387-425 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
425-504 ==> 0-79 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQVWDSSSDHFYVF at 355, score = 8 + 8
umis assigned: [4, 7]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 40, 101, 239, 242, 338, 389
confident = false

TIG 2[bases=483]
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=17)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
419-483 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQSYTTPYTF at 358, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 31, 37, 93, 106, 263, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.665 = CAGCAGCCACAACGCC-1

using 313 reads

====================================================================================

graph has 153 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[310]
surviving nonsolo ucounts = 1[310]
ids = [3]

====================================================================================

UMI info for barcode CAGCAGCCACAACGCC-1 contig 1 = GAAGAGCTGC...
umi TGATTAAAAC = 314 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=13)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYGRSPGTF at 357, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 305
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.667 = CAGCAGCCACACCGCA-1

using 231 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[231]
surviving nonsolo ucounts = 1[231]
ids = [0]

====================================================================================

UMI info for barcode CAGCAGCCACACCGCA-1 contig 1 = TGGGGGCTGG...
umi TCAACATCAT = 230 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=572]
46-394 ==> 0-348 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=8)
396-434 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
434-572 ==> 0-138 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CSSYSSSSAVLF at 370, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 46, 203, 247, 254, 257
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.672 = CAGCAGCCACAGGCCT-1

using 21643 reads

====================================================================================

graph has 16691 edges initially, 236 edges after simplification

total ucounts = 2580
nonsolo ucounts = 1891[2^310, 3^249, 4^211, 5^180, 6^168, 7^158, 8^135, 9^96, 10^61, 11^80, 12^55, 13^33, 14^35, 15^25, 16^12, 17^12, 18^18, 19^6, 20^9, 21^3, 22, 24, 25, 30, 31, 50, 68^2, 91, 161, 165, 197, 200, 203, 231^2, 254, 258, 268, 271, 278, 282, 289, 300, 351, 368, 371^2, 376, 382, 391, 464, 633, 696, 864]
surviving nonsolo ucounts = 32[9, 30, 31, 50, 68, 91, 161, 165, 197, 200, 203, 231^2, 254, 258, 268, 271, 278, 282, 289, 300, 351, 368, 371^2, 376, 382, 391, 464, 633, 696, 864]
ids = [1344, 1025, 1854, 1373, 1534, 2252, 985, 193, 907, 829, ...]

====================================================================================

UMI info for barcode CAGCAGCCACAGGCCT-1 contig 1 = GAGGAGTCAG...
umi AATCTTGTGT = 167 reads: +388 validated
umi ACAAGGTATA = 273 reads: +388 validated
umi ACGCGATTAG = 301 reads: +388 validated
umi AGCCCTCACG = 635 reads: +388 validated
umi CATGGATATG = 196 reads: +388 validated
umi CCTTTGTGTG = 268 reads: +388 validated
umi CGCACATTCT = 210 reads: +103 -6X +279 invalidated
umi CGGGTATTTC = 873 reads: -185X +203 invalidated
umi CTTCTGGATA = 281 reads: +388 validated
umi TCGCATCCTT = 361 reads: +388 validated
umi TGACTATGCT = 348 reads: +388 validated
umi TGGCGCAGAT = 472 reads: -64X +1 -1XX +322 invalidated
umi TTCTCACGGT = 368 reads: +388 validated
umi TTCTCCAAGG = 1 reads: -388 non-validated
umi TTCTCTATGG = 377 reads: +388 validated

UMI info for barcode CAGCAGCCACAGGCCT-1 contig 2 = ACATGGGAAG...
umi AGAATCAGTC = 260 reads: +436 validated
umi CAGACCGCAA = 205 reads: +436 validated
umi CCCCTTCCAA = 160 reads: +436 validated
umi CTTAACCTAA = 10 reads: +47 -3X +3 -2X +1 -6X +2 -1 +1 -1 +1 -1 +1 -3 +28 -5 +2 -1 +61 -1 +16 -1 +29 -59 +3 -1 +6 -2 +4 -3 +1 -1 +5 -1X +22 -1 +5 -58 +47 invalidated
umi GGTCGTTCAT = 614 reads: -402 +1 -1XX +1 -20XX +2 -1XX +1 -6XX +1 invalidated
umi TACGCACCTC = 30 reads: +19 -1 +17 -2 +300 -4X +2 -4XX +1 -86 invalidated
umi TGCGGCTATA = 91 reads: +1 -1 +434 non-validated

UMI info for barcode CAGCAGCCACAGGCCT-1 contig 3 = GCTGGGGTCT...
umi AAAGTACATC = 49 reads: -384X +1 -4XX +2 invalidated
umi ACACAGCCAT = 254 reads: +391 validated
umi ACACCGTTCT = 404 reads: +214 -6XX +1 -3XX +1 -1XX +1 -10XX +1 -39XX +3 -2XX +1 -3XX +2 -10XX +93 invalidated
umi CCCTTTGGCT = 232 reads: +391 validated
umi CGGATCTTAG = 234 reads: +391 validated
umi GCTGCAACGC = 63 reads: -357X +1 -1XX +1 -2XX +2 -4XX +2 -4XX +1 -9XX +1 -4XX +2 invalidated
umi GGTTCGTGCG = 403 reads: +214 -6XX +1 -3XX +1 -1XX +1 -10XX +1 -39XX +3 -2XX +1 -3XX +2 -10XX +93 invalidated
umi TTCGACGTGT = 58 reads: -354 +1 -2X +1 -1XX +1 -2XX +2 -4XX +2 -4XX +1 -9XX +1 -4XX +2 invalidated

GOOD CONTIGS

TIG 1[bases=552]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 14 umis using 869 reads
cdr3 = CQQSYTTLLTF at 355, score = 9 + 9
umis assigned: [193, 229, 332, 465, 907, 1097, 1120, 1173, 1364, 2107] and 5 others
of which 14 are surviving nonsolos
reads assigned: 5034
start codons at 28, 34, 90, 103, 239, 458
confident = true

TIG 2[bases=643]
0-25 ==> 6-31 on |185|IGHV4-34|5'UTR| [len=31] (mis=0)
25-396 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=9)
413-461 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
461-643 ==> 0-182 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 4 umis using 86 reads
cdr3 = CARAHGDYYTLLDCW at 385, score = 8 + 7
umis assigned: [413, 829, 985, 1344, 1699, 1854, 2252]
of which 7 are surviving nonsolos
reads assigned: 1342
start codons at 2, 25, 46, 90, 176, 376
confident = true

TIG 3[bases=643]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-394 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=4)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
432-643 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 123 reads
cdr3 = CSSYTSSSTLVVF at 365, score = 8 + 8
umis assigned: [39, 237, 240, 1015, 1157, 1601, 1715, 2418]
of which 8 are surviving nonsolos
reads assigned: 1636
start codons at 41, 198, 249
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.678 = CAGCAGCCACCGATAT-1

using 8814 reads

====================================================================================

graph has 4902 edges initially, 46 edges after simplification

total ucounts = 532
nonsolo ucounts = 230[2^85, 3^48, 4^21, 5^10, 6^11, 7^7, 8^4, 9^3, 10^2, 18^3, 22, 36, 56, 82, 90, 105, 110, 120, 136, 140, 142, 149, 157^2, 170, 174, 200, 205, 208, 215, 227, 229, 230, 236, 238, 271, 273, 282, 288, 289, 301^2, 356, 369, 413, 838]
surviving nonsolo ucounts = 35[36, 56, 82, 90, 105, 110, 120, 136, 140, 142, 149, 157^2, 170, 174, 200, 205, 208, 215, 227, 229, 230, 236, 238, 271, 273, 282, 288, 289, 301^2, 356, 369, 413, 838]
ids = [346, 7, 381, 27, 522, 437, 114, 401, 279, 282, ...]

====================================================================================

UMI info for barcode CAGCAGCCACCGATAT-1 contig 1 = TGGGGGATCA...
umi AAATCACTCC = 55 reads: +397 validated
umi AATGCTACAG = 355 reads: +397 validated
umi ACACATATAA = 228 reads: +397 validated
umi ATCTCTCCCT = 123 reads: +397 validated
umi CATTTGTCGC = 238 reads: +397 validated
umi CTCTATGTCC = 301 reads: +397 validated
umi CTTCTCCATC = 303 reads: +397 validated
umi GATGTTGTCC = 280 reads: +397 validated
umi GCACAAATGG = 171 reads: +397 validated
umi TAACGTTCTA = 290 reads: +397 validated
umi TAATCTTACC = 78 reads: -16 +381 non-validated
umi TACCCTTTCC = 238 reads: +397 validated
umi TCCCAGTCGT = 372 reads: +397 validated
umi TCTTACTGCA = 274 reads: +397 validated
umi TGTCCCATTT = 205 reads: +397 validated
umi TTTCGTGTAG = 106 reads: +397 validated

UMI info for barcode CAGCAGCCACCGATAT-1 contig 2 = AGCTCTGGGA...
umi AATTGTTCTT = 280 reads: +97 -1XX +308 invalidated
umi AGGATTACGT = 193 reads: +97 -1X +308 invalidated
umi GAGGCTTCCG = 137 reads: +97 -1XX +308 invalidated
umi GATGTTCTGG = 210 reads: +97 -1 +279 -2 +7 -20 non-validated
umi GCTTAGCTCC = 262 reads: +406 validated
umi GGTTGACCAT = 35 reads: +91 -1X +5 -1X +216 -1 +1 -90 invalidated
umi TATCTCGTTC = 131 reads: +97 -1X +308 invalidated
umi TCTACCCCCT = 141 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=568]
35-395 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=14)
395-432 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 16 umis using 482 reads
cdr3 = CMQGTHWPLTF at 371, score = 9 + 9
umis assigned: [7, 37, 43, 114, 172, 247, 262, 291, 293, 377] and 6 others
of which 16 are surviving nonsolos
reads assigned: 3550
start codons at 35, 104, 192, 255, 354, 374, 474
confident = true

TIG 2[bases=556]
0-79 ==> 0-79 on |154|IGHV3-66|5'UTR| [len=79] (mis=2)
79-429 ==> 0-350 on |155|IGHV3-66|L-REGION+V-REGION| [len=350] (mis=43)
449-485 ==> 13-49 on |52|IGHJ3|J-REGION| [len=49] (mis=2)
485-556 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 65 reads
cdr3 = CATGGWSSLEVW at 418, score = 8 + 7
umis assigned: [40, 89, 282, 290, 317, 346, 401, 440]
of which 8 are surviving nonsolos
reads assigned: 1361
start codons at 79, 235, 290, 379
confident = true

REJECT CONTIGS

TIG 1[bases=687]
0-222 ==> 5915-6137 on segment before IGLV2-5 exon 1 [len=6137] (mis=7)
50-75 ==> 0-25 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=0)
75-92 ==> 26-43 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=0) [SHIFT!]
209-481 ==> 43-315 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=49) [SHIFT!]
517-555 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
555-687 ==> 0-132 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [3, 27, 226, 245, 279, 334, 423, 437, 454]
of which 9 are surviving nonsolos
reads assigned: 1308
start codons at 50, 314, 317, 434, 445
confident = false
did not find CDR3
now this is a cell
paired!

AGTCTGAGAACGGAAGACACGGCTGTGTATTACTGTGCGACTGGAGGTTGGAGTTCTTTGGAAGTCTGGGGCCACGGGACAGTGGTCACCGTCTCTTCAG <==> ATCAGCAGGGTGGAGGCTGAGGATGTTGGCGTTTACTACTGCATGCAAGGTACACACTGGCCTCTCACTTTCGGCGGAGGGTCCAAGGTGGTGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.688 = CAGCAGCCAGATAATG-1

using 128 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[128]
surviving nonsolo ucounts = 1[128]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=387]
0-343 ==> 10-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=31)
357-387 ==> 13-43 on |56|IGHJ5|J-REGION| [len=49] (mis=1)
cdr3 = CAKNSGIYAW at 332, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 112
start codons at 56, 146, 293, 354
confident = false
VJ delta = 9
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.692 = CAGCAGCCAGGAATCG-1

using 153 reads

====================================================================================

graph has 56 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[16, 133]
surviving nonsolo ucounts = 2[16, 133]
ids = [4, 1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=520]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-246 ==> 0-195 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=8)
246-406 ==> 196-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=5) [SHIFT!]
406-444 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
444-520 ==> 0-76 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 374, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 127
start codons at 51, 205, 208, 258, 357, 384, 408
confident = false
not full
frameshifted full length stopped transcript of length 520
VJ delta = 23
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.693 = CAGCAGCCAGGATTGG-1

using 7889 reads

====================================================================================

graph has 3115 edges initially, 34 edges after simplification

total ucounts = 314
nonsolo ucounts = 132[2^46, 3^17, 4^11, 5^9, 6^5, 7^7, 8^2, 9, 11^2, 13^2, 18, 20, 40, 57, 64, 95, 101, 108, 154, 187, 211, 219, 221, 239, 247, 271, 278, 286, 302, 309, 317, 348, 349, 364, 379, 380, 399, 411, 448, 501]
surviving nonsolo ucounts = 27[40, 64, 95, 101, 108, 154, 187, 211, 219, 221, 239, 247, 271, 278, 286, 302, 309, 317, 348, 349, 364, 379, 380, 399, 411, 448, 501]
ids = [197, 60, 223, 113, 141, 137, 297, 89, 292, 56, ...]

====================================================================================

UMI info for barcode CAGCAGCCAGGATTGG-1 contig 1 = ACATTTCCTT...
umi AATGCTCCTA = 345 reads: +433 validated
umi ATCTACGGTG = 64 reads: +261 -12 +3 -1 +130 -26 non-validated
umi CAGCAGGTCT = 213 reads: +375 -1 +57 non-validated
umi CTAGTCGCCC = 136 reads: +433 validated
umi CTTGAAACTG = 400 reads: -399X +1 -1XX +1 -4XX +1 -16XX +1 -1XX +1 -6XX +1 invalidated
umi GGCTTGCTGG = 38 reads: +310 -1 +3 -1 +88 -1X +16 -13 invalidated
umi GTGACTTTCC = 95 reads: +433 validated
umi TGAGATGGGT = 247 reads: +433 validated
umi TTCGTGCATT = 219 reads: +433 validated

UMI info for barcode CAGCAGCCAGGATTGG-1 contig 2 = TGGGAGGAGT...
umi AAATATAGCT = 355 reads: -121X +1 -6XX +1 -4XX +2 -1XX +1 -4XX +1 -6XX +240 invalidated
umi ATATGCTAAT = 224 reads: +388 validated
umi CATAGGTCAA = 239 reads: -102X +286 invalidated
umi CATGCAACAG = 405 reads: +388 validated
umi CCTACTACAG = 100 reads: +388 validated
umi CCTGTGTGGT = 452 reads: +388 validated
umi CTATGTATTT = 351 reads: +388 validated
umi CTCAAATTGC = 104 reads: -365X +23 invalidated
umi CTTTCTTCCG = 418 reads: +388 validated
umi GAAGGGCCTC = 299 reads: +17 -1XX +20 -1XX +9 -1XX +2 -1XX +4 -2XX +1 -299X +1 -6XX +1 -8XX +3 -3XX +1 -1XX +2 -2XX +1 -1XX invalidated
umi GGGTGCGGTG = 305 reads: +388 validated
umi TACGGTGTCG = 242 reads: +388 validated
umi TGCGTTGGTC = 293 reads: +388 validated
umi TGTGTTATAT = 279 reads: +388 validated
umi TTACGTGTCA = 370 reads: +388 validated
umi TTGCCCGAGT = 1 reads: -342X +2 -4X +2 -3X +6 -1X +1 -1 +1 -3X +8 -2X +1 -1 +10 invalidated
umi TTGTAGCTTT = 316 reads: +388 validated
umi TTTGTCGACA = 383 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=578]
0-74 ==> 71-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
74-424 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=0)
429-456 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=3)
454-507 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=1)
507-578 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 77 reads
cdr3 = CARERPITMVRGVIHWYFDLW at 413, score = 9 + 7
umis assigned: [11, 60, 89, 137, 163, 197, 223, 267, 292]
of which 9 are surviving nonsolos
reads assigned: 1733
start codons at 30, 74, 118, 437
confident = true

TIG 2[bases=555]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=3)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 15 umis using 815 reads
cdr3 = CQQYDNLPYTF at 358, score = 9 + 8
umis assigned: [0, 56, 93, 98, 113, 115, 139, 141, 166, 174] and 8 others
of which 18 are surviving nonsolos
reads assigned: 5048
start codons at 31, 37, 93, 106, 245, 368, 461
confident = true
now this is a cell
paired!

TATTACTGTGCGAGAGAAAGGCCTATTACTATGGTTCGGGGAGTTATCCACTGGTACTTCGATCTCTGGGGCCGTGGCACCCTGGTCACTGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.707 = CAGCAGCCATGGATGG-1

using 12 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.716 = CAGCAGCGTACAGCAG-1

using 702 reads

====================================================================================

graph has 254 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 4, 249, 446]
surviving nonsolo ucounts = 2[249, 446]
ids = [4, 1]

====================================================================================

UMI info for barcode CAGCAGCGTACAGCAG-1 contig 1 = GGGGTCACAA...
umi TTATCTTTAG = 246 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=524]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=0)
392-423 ==> 7-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
423-524 ==> 0-101 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CCSYAGSSTPF at 362, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 38, 177, 239, 246, 372
confident = false

REJECT CONTIGS

TIG 1[bases=445]
2-192 ==> 163-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=14)
216-263 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
263-445 ==> 0-182 on |43|IGHG2|C-REGION| [len=977] (mis=1)
cdr3 = CARDRAATARLGGMDVW at 181, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 442
start codons at 142, 220
confident = false
VJ delta = 23
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.719 = CAGCAGCGTAGCTTGT-1

using 234 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 229]
surviving nonsolo ucounts = 1[229]
ids = [2]

====================================================================================

UMI info for barcode CAGCAGCGTAGCTTGT-1 contig 1 = GGAGTCTCCC...
umi ATCCCAACTT = 227 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=507]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=14)
427-477 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
477-507 ==> 0-30 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARRYGDYVYAFDFW at 401, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 59, 233, 257, 414, 429
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.724 = CAGCAGCGTCAGATAA-1

using 266 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 260]
surviving nonsolo ucounts = 1[260]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=505]
1-332 ==> 32-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=12)
330-369 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
369-505 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQHYYSIPPTF at 308, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 38, 291, 411
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.731 = CAGCAGCGTCTCCATC-1

using 259 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[258]
surviving nonsolo ucounts = 1[258]
ids = [1]

====================================================================================

UMI info for barcode CAGCAGCGTCTCCATC-1 contig 1 = AGGAACTGCT...
umi TAATCTTCCC = 243 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=499]
0-32 ==> 15-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
32-377 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-499 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQRSNWPRTF at 353, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 32, 237, 240, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.742 = CAGCAGCGTTCCCTTG-1

using 98 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[5, 93]
surviving nonsolo ucounts = 1[93]
ids = [0]

====================================================================================

UMI info for barcode CAGCAGCGTTCCCTTG-1 contig 1 = CACCCCTCCT...
umi CCGCTCCCTG = 86 reads: +406 -3 non-validated

GOOD CONTIGS

TIG 1[bases=453]
0-42 ==> 17-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
42-395 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=23)
400-451 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
junction support: 1 umis using 13 reads
cdr3 = CARGSTSWYDYW at 384, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 86
start codons at 42, 193, 240, 245, 277, 339
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.743 = CAGCAGCGTTCTGTTT-1

using 4218 reads

====================================================================================

graph has 4006 edges initially, 104 edges after simplification

total ucounts = 1355
nonsolo ucounts = 850[2^243, 3^166, 4^109, 5^96, 6^85, 7^54, 8^40, 9^23, 10^11, 11^9, 12^3, 13^7, 15^2, 16^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.754 = CAGCAGCTCACTTACT-1

using 1854 reads

====================================================================================

graph has 2122 edges initially, 18 edges after simplification

total ucounts = 630
nonsolo ucounts = 260[2^119, 3^60, 4^33, 5^20, 6^14, 7^2, 8^4, 9^3, 15^3, 16, 616]
surviving nonsolo ucounts = 1[616]
ids = [349]

====================================================================================

REJECT CONTIGS

TIG 1[bases=344]
4-171 ==> 184-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=0)
170-208 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
208-344 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQDYNYPWTF at 147, score = 9 + 8
umis assigned: [349]
of which 1 are surviving nonsolos
reads assigned: 608
start codons at 31, 250
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.758 = CAGCAGCTCATAAAGG-1

using 243 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[239]
surviving nonsolo ucounts = 1[239]
ids = [3]

====================================================================================

UMI info for barcode CAGCAGCTCATAAAGG-1 contig 1 = AGTCCCAGTC...
umi CCTGCTTTCA = 237 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 38-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
20-371 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=2)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQLNSYPITF at 347, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 20, 26, 82, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.764 = CAGCAGCTCCAGAGGA-1

using 15 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.765 = CAGCAGCTCCAGTAGT-1

using 205 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[203]
surviving nonsolo ucounts = 1[203]
ids = [0]

====================================================================================

UMI info for barcode CAGCAGCTCCAGTAGT-1 contig 1 = GCTCTGCTTC...
umi CGCGTCTGCA = 197 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=529]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-529 ==> 0-84 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.767 = CAGCAGCTCCCAACGG-1

using 15 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.770 = CAGCAGCTCCTTTCGG-1

using 292 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2^2, 283]
surviving nonsolo ucounts = 1[283]
ids = [5]

====================================================================================

UMI info for barcode CAGCAGCTCCTTTCGG-1 contig 1 = AGCTCTGAGA...
umi GTATTACCAG = 281 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=559]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-559 ==> 0-56 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.774 = CAGCAGCTCGGCCGAT-1

using 424 reads

====================================================================================

graph has 174 edges initially, 6 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 4, 159, 257]
surviving nonsolo ucounts = 2[159, 257]
ids = [5, 2]

====================================================================================

UMI info for barcode CAGCAGCTCGGCCGAT-1 contig 1 = GACTGATCAG...
umi TTGGATGCTG = 162 reads: +403 validated

UMI info for barcode CAGCAGCTCGGCCGAT-1 contig 2 = ATCAGTCCCA...
umi GAAGGACTCA = 255 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=573]
0-34 ==> 2-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
34-394 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=0)
399-437 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
437-573 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CMQALQTPLLVTF at 370, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 158
start codons at 34, 67, 103, 191, 353, 373, 479
confident = false

TIG 2[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.785 = CAGCAGCTCTGCAAGT-1

using 274 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[272]
surviving nonsolo ucounts = 1[272]
ids = [0]

====================================================================================

UMI info for barcode CAGCAGCTCTGCAAGT-1 contig 1 = GCTCTGCTTC...
umi CATAATAGCG = 274 reads: +377 -1XX +1 -1XX +1 -4XX +1 -3XX +1 -2XX +1 -1X invalidated

GOOD CONTIGS

TIG 1[bases=529]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-529 ==> 0-84 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 0 umis using 0 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.786 = CAGCAGCTCTGCCAGG-1

using 75 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[75]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.809 = CAGCATAAGCCACGTC-1

using 285 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 5, 274]
surviving nonsolo ucounts = 1[274]
ids = [3]

====================================================================================

UMI info for barcode CAGCATAAGCCACGTC-1 contig 1 = CTGGGCCTCA...
umi CGGCGATACT = 264 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=528]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-377 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
381-419 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
419-528 ==> 0-109 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQAWDSSTEVYVF at 352, score = 6 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 37, 42, 98, 185, 331, 335, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.811 = CAGCATAAGCGATATA-1

using 213 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[206]
surviving nonsolo ucounts = 1[206]
ids = [7]

====================================================================================

REJECT CONTIGS

TIG 1[bases=628]
0-38 ==> 0-38 on |354|IGLV3-16|5'UTR| [len=38] (mis=3)
38-72 ==> 0-34 on |355|IGLV3-16|L-REGION+V-REGION| [len=347] (mis=0)
72-383 ==> 36-347 on |355|IGLV3-16|L-REGION+V-REGION| [len=347] (mis=2) [SHIFT!]
379-417 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
417-628 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 38, 97, 141, 184, 379
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.821 = CAGCATAAGGCGACAT-1

using 385 reads

====================================================================================

graph has 230 edges initially, 2 edges after simplification

total ucounts = 141
nonsolo ucounts = 92[2^37, 3^23, 4^12, 5^4, 6^8, 7^2, 8^2, 10, 12^2, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.824 = CAGCATAAGGTCATCT-1

using 265 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 6[2^3, 5, 95, 151]
surviving nonsolo ucounts = 2[95, 151]
ids = [12, 4]

====================================================================================

UMI info for barcode CAGCATAAGGTCATCT-1 contig 1 = AGCTCTGAGA...
umi ATTCTACGCT = 153 reads: +424 validated
umi TAATCGCGGC = 93 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=595]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-595 ==> 0-92 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 2 umis using 26 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [4, 12]
of which 2 are surviving nonsolos
reads assigned: 239
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.825 = CAGCATAAGGTGGGTT-1

using 233 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[230]
surviving nonsolo ucounts = 1[230]
ids = [2]

====================================================================================

UMI info for barcode CAGCATAAGGTGGGTT-1 contig 1 = CTCAGGAGGC...
umi CCTCTCGGTG = 232 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=482]
33-386 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
383-421 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
421-482 ==> 0-61 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CSSYTSSSTLVF at 357, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 33, 190, 234, 241, 244
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.829 = CAGCATAAGTCGATAA-1

using 271 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 3, 4, 6, 7, 244]
surviving nonsolo ucounts = 1[244]
ids = [5]

====================================================================================

UMI info for barcode CAGCATAAGTCGATAA-1 contig 1 = GGACTCCTGT...
umi CCGGGGCTTT = 241 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=545]
18-376 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
401-451 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
451-545 ==> 0-94 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 36 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 363, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 18, 62, 241, 244, 247, 333, 403
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.831 = CAGCATAAGTGGTCCC-1

using 14721 reads

====================================================================================

graph has 6699 edges initially, 46 edges after simplification

total ucounts = 1068
nonsolo ucounts = 436[2^177, 3^86, 4^54, 5^27, 6^17, 7^9, 8^6, 9^2, 11^2, 12^2, 13, 14^3, 16, 17, 19, 49, 51, 58, 70, 96, 142, 149, 150, 152^2, 155, 166, 168, 175, 180, 181, 183, 208, 210, 214, 215, 222, 223, 227, 228, 230, 232^2, 233, 237, 238, 241, 242, 255, 266, 268, 269, 304, 371, 424, 427, 576, 640, 692, 714, 806, 821]
surviving nonsolo ucounts = 46[49, 58, 70, 96, 142, 149, 150, 152^2, 155, 166, 168, 175, 180, 181, 183, 208, 210, 214, 215, 222, 223, 227, 228, 230, 232^2, 233, 237, 238, 241, 242, 255, 266, 268, 269, 304, 371, 424, 427, 576, 640, 692, 714, 806, 821]
ids = [604, 636, 909, 685, 888, 11, 412, 15, 104, 1009, ...]

====================================================================================

UMI info for barcode CAGCATAAGTGGTCCC-1 contig 1 = AGCTTCAGCT...
umi AAAGCAATAT = 149 reads: +391 validated
umi AAAGTCTCGG = 154 reads: +391 validated
umi AACGCGAAGG = 721 reads: -346 +1 -1XX +1 -1XX +1 -2XX +1 -2XX +3 -1XX +31 invalidated
umi AAGTGGTGTA = 227 reads: +391 validated
umi ACCCAGCGAA = 150 reads: +391 validated
umi AGATGCAGCC = 216 reads: +391 validated
umi CCCAACTTAA = 241 reads: +391 validated
umi CGATGGTACC = 228 reads: +391 validated
umi CGGGAAACGG = 271 reads: +391 validated
umi CGTAGTCTCG = 152 reads: +391 validated
umi CTCCATGCCG = 232 reads: +391 validated
umi CTCCGTGCTT = 243 reads: +391 validated
umi CTGCATACCA = 222 reads: +391 validated
umi GACTACTTTA = 178 reads: +391 validated
umi GGTCACGCCA = 215 reads: +391 validated
umi GTCACTCAAC = 94 reads: +391 validated
umi TCACCGGAAG = 419 reads: +391 validated
umi TCGTGCTTGG = 236 reads: +391 validated
umi TGACCCCCCT = 269 reads: +391 validated
umi TGACTCGACC = 228 reads: +391 validated
umi TGATCATAGC = 214 reads: +391 validated
umi TGCGACGATG = 70 reads: +311 -27 +53 non-validated
umi TGGTTTCACG = 202 reads: +391 validated
umi TGTTGATTCG = 255 reads: -16X +2 -2XX +1 -1XX +1 -2XX +1 -2XX +1 -12XX +1 -1XX +348 invalidated
umi TTAGATACCA = 305 reads: +391 validated
umi TTCTCTAGGT = 156 reads: +391 validated
umi TTTTCGCTCA = 254 reads: +391 validated

UMI info for barcode CAGCATAAGTGGTCCC-1 contig 2 = AGGTCTCAGA...
umi GCAGTTCTGG = 178 reads: +421 validated
umi TAGCCGCAGC = 170 reads: +421 validated
umi TCAACGTATG = 223 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=648]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=2)
399-437 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
437-648 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 25 umis using 777 reads
cdr3 = CAAWDDSLSGDVVF at 367, score = 7 + 8
umis assigned: [11, 15, 26, 46, 104, 162, 324, 387, 405, 412] and 17 others
of which 27 are surviving nonsolos
reads assigned: 6194
start codons at 46, 200, 350, 375, 380, 398
confident = true

TIG 2[bases=571]
0-79 ==> 0-79 on |158|IGHV3-7|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |159|IGHV3-7|L-REGION+V-REGION| [len=353] (mis=2)
452-500 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
500-571 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 3 umis using 41 reads
cdr3 = CARDGDDYGDPNFDYW at 421, score = 9 + 7
umis assigned: [559, 764, 792]
of which 3 are surviving nonsolos
reads assigned: 552
start codons at 79, 235, 296, 314, 382, 431, 437
confident = true

REJECT CONTIGS

TIG 1[bases=578]
1-424 ==> 432-855 on rc of segment before IGHD3-22 exon 1 [len=1142] (mis=2)
459-507 ==> 15-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
507-578 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [54, 166, 359, 952]
of which 4 are surviving nonsolos
reads assigned: 990
start codons at 380, 387, 464
confident = false
did not find CDR3

TIG 2[bases=914]
0-584 ==> 1723-2307 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=0)
580-742 ==> 5838-6000 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=5)
739-778 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
778-914 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [113, 226, 402, 415, 444, 510, 604, 636, 819, 888] and 1 others
of which 11 are surviving nonsolos
reads assigned: 3956
start codons at 63, 112, 119, 179, 264, 329, 361, 396, 420, 497, 550, 605, 610, 723, 738, 820
confident = false
did not find CDR3
now this is a cell
paired!

GAGGACACGGCTGTGTATTACTGTGCGAGAGATGGGGATGACTACGGTGACCCTAATTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> CTCCGGTCCGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAGTGGGGATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.833 = CAGCATACAAAGAATC-1

using 288 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[284]
surviving nonsolo ucounts = 1[284]
ids = [4]

====================================================================================

UMI info for barcode CAGCATACAAAGAATC-1 contig 1 = TGGGGGCTCT...
umi TTGCTTAGCA = 249 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=520]
83-436 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=28)
439-489 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
489-520 ==> 0-31 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARENDAFDIW at 425, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 83, 143, 234, 239, 297, 300, 386, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.837 = CAGCATACAATCGAAA-1

using 452 reads

====================================================================================

graph has 174 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[447]
surviving nonsolo ucounts = 1[447]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=580]
0-28 ==> 67-95 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
0-28 ==> 67-95 on |324|IGLV1-44|5'UTR| [len=114] (mis=0)
24-334 ==> 43-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
331-369 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
369-580 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CASWDDSLRGRVF at 302, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 443
start codons at 135, 285, 310, 315
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.841 = CAGCATACACCAGTTA-1

using 17 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.842 = CAGCATACACCGAATT-1

using 196 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[196]
surviving nonsolo ucounts = 1[196]
ids = [0]

====================================================================================

UMI info for barcode CAGCATACACCGAATT-1 contig 1 = GGAATCAGTC...
umi TAGTATAGCA = 196 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.846 = CAGCATACAGATCCAT-1

using 638 reads

====================================================================================

graph has 224 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 316, 318]
surviving nonsolo ucounts = 2[316, 318]
ids = [0, 1]

====================================================================================

UMI info for barcode CAGCATACAGATCCAT-1 contig 1 = AGACCCAGTC...
umi GTCCTGTACG = 319 reads: +388 validated

UMI info for barcode CAGCATACAGATCCAT-1 contig 2 = AGTCTGGGCC...
umi GTCCTCTCCC = 314 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 161-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
20-371 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=25)
377-408 ==> 8-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQYRSYSRDF at 347, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 314
start codons at 20, 26, 82, 95, 146, 327, 450
confident = false

TIG 2[bases=544]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-373 ==> 0-333 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=29)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-544 ==> 0-122 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQVWDSDGHYVVF at 355, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 40, 101, 170, 338, 374, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.854 = CAGCATACAGTCGATT-1

using 95 reads

====================================================================================

graph has 96 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^2, 3^2, 11, 69]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.855 = CAGCATACAGTCTTCC-1

using 1382 reads

====================================================================================

graph has 492 edges initially, 54 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[330, 344, 348, 354]
surviving nonsolo ucounts = 4[330, 344, 348, 354]
ids = [5, 7, 1, 8]

====================================================================================

UMI info for barcode CAGCATACAGTCTTCC-1 contig 1 = AGTCAGTCCC...
umi ACGCTCCTCA = 353 reads: +17 -1XX +4 -1XX +365 invalidated

UMI info for barcode CAGCATACAGTCTTCC-1 contig 2 = GAAGTCTCTC...
umi GACTTAGACC = 352 reads: +110 -1XX +277 invalidated

UMI info for barcode CAGCATACAGTCTTCC-1 contig 3 = GAGCTGCTCA...
umi GTCCCTACAA = 344 reads: +385 validated

UMI info for barcode CAGCATACAGTCTTCC-1 contig 4 = TGGGAGGAAT...
umi TTCGACACGG = 363 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 7-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
24-375 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=31)
373-412 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CHQYESVPYTF at 351, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 342
start codons at 24, 30, 86, 99, 238, 334, 361, 454
confident = false

TIG 2[bases=550]
0-26 ==> 5-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=5)
376-414 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQKYESAPRTF at 353, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 326
start codons at 26, 32, 88, 101, 237, 336, 363, 456
confident = false

TIG 3[bases=551]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYGSSPLTF at 354, score = 9 + 9
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 339
start codons at 30, 238, 364, 457
confident = false

TIG 4[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 352
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.858 = CAGCATACATCACGAT-1

using 93 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 87]
surviving nonsolo ucounts = 1[87]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=520]
0-356 ==> 2-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=12)
387-437 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
437-520 ==> 0-83 on |43|IGHG2|C-REGION| [len=977] (mis=0)
cdr3 = CAHRLSGALVWEYVKDTFDIW at 343, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 83
start codons at 42, 221, 224, 304, 313, 380, 418
confident = false
VJ delta = 12
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.873 = CAGCATAGTCTCTTAT-1

using 234 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[234]
surviving nonsolo ucounts = 1[234]
ids = [0]

====================================================================================

UMI info for barcode CAGCATAGTCTCTTAT-1 contig 1 = GTCAGTCTCA...
umi TGTACTACAG = 213 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=502]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-502 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 33 reads
cdr3 = CQQSYTTLLTF at 350, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.887 = CAGCATAGTTCGCGAC-1

using 29 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[29]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.889 = CAGCATATCAACACGT-1

using 297 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 4, 5, 6, 8, 267]
surviving nonsolo ucounts = 1[267]
ids = [1]

====================================================================================

UMI info for barcode CAGCATATCAACACGT-1 contig 1 = GCTCTGCTTC...
umi ACGGCGCGCG = 265 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=609]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=6)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
442-609 ==> 0-167 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQSYDSSLSAVVF at 375, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.894 = CAGCATATCACATAGC-1

using 322 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[3, 4, 308]
surviving nonsolo ucounts = 1[308]
ids = [8]

====================================================================================

UMI info for barcode CAGCATATCACATAGC-1 contig 1 = GGAGGAACTG...
umi TTACATTTTC = 309 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=555]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
381-419 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQRSNWPPITF at 355, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 34, 239, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.898 = CAGCATATCATCACCC-1

using 21 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.905 = CAGCATATCCATGAGT-1

using 237 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 230]
surviving nonsolo ucounts = 1[230]
ids = [6]

====================================================================================

UMI info for barcode CAGCATATCCATGAGT-1 contig 1 = GCTCTGCTTC...
umi TTAGAAGCGT = 222 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=550]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=1)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
442-550 ==> 0-108 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQSYDSSLSGWVF at 375, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.908 = CAGCATATCCGCGGTA-1

using 21 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.912 = CAGCATATCCTAGTGA-1

using 36 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[6^2, 10, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.913 = CAGCATATCCTATTCA-1

using 258 reads

====================================================================================

graph has 91 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 255]
surviving nonsolo ucounts = 1[255]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.914 = CAGCATATCGAATGGG-1

using 208 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[205]
surviving nonsolo ucounts = 1[205]
ids = [2]

====================================================================================

UMI info for barcode CAGCATATCGAATGGG-1 contig 1 = AGCTGTGGGC...
umi GGCTTGGAGC = 197 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=467]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=1)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-467 ==> 0-45 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CNSRDSSGNHLVF at 355, score = 7 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 40, 159, 188, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.927 = CAGCATATCTGCTGCT-1

using 55 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[3^2, 5, 8, 9^2, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.932 = CAGCCGAAGAAAGTGG-1

using 400 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2^3, 7, 8, 377]
surviving nonsolo ucounts = 1[377]
ids = [0]

====================================================================================

UMI info for barcode CAGCCGAAGAAAGTGG-1 contig 1 = GGAGGAACTG...
umi AAACTTTTGT = 343 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
385-422 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
422-490 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQRSNWPPELTF at 355, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 340
start codons at 34, 239, 242, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.937 = CAGCCGAAGACTCGGA-1

using 928 reads

====================================================================================

graph has 412 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 281, 642]
surviving nonsolo ucounts = 2[281, 642]
ids = [2, 5]

====================================================================================

UMI info for barcode CAGCCGAAGACTCGGA-1 contig 1 = GGGGTCACAA...
umi GGCCGTACCA = 280 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=631]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=12)
382-420 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
420-631 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CCSYAGSVLF at 362, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 38, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.938 = CAGCCGAAGAGACTAT-1

using 251 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[7^2, 234]
surviving nonsolo ucounts = 1[234]
ids = [5]

====================================================================================

UMI info for barcode CAGCCGAAGAGACTAT-1 contig 1 = CGAGCCCAGC...
umi TTACATATCG = 209 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=488]
0-67 ==> 0-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
67-420 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=2)
429-482 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CASATRSYWYFDLW at 409, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 67, 218, 223, 281, 284, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.944 = CAGCCGAAGCCAGAAC-1

using 288 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 5, 276]
surviving nonsolo ucounts = 1[276]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.951 = CAGCCGAAGCTACCTA-1

using 304 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 299]
surviving nonsolo ucounts = 1[299]
ids = [2]

====================================================================================

UMI info for barcode CAGCCGAAGCTACCTA-1 contig 1 = TGGGGAGGAG...
umi TGATATAGGG = 258 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=438]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-438 ==> 0-21 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQSYSTPSF at 359, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 32, 38, 94, 107, 243
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.953 = CAGCCGAAGGACAGCT-1

using 467 reads

====================================================================================

graph has 236 edges initially, 2 edges after simplification

total ucounts = 26
nonsolo ucounts = 15[2^5, 3^4, 6^2, 8, 14, 21, 379]
surviving nonsolo ucounts = 1[379]
ids = [13]

====================================================================================

UMI info for barcode CAGCCGAAGGACAGCT-1 contig 1 = GAGTCAGTCT...
umi CTGGTGGTTG = 336 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=504]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-504 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQSYSTPLTF at 352, score = 9 + 9
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.954 = CAGCCGAAGGACGAAA-1

using 1089 reads

====================================================================================

graph has 546 edges initially, 12 edges after simplification

total ucounts = 185
nonsolo ucounts = 39[2^22, 3^8, 4^4, 6^3, 14, 826]
surviving nonsolo ucounts = 1[826]
ids = [171]

====================================================================================

REJECT CONTIGS

TIG 1[bases=301]
3-128 ==> 235-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=4)
127-165 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
165-301 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQGTHWPWTF at 104, score = 8 + 8
umis assigned: [171]
of which 1 are surviving nonsolos
reads assigned: 818
start codons at 87, 107, 207
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.956 = CAGCCGAAGGGATACC-1

using 301 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^3, 4, 287]
surviving nonsolo ucounts = 1[287]
ids = [5]

====================================================================================

UMI info for barcode CAGCCGAAGGGATACC-1 contig 1 = TCACATAACA...
umi ATTTACTCTC = 288 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=537]
0-57 ==> 1-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
57-410 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=9)
411-429 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=2)
430-493 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
493-537 ==> 0-44 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARVGYSSSASYYYYYAMDVW at 399, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 57, 208, 255, 354, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.987 = CAGCCGACAGACACTT-1

using 269 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[268]
surviving nonsolo ucounts = 1[268]
ids = [0]

====================================================================================

UMI info for barcode CAGCCGACAGACACTT-1 contig 1 = GGGGTCACAA...
umi TTCTGCAACC = 259 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=560]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
395-423 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
423-560 ==> 0-137 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 49 reads
cdr3 = CFSYGTSGRTF at 362, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 38, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.988 = CAGCCGACAGAGCCAA-1

using 16033 reads

====================================================================================

graph has 5902 edges initially, 98 edges after simplification

total ucounts = 430
nonsolo ucounts = 186[2^59, 3^39, 4^14, 5^7, 6^6, 7^3, 8^6, 9^3, 10, 11^3, 13, 15, 22, 25, 29, 69, 75, 78, 84, 95, 140, 156, 186, 200, 211, 213, 214, 228, 252, 271, 273, 284, 287, 291, 295, 313, 317, 331, 333, 347, 369, 371, 374, 421, 465, 472, 521, 551, 561, 694, 729, 841, 1013, 1083, 1176]
surviving nonsolo ucounts = 40[25, 29, 69, 75, 95, 140, 156, 186, 200, 211, 213, 214, 228, 252, 271, 273, 284, 287, 291, 295, 313, 317, 331, 333, 347, 369, 371, 374, 421, 465, 472, 521, 551, 561, 694, 729, 841, 1013, 1083, 1176]
ids = [117, 48, 56, 171, 352, 21, 134, 11, 96, 428, ...]

====================================================================================

UMI info for barcode CAGCCGACAGAGCCAA-1 contig 1 = AGCTCTGGGA...
umi AACGGCTCCG = 278 reads: +147 -1XX +50 -1XX +226 -1X +10 -1 +5 invalidated
umi AATAGCTCAT = 289 reads: +442 validated
umi ACCATTGTTG = 272 reads: +442 validated
umi CCCGTCACGC = 162 reads: +147 -1XX +294 invalidated
umi CGAACCAGCC = 329 reads: +147 -1XX +294 invalidated
umi TTTTCGTTTG = 219 reads: +147 -1XX +294 invalidated

UMI info for barcode CAGCCGACAGAGCCAA-1 contig 2 = GGGGTCACAA...
umi AATCATTGGT = 137 reads: +394 validated
umi CAATTATAGT = 218 reads: +394 validated
umi CCAAATGGCT = 283 reads: +394 validated
umi CCCGGCCTTT = 549 reads: +394 validated
umi CGATCTCCAA = 273 reads: +394 validated
umi CGTGTCACTG = 291 reads: +394 validated
umi GCCAATATGG = 1167 reads: -291 +103 non-validated
umi GGTCATTTCC = 469 reads: +394 validated
umi TATACCTCTG = 343 reads: +394 validated
umi TCGCATACAG = 213 reads: +394 validated
umi TCGCTGGATG = 98 reads: +394 validated
umi TGGGCGCGAG = 229 reads: +394 validated
umi TTTAAACTGT = 324 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=593]
0-80 ==> 0-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=1)
80-439 ==> 0-359 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=17)
439-470 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=3)
471-522 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
522-593 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 62 reads
cdr3 = CTRGGYCSGVSCYSRNWFDPW at 428, score = 8 + 7
umis assigned: [9, 18, 33, 134, 154, 428]
of which 6 are surviving nonsolos
reads assigned: 1476
start codons at 80, 133, 303, 360, 389
confident = true

TIG 2[bases=643]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=7)
394-432 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
432-643 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 13 umis using 656 reads
cdr3 = CCSYAGSSTIPYVF at 362, score = 8 + 8
umis assigned: [21, 95, 119, 133, 158, 177, 235, 271, 319, 350] and 3 others
of which 13 are surviving nonsolos
reads assigned: 4501
start codons at 38, 239, 246, 372, 396, 564
confident = true

REJECT CONTIGS

TIG 1[bases=359]
21-74 ==> 3108-3161 on segment before IGLJ5 exon 1 [len=3161] (mis=7)
110-148 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
148-359 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [38, 140, 218]
of which 3 are surviving nonsolos
reads assigned: 2488
start codons at 5, 91
confident = false
did not find CDR3

TIG 2[bases=543]
2-297 ==> 1805-2100 on segment after IGLV3-12 exon 2 [len=6000] (mis=0)
294-332 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
332-543 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
umis assigned: [53, 96, 100, 113, 304, 368, 386]
of which 7 are surviving nonsolos
reads assigned: 3962
start codons at 28, 147, 154, 225, 253
confident = false
did not find CDR3

TIG 3[bases=549]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
0-27 ==> 6795-6822 on rc of segment before IGKV3-34 exon 2 [len=6822] (mis=0)
16-79 ==> 5678-5741 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=18)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [10, 11, 48, 56, 117, 149, 171, 282, 307, 324] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2416
start codons at 27, 33, 89, 102, 245, 364, 370, 455
confident = false
did not find CDR3
now this is a cell
paired!

TATTATTGTACCAGAGGGGGATATTGTAGTGGTGTTAGCTGCTACTCACGGAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> CTCCAGGCTGAGGACGAGGCTGATTACTACTGCTGCTCATATGCAGGTAGTAGCACTATCCCTTATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.992 = CAGCCGACAGCCTGTG-1

using 165 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 5, 9, 148]
surviving nonsolo ucounts = 1[148]
ids = [4]

====================================================================================

UMI info for barcode CAGCCGACAGCCTGTG-1 contig 1 = GAAGAGCTGC...
umi TCTAATCTCC = 135 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=500]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=5)
383-421 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
421-500 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQLYGNSPLFTF at 357, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 135
start codons at 33, 367, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.995 = CAGCCGACAGCTGCTG-1

using 37 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 6[2^2, 3^2, 5, 14]
surviving nonsolo ucounts = 1[14]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1006 = CAGCCGACATCAGTAC-1

using 117 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 110]
surviving nonsolo ucounts = 1[110]
ids = [3]

====================================================================================

UMI info for barcode CAGCCGACATCAGTAC-1 contig 1 = GGGTCCAGGA...
umi CGATTGCTTC = 99 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=421]
0-33 ==> 10-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
33-370 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
377-415 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CQSADSSGTYWVF at 348, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 97
start codons at 33, 94, 163, 181
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1009 = CAGCCGACATCCTAGA-1

using 1840 reads

====================================================================================

graph has 2758 edges initially, 38 edges after simplification

total ucounts = 941
nonsolo ucounts = 358[2^171, 3^75, 4^42, 5^29, 6^10, 7^9, 8^4, 9^6, 11^4, 12, 13, 14^2, 15, 17, 18, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1024 = CAGCCGAGTAGCGATG-1

using 233 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[232]
surviving nonsolo ucounts = 1[232]
ids = [1]

====================================================================================

UMI info for barcode CAGCCGAGTAGCGATG-1 contig 1 = AGTCCCACTC...
umi TGTCGTGGTA = 211 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=464]
0-20 ==> 7-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
408-464 ==> 0-56 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQYSSSPWTF at 347, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 20, 26, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1029 = CAGCCGAGTCAGTGGA-1

using 42 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[42]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1043 = CAGCCGAGTGAGCGAT-1

using 537 reads

====================================================================================

graph has 260 edges initially, 4 edges after simplification

total ucounts = 27
nonsolo ucounts = 5[2^3, 238, 271]
surviving nonsolo ucounts = 2[238, 271]
ids = [18, 8]

====================================================================================

UMI info for barcode CAGCCGAGTGAGCGAT-1 contig 1 = AGCTCTGGGA...
umi CAAATACGCG = 246 reads: +442 validated

UMI info for barcode CAGCCGAGTGAGCGAT-1 contig 2 = GGAGTCAGTC...
umi GCCTCCAGTC = 223 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=545]
0-80 ==> 0-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=2)
440-461 ==> 0-21 on |33|IGHD6-19|D-REGION| [len=21] (mis=3)
459-522 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=4)
522-545 ==> 0-23 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CTRANYSSGWYIYYYYYMDVW at 428, score = 8 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 80, 133, 231, 236, 303, 360, 389, 479
confident = false

TIG 2[bases=484]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=0)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=4)
414-484 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQSYSTPPTF at 353, score = 9 + 8
umis assigned: [18]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1049 = CAGCCGAGTGTGCCTG-1

using 37375 reads

====================================================================================

graph has 10814 edges initially, 144 edges after simplification

total ucounts = 768
nonsolo ucounts = 373[2^87, 3^65, 4^33, 5^20, 6^15, 7^8, 8^4, 9^2, 10, 11, 13^3, 16, 18, 21, 33, 37, 38, 43, 48, 52, 68, 69, 71, 73, 75, 92, 97, 109, 114, 126, 127, 129, 130, 132^3, 134, 143, 153, 157, 162, 168, 175, 178, 185, 186, 188, 189, 191, 194, 197, 202^2, 203, 204, 205, 216, 218, 219, 222, 223, 229, 230, 233, 236^2, 239^2, 241, 242, 243^2, 245, 246, 248, 250, 254^2, 257, 258, 264, 267^2, 272^3, 273^2, 274^2, 276, 277, 279, 280, 282, 285^2, 287, 289, 295, 296, 298, 305^2, 306, 310, 318, 321, 322^2, 324^2, 327, 329, 332, 333, 336, 341, 345, 346^2, 347, 348, 353, 355, 356, 359, 365, 366^2, 370, 373, 375, 379, 381, 396, 419, 527, 635, 671, 708, 787, 817, 846, 1576]
surviving nonsolo ucounts = 121[48, 52, 69, 73, 75, 97, 126, 127, 129, 130, 132^3, 134, 143, 157, 162, 168, 175, 178, 185, 186, 188, 189, 191, 194, 197, 202^2, 203, 204, 205, 216, 218, 219, 222, 223, 229, 230, 233, 236^2, 239^2, 241, 242, 243^2, 245, 246, 248, 250, 254^2, 257, 258, 264, 267^2, 272^3, 273^2, 274^2, 276, 277, 279, 280, 282, 285^2, 287, 289, 295, 296, 298, 305^2, 306, 310, 318, 321, 322^2, 324^2, 327, 329, 332, 333, 336, 341, 345, 346^2, 347, 348, 353, 355, 356, 359, 365, 366^2, 370, 373, 375, 379, 381, 396, 419, 527, 635, 671, 708, 787, 817, 846, 1576]
ids = [585, 734, 588, 716, 385, 530, 37, 261, 461, 320, ...]

====================================================================================

UMI info for barcode CAGCCGAGTGTGCCTG-1 contig 1 = GCTCTGCTTC...
umi AACTTGCCCT = 237 reads: +394 validated
umi AAGTGTGACT = 254 reads: +394 validated
umi ACACCTTCGC = 204 reads: +394 validated
umi ACCAGAACCT = 278 reads: +394 validated
umi ACTAAACCCT = 352 reads: +394 validated
umi ACTCCTCTCA = 235 reads: +394 validated
umi AGTACTTCCG = 292 reads: +394 validated
umi AGTGCCCTTT = 640 reads: -356 +38 non-validated
umi ATATGGCTCG = 192 reads: +394 validated
umi ATCCCGTCTT = 273 reads: +394 validated
umi ATGATCAGAG = 224 reads: +394 validated
umi ATTTTGATAG = 253 reads: +394 validated
umi ATTTTTCGAG = 339 reads: +394 validated
umi CACCCACCGG = 298 reads: +394 validated
umi CATGTCTGAA = 204 reads: +394 validated
umi CCAACGTCTT = 282 reads: +394 validated
umi CCGCTCGGGT = 287 reads: +394 validated
umi CGACTATAGC = 343 reads: +394 validated
umi CGCGTGTTAA = 237 reads: +394 validated
umi CGGCGGGTAT = 313 reads: +394 validated
umi CTCTTGCCGT = 245 reads: +394 validated
umi CTGTTTTCTT = 326 reads: +394 validated
umi GATGGAAGCG = 269 reads: +394 validated
umi GCTCTACGCC = 251 reads: +394 validated
umi GGTCCTAGTG = 246 reads: +394 validated
umi GTAACCCTTC = 238 reads: +394 validated
umi GTGCTTATCA = 292 reads: +394 validated
umi GTGTCGCGGC = 282 reads: +394 validated
umi TCAGCCTCTA = 280 reads: +394 validated
umi TCTTCCGTCA = 310 reads: +394 validated
umi TGATCATCTC = 207 reads: +394 validated
umi TTTGGGCATA = 267 reads: +394 validated

UMI info for barcode CAGCCGAGTGTGCCTG-1 contig 2 = TGGGGATGCT...
umi AAAACAGTAA = 322 reads: +457 validated
umi AAAACCTTGT = 239 reads: +457 validated
umi AATCTAAGCC = 197 reads: +457 validated
umi AATCTCCTCC = 125 reads: +446 -1X +10 invalidated
umi AATTATCTCC = 131 reads: +457 validated
umi ACCAATGCCG = 338 reads: +457 validated
umi ACGTTTTCGT = 387 reads: +457 validated
umi ACTAATCTCT = 195 reads: +457 validated
umi AGATCGGGGT = 272 reads: +457 validated
umi AGCTCTATTC = 351 reads: +457 validated
umi AGCTGACAGC = 190 reads: +457 validated
umi AGTAGTTCCT = 144 reads: -443 +9 -1X +4 invalidated
umi AGTTTGTGCT = 272 reads: +457 validated
umi ATACACTGCA = 278 reads: +457 validated
umi ATTATTTCTT = 176 reads: +457 validated
umi ATTTTGCGGT = 322 reads: +457 validated
umi CAATATCTCT = 185 reads: +457 validated
umi CATAGTACGG = 382 reads: +55 -1XX +401 invalidated
umi CCCTATTCCT = 114 reads: -422 +4 -1 +2 -1 +1 -1X +1 -2X +2 -2XX +13 -1XX +4 invalidated
umi CGCAACGGCG = 251 reads: +457 validated
umi CGCCGATGTA = 166 reads: +457 validated
umi CGGAATTTGT = 133 reads: -2X +414 -1X +40 invalidated
umi CGGATTCTCG = 265 reads: +368 -1XX +81 -7 invalidated
umi CGTTTTATTA = 262 reads: +457 validated
umi CTACTTTTTC = 243 reads: +457 validated
umi CTAGATTAGT = 224 reads: +457 validated
umi GACCGCTGTA = 160 reads: -450 +2 -1X +4 invalidated
umi GAGTGGAGCT = 347 reads: +457 validated
umi GATCTCTCTT = 135 reads: +453 -1 +3 non-validated
umi GCATGTACGG = 368 reads: +457 validated
umi GCCGTGCCCT = 169 reads: +457 validated
umi GCGGATGATC = 130 reads: +457 validated
umi GCTGTTCGCC = 337 reads: +457 validated
umi GGGGACTTCG = 204 reads: +457 validated
umi GTATTTACGT = 99 reads: +457 validated
umi GTCCTACTAT = 168 reads: +457 validated
umi GTGTCTCGGA = 245 reads: +457 validated
umi TACAAATCAG = 201 reads: +457 validated
umi TACCTCCCCT = 49 reads: +28 -1 +5 -2 +380 -4 +37 non-validated
umi TACGGTCCAA = 68 reads: -13X +441 -3 invalidated
umi TCATCTCCAC = 296 reads: +457 validated
umi TCCGCCGCTC = 230 reads: +457 validated
umi TCCGGGCCCT = 152 reads: +429 -28 non-validated
umi TCGCGTTCAG = 131 reads: +450 -7 non-validated
umi TCGGGCTATC = 371 reads: +457 validated
umi TGCCTGTTCA = 218 reads: +457 validated
umi TTACGTATCA = 73 reads: +390 -1 +10 -1 +7 -1 +47 non-validated
umi TTCATCTCAA = 51 reads: +423 -8 +11 -1 +14 non-validated
umi TTCCGCTCGT = 348 reads: +457 validated
umi TTGCTTCACC = 239 reads: +452 -5 non-validated
umi TTGTTTATGC = 275 reads: +457 validated
umi TTTCTTTGTC = 356 reads: +457 validated
umi TTTTTTGCCG = 289 reads: +457 validated
umi TTTTTTTCCT = 187 reads: +457 validated

GOOD CONTIGS

TIG 1[bases=656]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=5)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
445-656 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 31 umis using 1319 reads
cdr3 = CQSYDSSLSALYVF at 375, score = 8 + 8
umis assigned: [20, 30, 51, 62, 81, 88, 127, 133, 163, 169] and 22 others
of which 32 are surviving nonsolos
reads assigned: 8788
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = true

TIG 2[bases=549]
21-398 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=3)
428-478 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
478-549 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 42 umis using 814 reads
cdr3 = CARHNSSGWYIDPRAAFDIW at 387, score = 8 + 8
umis assigned: [0, 2, 36, 37, 40, 61, 79, 82, 107, 113] and 44 others
of which 54 are surviving nonsolos
reads assigned: 11898
start codons at 5, 21, 30, 42, 86, 459
confident = true

REJECT CONTIGS

TIG 1[bases=550]
0-63 ==> 5937-6000 on segment before IGKV2D-40 exon 1 [len=6000] (mis=2)
23-69 ==> 3411-3457 on segment before IGKV2OR2-2 exon 1 [len=3837] (mis=2)
30-390 ==> 0-360 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=5)
390-414 ==> 14-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQSIQLSK at 366, score = 8 + 4
umis assigned: [45, 84, 92, 93, 110, 139, 147, 165, 183, 209] and 15 others
of which 25 are surviving nonsolos
reads assigned: 7276
start codons at 30, 63, 99, 187, 250, 349, 369, 456
confident = false
not full
frameshifted full length transcript of length 550
VJ delta = 21
not full

TIG 2[bases=767]
5-29 ==> 5976-6000 on segment before IGLV10-54 exon 1 [len=6000] (mis=0)
42-85 ==> 0-43 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=0)
88-200 ==> 0-112 on segment before IGLV10-54 exon 2 [len=112] (mis=0)
197-440 ==> 43-286 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=2) [SHIFT!]
452-518 ==> 286-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=1) [SHIFT!]
518-556 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
556-767 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [39, 43, 161, 189, 191, 233, 329, 403, 459, 671]
of which 10 are surviving nonsolos
reads assigned: 6661
start codons at 42, 293, 495, 518
confident = false
see insertion of CTGGACTCCAGC at pos 286 on |333|IGLV10-54|L-REGION+V-REGION|
did not find CDR3
now this is a cell
paired!

GTGTATTACTGTGCGAGACATAATAGCAGTGGCTGGTACATTGATCCACGGGCCGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> CTCCAGGCTGAGGATGAGGCTGATTATTACTGCCAGTCCTATGACAGCAGCCTGAGTGCCCTTTATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1052 = CAGCCGAGTTCATGGT-1

using 309 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 303]
surviving nonsolo ucounts = 1[303]
ids = [0]

====================================================================================

UMI info for barcode CAGCCGAGTTCATGGT-1 contig 1 = GCTGGGGTCT...
umi AACACTGTCC = 292 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=589]
0-41 ==> 1-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
41-369 ==> 0-328 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=14)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
429-589 ==> 0-160 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 45 reads
cdr3 = CSSEAGSYTLLF at 365, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 287
start codons at 41, 192, 198, 249, 252, 348
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1059 = CAGCCGAGTTTAGGAA-1

using 636 reads

====================================================================================

graph has 190 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 244, 385]
surviving nonsolo ucounts = 2[244, 385]
ids = [1, 2]

====================================================================================

UMI info for barcode CAGCCGAGTTTAGGAA-1 contig 1 = AGCTTCAGCT...
umi CTTGTCCCCA = 236 reads: +388 validated

UMI info for barcode CAGCCGAGTTTAGGAA-1 contig 2 = GAGGAACTGC...
umi GACACTTAGT = 355 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=541]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
435-541 ==> 0-106 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CSAWDDSLNAPVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 47, 351, 376, 381, 393
confident = false

TIG 2[bases=489]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=8)
383-415 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-489 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CQQRSNWPPTF at 354, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 354
start codons at 33, 238, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1064 = CAGCCGATCACCCGAG-1

using 39 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[4, 15, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1065 = CAGCCGATCACGCGGT-1

using 12952 reads

====================================================================================

graph has 10089 edges initially, 260 edges after simplification

total ucounts = 2534
nonsolo ucounts = 1822[2^338, 3^235, 4^190, 5^150, 6^126, 7^139, 8^105, 9^108, 10^79, 11^82, 12^60, 13^45, 14^42, 15^27, 16^24, 17^15, 18^16, 19^12, 20^11, 21^4, 22^2, 23^4, 24, 25^3, 27^2, 28, 41]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1066 = CAGCCGATCAGCATGT-1

using 535 reads

====================================================================================

graph has 247 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2, 3, 5, 232, 292]
surviving nonsolo ucounts = 2[232, 292]
ids = [3, 4]

====================================================================================

UMI info for barcode CAGCCGATCAGCATGT-1 contig 1 = GGGCCTCAGG...
umi GATTGCCCTT = 236 reads: +376 validated
umi TCGGAGAGTG = 294 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=622]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-375 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
373-411 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
411-622 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 93 reads
cdr3 = CQAWDSSTVVF at 350, score = 6 + 8
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 518
start codons at 35, 40, 96, 183, 329, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1067 = CAGCCGATCAGGATCT-1

using 417 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 4, 403]
surviving nonsolo ucounts = 1[403]
ids = [10]

====================================================================================

UMI info for barcode CAGCCGATCAGGATCT-1 contig 1 = TGGGAGGAAT...
umi TTGAGGGTGA = 401 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 396
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1073 = CAGCCGATCCCATTAT-1

using 520 reads

====================================================================================

graph has 162 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 71, 154, 287]
surviving nonsolo ucounts = 3[71, 154, 287]
ids = [8, 3, 5]

====================================================================================

UMI info for barcode CAGCCGATCCCATTAT-1 contig 1 = GATCAGGACT...
umi CTATTTGGCA = 144 reads: +397 validated
umi GCCCCTTGTA = 262 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=511]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-511 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 79 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [3, 5]
of which 2 are surviving nonsolos
reads assigned: 401
start codons at 30, 63, 99, 187, 349, 369, 469
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1085 = CAGCCGATCGCCAAAT-1

using 12 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1091 = CAGCCGATCTCCGGTT-1

using 1244 reads

====================================================================================

graph has 334 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[1243]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1095 = CAGCCGATCTGAGTGT-1

using 333 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 325]
surviving nonsolo ucounts = 1[325]
ids = [1]

====================================================================================

UMI info for barcode CAGCCGATCTGAGTGT-1 contig 1 = CAGCTCACAT...
umi ATGACCTCTG = 327 reads: +457 validated

GOOD CONTIGS

TIG 1[bases=559]
0-31 ==> 0-31 on |185|IGHV4-34|5'UTR| [len=31] (mis=0)
31-402 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=1)
409-440 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=8)
437-488 ==> 12-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
488-559 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARGSHGRRFLEWLPHYGMDVW at 391, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 8, 31, 52, 96, 182, 407, 445
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1098 = CAGCCGATCTGCCAGG-1

using 431 reads

====================================================================================

graph has 190 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 5[2^2, 4, 139, 274]
surviving nonsolo ucounts = 2[139, 274]
ids = [2, 0]

====================================================================================

UMI info for barcode CAGCCGATCTGCCAGG-1 contig 1 = GGGACTCCTG...
umi CCCCGTGTTG = 136 reads: +433 validated

UMI info for barcode CAGCCGATCTGCCAGG-1 contig 2 = TCTCAGGAGG...
umi AACTAGTGGA = 268 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=537]
19-377 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
402-452 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
452-537 ==> 0-85 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 17 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 364, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 136
start codons at 19, 63, 242, 245, 248, 334, 404
confident = false

TIG 2[bases=565]
0-34 ==> 129-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
34-388 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=3)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
425-565 ==> 0-140 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CSSYAGSNNPVVF at 358, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 34, 191, 235, 242, 341, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1103 = CAGCCGATCTTAGAGC-1

using 608 reads

====================================================================================

graph has 192 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 277, 327]
surviving nonsolo ucounts = 2[277, 327]
ids = [1, 3]

====================================================================================

UMI info for barcode CAGCCGATCTTAGAGC-1 contig 1 = GAGGAACTGC...
umi CGTATATAGA = 274 reads: +388 validated

UMI info for barcode CAGCCGATCTTAGAGC-1 contig 2 = GATCAGGACT...
umi GGTCATACTT = 325 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQRSNWPPLYTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 33, 238, 241, 463
confident = false

TIG 2[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1109 = CAGCGACAGAGGGATA-1

using 387 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[71, 315]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1121 = CAGCGACAGCGGATCA-1

using 321 reads

====================================================================================

graph has 141 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 10, 305]
surviving nonsolo ucounts = 1[305]
ids = [2]

====================================================================================

UMI info for barcode CAGCGACAGCGGATCA-1 contig 1 = GCTGTGGGTC...
umi CTGGTATCGG = 293 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=566]
0-38 ==> 5-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
38-358 ==> 0-320 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=28)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
429-566 ==> 0-137 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQSADSISPLATRVTF at 353, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 286
start codons at 38, 168, 186, 305
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1125 = CAGCGACAGGACAGCT-1

using 9618 reads

====================================================================================

graph has 3462 edges initially, 54 edges after simplification

total ucounts = 320
nonsolo ucounts = 124[2^40, 3^19, 4^16, 5^7, 6^3, 7^4, 8, 9^3, 15, 35, 62, 69, 112, 130, 194, 213, 226, 238, 258, 272, 275, 291, 299, 301, 305, 309, 316, 320, 336, 341, 365, 366, 379, 382, 420, 436, 518, 601, 721]
surviving nonsolo ucounts = 30[35, 62, 69, 112, 130, 194, 213, 226, 238, 258, 272, 275, 291, 299, 301, 305, 309, 316, 320, 336, 341, 365, 366, 379, 382, 420, 436, 518, 601, 721]
ids = [250, 166, 195, 246, 222, 4, 65, 84, 194, 150, ...]

====================================================================================

UMI info for barcode CAGCGACAGGACAGCT-1 contig 1 = ATCATCCAAC...
umi AAAGATTTGA = 168 reads: +421 validated
umi AAATGACCCT = 294 reads: +421 validated
umi AGTGTATTGT = 186 reads: +421 validated
umi ATGTAATTGT = 226 reads: +421 validated
umi CAAACGCCAC = 322 reads: +421 validated
umi CCTGTGGGCG = 291 reads: +421 validated
umi CGCGACATCG = 304 reads: +421 validated
umi CTCCCTGGGG = 306 reads: +421 validated
umi GACGAGCGGT = 263 reads: +421 validated
umi TAATGTGGGT = 111 reads: +421 validated
umi TATCCCGTTA = 276 reads: +421 validated
umi TCAAACGAAA = 29 reads: +356 -3 +62 non-validated
umi TTAATCTCCA = 436 reads: +421 validated

UMI info for barcode CAGCGACAGGACAGCT-1 contig 2 = GGAGTCAGTC...
umi AAAAGTTAAA = 609 reads: +388 validated
umi AAAATTCCTT = 364 reads: +388 validated
umi AGGCTTAAGG = 301 reads: +388 validated
umi AGTGATAGGG = 324 reads: +388 validated
umi CATACCGCCA = 382 reads: +388 validated
umi CATCCACCGT = 489 reads: -273 +2 -1XX +2 -1XX +3 -1XX +25 -1XX +3 -1XX +7 -1XX +8 -1XX +9 -1X +2 -7X +3 -2XX +2 -1XX +6 -2XX +15 -1XX +7 invalidated
umi CCTCAAGGCT = 272 reads: +388 validated
umi CGTGGTCATA = 258 reads: +388 validated
umi GCCTACATGT = 70 reads: +4 -12 +1 -1 +370 non-validated
umi TAAATATGGA = 378 reads: +388 validated
umi TATAGGATGG = 721 reads: +388 validated
umi TTACCTCTCT = 417 reads: +388 validated
umi TTTACACTAA = 321 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=2)
412-433 ==> 0-21 on |33|IGHD6-19|D-REGION| [len=21] (mis=2)
439-479 ==> 6-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
479-550 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 12 umis using 290 reads
cdr3 = CARGGGSSGWYPRDYW at 400, score = 9 + 7
umis assigned: [4, 7, 65, 84, 91, 131, 144, 162, 179, 222] and 3 others
of which 13 are surviving nonsolos
reads assigned: 3162
start codons at 58, 214, 256, 322, 355
confident = true

TIG 2[bases=550]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 12 umis using 668 reads
cdr3 = CQQYDNLPPTF at 353, score = 9 + 8
umis assigned: [1, 2, 58, 64, 104, 105, 124, 150, 195, 215] and 3 others
of which 13 are surviving nonsolos
reads assigned: 4833
start codons at 26, 32, 88, 101, 240, 363, 456
confident = true
now this is a cell
paired!

GAGGACACGGCCGTGTATTACTGTGCTAGAGGCGGGGGTAGCAGTGGCTGGTACCCTAGGGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCCTCCCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1128 = CAGCGACAGTACACCT-1

using 262 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[262]
surviving nonsolo ucounts = 1[262]
ids = [0]

====================================================================================

UMI info for barcode CAGCGACAGTACACCT-1 contig 1 = GCTTTCTGAG...
umi TAACCGGGCC = 252 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=554]
35-172 ==> 0-137 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=25)
172-298 ==> 140-266 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=30)
419-465 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=12)
465-554 ==> 0-89 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CARGPLVRGILGKGYYLDLW at 374, score = 8 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 35, 79, 344
confident = false
see deletion of 3 bases at pos 137 on |197|IGHV4/OR15-8|L-REGION+V-REGION|
>vscore_22.1128_77.1%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGCGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1129 = CAGCGACAGTCGATAA-1

using 210 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 5, 196]
surviving nonsolo ucounts = 1[196]
ids = [7]

====================================================================================

UMI info for barcode CAGCGACAGTCGATAA-1 contig 1 = AGCTTCAGCT...
umi TGAACTTGGC = 189 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=543]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=2)
399-437 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
437-543 ==> 0-106 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CAAWDDSLSAYVVF at 367, score = 7 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 46, 200, 350, 375, 380, 398
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1132 = CAGCGACAGTGCCAGA-1

using 243 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[237]
surviving nonsolo ucounts = 1[237]
ids = [4]

====================================================================================

UMI info for barcode CAGCGACAGTGCCAGA-1 contig 1 = GGGGGTCTCA...
umi CTTAATTTTT = 235 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=565]
39-390 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
427-565 ==> 0-138 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CSSYTSSSTWVF at 363, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 39, 196, 240, 247, 250
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1138 = CAGCGACCAAGTAGTA-1

using 264 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 5[2^4, 245]
surviving nonsolo ucounts = 1[245]
ids = [11]

====================================================================================

UMI info for barcode CAGCGACCAAGTAGTA-1 contig 1 = ATCAGTCCCA...
umi GGCTTACATA = 216 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=492]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-492 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1149 = CAGCGACCACGAGAGT-1

using 598 reads

====================================================================================

graph has 270 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 204, 386]
surviving nonsolo ucounts = 2[204, 386]
ids = [6, 0]

====================================================================================

UMI info for barcode CAGCGACCACGAGAGT-1 contig 1 = GCTCTGCTTC...
umi GAATACCGGA = 200 reads: +394 validated

UMI info for barcode CAGCGACCACGAGAGT-1 contig 2 = GATCAGGACT...
umi ACTAAGCTTA = 383 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=521]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-521 ==> 0-76 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false

TIG 2[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 378
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1150 = CAGCGACCACGCATCG-1

using 237 reads

====================================================================================

graph has 326 edges initially, 4 edges after simplification

total ucounts = 129
nonsolo ucounts = 35[2^17, 3^5, 4^4, 5^2, 6^2, 7^2, 10, 15, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1151 = CAGCGACCACGGTGTC-1

using 375 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 370]
surviving nonsolo ucounts = 1[370]
ids = [1]

====================================================================================

UMI info for barcode CAGCGACCACGGTGTC-1 contig 1 = GGGGTGGGAT...
umi CTTTCGAGCC = 375 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=645]
43-381 ==> 0-338 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=16)
396-434 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=5)
434-645 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CSSYTNSTTPGVF at 367, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 366
start codons at 43, 179, 251, 566
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1161 = CAGCGACCAGTTTACG-1

using 278 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 271]
surviving nonsolo ucounts = 1[271]
ids = [1]

====================================================================================

UMI info for barcode CAGCGACCAGTTTACG-1 contig 1 = TGGGGAGGAG...
umi GATTCACTCA = 264 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQSYTTLLTF at 359, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 32, 38, 94, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1167 = CAGCGACCATGCATGT-1

using 311 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 303]
surviving nonsolo ucounts = 1[303]
ids = [5]

====================================================================================

UMI info for barcode CAGCGACCATGCATGT-1 contig 1 = GAGGAATCAG...
umi TACAGTGGTA = 306 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 50 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1175 = CAGCGACGTATTCGTG-1

using 232 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[4, 221]
surviving nonsolo ucounts = 1[221]
ids = [2]

====================================================================================

UMI info for barcode CAGCGACGTATTCGTG-1 contig 1 = GGGAATCAGT...
umi CCCAGAATCC = 204 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=501]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-501 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1177 = CAGCGACGTCGCCATG-1

using 298 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[298]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1180 = CAGCGACGTGACCAAG-1

using 227 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 224]
surviving nonsolo ucounts = 1[224]
ids = [2]

====================================================================================

UMI info for barcode CAGCGACGTGACCAAG-1 contig 1 = GAGGAGTCAG...
umi TCCTTCTATT = 218 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=555]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQSYSTLALTF at 355, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 28, 34, 90, 103, 239, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1183 = CAGCGACGTGTCGCTG-1

using 16359 reads

====================================================================================

graph has 5160 edges initially, 48 edges after simplification

total ucounts = 280
nonsolo ucounts = 148[2^32, 3^16, 4^6, 5^4, 6^3, 7, 8, 9^4, 10, 11, 23, 26^2, 33, 39, 43, 47, 52, 69, 70, 76, 81, 84, 98, 100, 107, 110, 126, 132, 135, 141, 150, 151, 168, 173, 181, 182^2, 183, 185, 186, 187^2, 190, 191, 193, 195^3, 201, 203, 204, 205, 212^2, 214, 224, 226, 228, 229, 231^2, 233, 236, 237, 239, 241, 251, 252, 254, 263, 264, 269, 270, 277, 280, 283, 288, 299^2, 303, 305, 306, 320, 325, 331, 334, 454, 855]
surviving nonsolo ucounts = 73[9, 26^2, 33, 47, 52, 70, 76, 81, 84, 98, 100, 107, 110, 126, 132, 135, 141, 150, 168, 181, 182^2, 183, 185, 186, 187^2, 190, 191, 193, 195^3, 201, 203, 204, 205, 212^2, 214, 224, 226, 228, 229, 231^2, 233, 236, 237, 239, 241, 251, 254, 263, 264, 269, 270, 277, 280, 283, 288, 299^2, 303, 305, 306, 320, 325, 331, 334, 454, 855]
ids = [221, 67, 104, 146, 142, 60, 207, 167, 177, 114, ...]

====================================================================================

UMI info for barcode CAGCGACGTGTCGCTG-1 contig 1 = TGGGGAGGAG...
umi AAGAGCTCTT = 224 reads: +388 validated
umi AAGGACCCGT = 284 reads: +388 validated
umi AATGATCGCG = 458 reads: +388 validated
umi ACCGAGCTTA = 226 reads: +388 validated
umi ACCTGTGAAC = 297 reads: +388 validated
umi AGATAGTCGA = 275 reads: +388 validated
umi AGCGTTTCTT = 305 reads: -74 +314 non-validated
umi AGGAGAAGGG = 324 reads: +388 validated
umi AGGGTTGGTT = 325 reads: +388 validated
umi AGGTATCTAG = 200 reads: +388 validated
umi AGTCTAGGGT = 303 reads: +388 validated
umi AGTGGAGGAT = 192 reads: +388 validated
umi AGTTCCGCTC = 271 reads: +388 validated
umi ATAAACACTC = 100 reads: +388 validated
umi ATAATCTTCG = 197 reads: +388 validated
umi ATACTCGATC = 239 reads: +119 -1XX +268 invalidated
umi ATCAATGGCC = 240 reads: +388 validated
umi ATGAAAACCG = 203 reads: +388 validated
umi ATGTCACATC = 279 reads: +388 validated
umi ATTATTCTGC = 17 reads: -354X +2 -1X +6 -2XX +12 -1XX +2 -1XX +7 invalidated
umi ATTGGCCCAC = 337 reads: +388 validated
umi ATTTATTCGG = 195 reads: +388 validated
umi ATTTGCCCGG = 229 reads: +388 validated
umi CAAAACGGCG = 258 reads: +388 validated
umi CAAGAACATT = 340 reads: +388 validated
umi CAAGTCTTTG = 287 reads: +388 validated
umi CAATAACTGC = 232 reads: +388 validated
umi CAATAGGAAC = 259 reads: +388 validated
umi CCCTATAGGC = 69 reads: -371X +1 -6X +1 -1XX +1 -7XX invalidated
umi CTCTTGCACA = 238 reads: +388 validated
umi GACCATCTGT = 188 reads: +388 validated
umi GACGGTTCGG = 213 reads: +388 validated
umi GAGTGGGTGC = 38 reads: -347X +2 -5XX +2 -1XX +6 -2XX +12 -1XX +2 -1XX +7 invalidated
umi GATCTGCCAG = 281 reads: +388 validated
umi GATGGGCGCG = 188 reads: +388 validated
umi GCATCATGGG = 149 reads: +388 validated
umi GCCCTTCACC = 239 reads: +388 validated
umi GCGCTCGCAG = 300 reads: +388 validated
umi GCTGTTCGCA = 76 reads: -119 +3 -1 +265 non-validated
umi GGCCAACGGG = 229 reads: +388 validated
umi GTACAACATC = 229 reads: +388 validated
umi GTCCGCCCTT = 203 reads: +388 validated
umi TACGTTCGGC = 181 reads: +388 validated
umi TAGAGAGCCA = 216 reads: +388 validated
umi TATTCGTTCA = 265 reads: +388 validated
umi TCGCACGGGG = 305 reads: +388 validated
umi TCTTCCAAAT = 213 reads: +388 validated
umi TGACTACATC = 184 reads: +388 validated
umi TGATTCGGGG = 231 reads: +388 validated
umi TGCTAAATGG = 105 reads: +388 validated
umi TTCCTAAATG = 263 reads: +388 validated
umi TTCGTTTGTC = 186 reads: +388 validated
umi TTTAGCACCC = 126 reads: +388 validated
umi TTTCATTGCC = 136 reads: +388 validated

UMI info for barcode CAGCGACGTGTCGCTG-1 contig 2 = AGTGCTTTCT...
umi ACGTTCCGTT = 187 reads: +436 validated
umi AGCGGTTAGC = 108 reads: +436 validated
umi AGTTCAGCAA = 45 reads: -419X +17 invalidated
umi ATAGTAGCAC = 26 reads: +123 -1 +4 -1 +221 -30 +18 -1 +1 -1 +35 non-validated
umi CAAGGATTCA = 25 reads: +18 -1 +59 -25 +184 -7 +142 non-validated
umi CACAAGGTCC = 193 reads: +436 validated
umi CAGAGGGTGC = 83 reads: +436 validated
umi CTTGTCATCA = 47 reads: +436 validated
umi GACATATCTA = 34 reads: -61 +204 -1 +14 -1 +3 -1 +112 -39 non-validated
umi GCTGGTTTCT = 132 reads: +4 -1 +431 non-validated
umi GGCTCGGGCT = 80 reads: +436 validated
umi GTGCTAAAGC = 141 reads: +436 validated
umi TAGAAGGGTC = 70 reads: +436 validated
umi TCATGCTTTC = 9 reads: -32 +21 -1 +1 -1 +17 -1 +3 -1 +64 -1 +10 -1 +2 -1 +128 -151 non-validated
umi TCGCATTCAG = 97 reads: +436 validated
umi TGAGAAAGGA = 168 reads: +436 validated
umi TTGTTCATAA = 182 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 51 umis using 1874 reads
cdr3 = CQQSYTTLLTF at 359, score = 9 + 9
umis assigned: [6, 10, 17, 22, 25, 40, 46, 48, 52, 53] and 44 others
of which 51 are surviving nonsolos
reads assigned: 11942
start codons at 32, 38, 94, 107, 243, 462
confident = true

TIG 2[bases=635]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
453-635 ==> 0-182 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 12 umis using 196 reads
cdr3 = CARAHGDYYALLDYW at 377, score = 8 + 7
umis assigned: [31, 45, 60, 67, 104, 108, 114, 142, 146, 166] and 7 others
of which 17 are surviving nonsolos
reads assigned: 1605
start codons at 17, 38, 82, 168, 368
confident = true
now this is a cell
paired!

GCCGCGGACACGGCTATGTATTATTGTGCGAGAGCACACGGTGACTACTACGCCCTCCTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACACTACCCTCCTCACTTTCGGCGGAGGGACCAAGGTTGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1185 = CAGCGACGTTAGATGA-1

using 506 reads

====================================================================================

graph has 216 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 3[21, 214, 262]
surviving nonsolo ucounts = 2[214, 262]
ids = [9, 8]

====================================================================================

UMI info for barcode CAGCGACGTTAGATGA-1 contig 1 = AGCTCTGAGA...
umi TACCCGTCGG = 205 reads: +424 validated

UMI info for barcode CAGCGACGTTAGATGA-1 contig 2 = GGAGAAGAGC...
umi TACACTTGTT = 249 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=524]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=1)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-524 ==> 0-21 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 79, 230, 235, 382, 460
confident = false

TIG 2[bases=498]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
424-498 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYGSSPRYTF at 360, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 36, 244, 370, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1187 = CAGCGACGTTCCCTTG-1

using 301 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[301]
surviving nonsolo ucounts = 1[301]
ids = [0]

====================================================================================

UMI info for barcode CAGCGACGTTCCCTTG-1 contig 1 = ACAACAGGCA...
umi CGTCCAGCCT = 304 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=561]
0-25 ==> 150-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
25-388 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
386-425 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYYGSPRTF at 364, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 22, 25, 80, 94, 347, 377, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1191 = CAGCGACTCAACTCTT-1

using 51 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 12[2^4, 3^3, 4^2, 6, 9, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1209 = CAGCGACTCGCCCTTA-1

using 412 reads

====================================================================================

graph has 200 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[5, 148, 255]
surviving nonsolo ucounts = 2[148, 255]
ids = [1, 6]

====================================================================================

UMI info for barcode CAGCGACTCGCCCTTA-1 contig 1 = GGAGGAACTG...
umi ATGCATTCTG = 149 reads: +382 validated

UMI info for barcode CAGCGACTCGCCCTTA-1 contig 2 = AGAGCTCTGG...
umi TTTCGTCTTC = 236 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=28)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CQQFMNWPRTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 146
start codons at 34, 103, 367, 458
confident = false

TIG 2[bases=558]
0-22 ==> 38-60 on |373|IGLV4-69|5'UTR| [len=60] (mis=0)
22-381 ==> 0-359 on |374|IGLV4-69|L-REGION+V-REGION| [len=359] (mis=20)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
419-558 ==> 0-139 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQTWGAGIEVVF at 355, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 22, 223, 236, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1215 = CAGCGACTCTGATTCT-1

using 160 reads

====================================================================================

graph has 90 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 5, 8, 140]
surviving nonsolo ucounts = 1[140]
ids = [7]

====================================================================================

UMI info for barcode CAGCGACTCTGATTCT-1 contig 1 = AGGAGTCAGA...
umi ACGACTGGGG = 3 reads: -65 +8 -1X +15 -1XX +3 -1XX +28 -3X +6 -117 +6 -1X +2 -2X +1 -1 +12 -1X +1 -1X +2 -1X +1 -1X +1 -1X +21 -84 invalidated
umi TTTCGGATAA = 136 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=458]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-458 ==> 0-43 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [0, 7]
of which 1 are surviving nonsolos
reads assigned: 136
start codons at 27, 33, 89, 102, 238, 241, 334
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1217 = CAGCGACTCTGCCAGG-1

using 5761 reads

====================================================================================

graph has 2922 edges initially, 46 edges after simplification

total ucounts = 524
nonsolo ucounts = 231[2^93, 3^51, 4^28, 5^13, 6^6, 7^5, 8^5, 9^3, 10^2, 11^3, 14, 15, 46, 47, 85, 86, 100, 103, 104, 204, 218, 242, 259, 272, 331, 332, 351, 352, 373, 382, 412, 433]
surviving nonsolo ucounts = 18[46, 47, 85, 100, 104, 204, 218, 242, 259, 272, 331, 332, 351, 352, 373, 382, 412, 433]
ids = [379, 422, 165, 318, 68, 503, 117, 427, 2, 292, ...]

====================================================================================

UMI info for barcode CAGCGACTCTGCCAGG-1 contig 1 = GGGGAGGGTC...
umi AAAATACGTC = 54 reads: -296X +2 -1XX +1 -1XX +2 -1XX +7 -5XX +3 -3XX +1 -1XX +1 -2XX +27 -6XX +2 -10XX +1 -4X +1 -21X +4 -1 +14 invalidated
umi CAAGCCAGCC = 219 reads: +418 validated
umi CCACGGACTG = 303 reads: +418 validated
umi CCGGAATCAG = 90 reads: +204 -10XX +1 -4X +1 -2XX +187 -9 invalidated
umi GAAGTCGGCT = 275 reads: +418 validated
umi GCAGACAGGG = 441 reads: +418 validated
umi GCAGCGCCAG = 410 reads: +418 validated
umi GCCTTGCTCT = 218 reads: +418 validated
umi GGCATTAGCC = 98 reads: +418 validated
umi TAATATCCGG = 46 reads: +370 -36 +12 non-validated
umi TCCCGACCTC = 47 reads: +379 -39 non-validated
umi TCCTACGCAA = 248 reads: +418 validated

UMI info for barcode CAGCGACTCTGCCAGG-1 contig 2 = GAGGAGTCAG...
umi AGGTTGTCGC = 105 reads: +385 validated
umi ATTGTATTGC = 395 reads: +139 -2X +244 invalidated
umi CACACCCGTT = 352 reads: +385 validated
umi CCAACGTCTG = 332 reads: +385 validated
umi GTCCGTGCAT = 351 reads: +385 validated
umi TTGAATGGGG = 203 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=551]
62-410 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=5)
432-480 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
480-551 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 195 reads
cdr3 = CARSTGDPPYFDYW at 407, score = 9 + 7
umis assigned: [2, 117, 146, 165, 268, 283, 286, 292, 318, 379] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2408
start codons at 18, 62, 106
confident = true

TIG 2[bases=549]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 6 umis using 273 reads
cdr3 = CQQSYSTPTF at 355, score = 9 + 8
umis assigned: [68, 106, 121, 144, 355, 503]
of which 6 are surviving nonsolos
reads assigned: 1692
start codons at 28, 34, 90, 103, 239, 455
confident = true
now this is a cell
paired!

ACTGCCGCGGACACGGCCGTGTATTACTGTGCGAGATCGACTGGGGACCCGCCCTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCGACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1222 = CAGCGACTCTTAGCCC-1

using 704 reads

====================================================================================

graph has 288 edges initially, 42 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[4, 345, 352]
surviving nonsolo ucounts = 2[345, 352]
ids = [4, 2]

====================================================================================

UMI info for barcode CAGCGACTCTTAGCCC-1 contig 1 = AGGAGTCAGA...
umi TGTACCAGTA = 343 reads: +388 validated

UMI info for barcode CAGCGACTCTTAGCCC-1 contig 2 = GGGGAGTCTC...
umi CTCTGTCAAC = 352 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=0)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQANSFPPTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 342
start codons at 27, 33, 89, 102, 238, 457
confident = false

TIG 2[bases=548]
24-375 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
374-412 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 71 reads
cdr3 = CQQSYRRPITF at 351, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 346
start codons at 24, 30, 86, 99, 235, 334, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1225 = CAGCTAAAGAAACCAT-1

using 270 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 263]
surviving nonsolo ucounts = 1[263]
ids = [2]

====================================================================================

UMI info for barcode CAGCTAAAGAAACCAT-1 contig 1 = GAATCAGTCC...
umi CCTTGTCAGC = 263 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1228 = CAGCTAAAGAAGATTC-1

using 20655 reads

====================================================================================

graph has 8568 edges initially, 72 edges after simplification

total ucounts = 984
nonsolo ucounts = 522[2^162, 3^98, 4^72, 5^54, 6^28, 7^13, 8^13, 9^10, 10^3, 11^3, 12^2, 13, 14^2, 17, 25, 33, 38, 45, 48, 87, 97, 101, 106, 134, 148, 155, 163, 166, 176, 182, 191, 192, 193, 199, 200, 207, 208, 217, 222, 230, 237, 238, 240, 247, 253, 256, 263, 264, 267, 268, 271, 276, 283, 285, 290, 292^4, 297, 310, 313, 317^2, 421, 478, 507, 525, 667, 679, 693, 772, 1530, 1724]
surviving nonsolo ucounts = 56[48, 87, 97, 101, 106, 134, 148, 155, 163, 166, 176, 182, 191, 192, 193, 199, 200, 207, 208, 217, 222, 230, 237, 238, 240, 247, 253, 256, 263, 264, 267, 268, 271, 276, 283, 285, 290, 292^4, 297, 310, 313, 317^2, 421, 478, 507, 525, 667, 679, 693, 772, 1530, 1724]
ids = [210, 23, 960, 966, 713, 442, 256, 507, 885, 355, ...]

====================================================================================

UMI info for barcode CAGCTAAAGAAGATTC-1 contig 1 = GCTCTGCTTC...
umi AAATTACCTT = 1 reads: -345X +1 -4X +1 -5X +23 -1 +9 -1X +1 invalidated
umi AAGTATCGGC = 268 reads: +391 validated
umi AATATGGCTT = 260 reads: +391 validated
umi ACCTCCTCTA = 520 reads: +391 validated
umi AGATATCGCG = 216 reads: +391 validated
umi AGCGGTCCTT = 1771 reads: +29 -2XX +2 -1XX +1 -1XX +1 -1XX +2 -1XX +1 -1XX +1 -1XX +1 -1XX +1 -343XX invalidated
umi AGTCAGTTGG = 197 reads: +391 validated
umi ATATCTCTGT = 177 reads: +391 validated
umi ATCACGTTAA = 319 reads: +391 validated
umi ATCCTTCCGT = 294 reads: +391 validated
umi ATTAACAGTC = 139 reads: +391 validated
umi ATTACAGGCG = 206 reads: +391 validated
umi CACACCGCCG = 230 reads: +391 validated
umi CACTGTCTAT = 234 reads: +391 validated
umi CACTTTCGTA = 268 reads: +391 validated
umi CAGACCACCG = 276 reads: +391 validated
umi CCAGGTCTGG = 255 reads: +391 validated
umi CCTTCCAGCG = 200 reads: +391 validated
umi CGGTCGCCCG = 119 reads: +346 -45 non-validated
umi CTCTGCGTTT = 508 reads: +391 validated
umi CTGCTGCGTA = 155 reads: +391 validated
umi CTGTAGCGCG = 479 reads: +391 validated
umi CTTTCAGCGA = 210 reads: +391 validated
umi GCCAATTCCT = 311 reads: +391 validated
umi GCCGGCATTG = 294 reads: +391 validated
umi GCTGTACGCA = 287 reads: +391 validated
umi GTTAAAACTC = 245 reads: +391 validated
umi TAAAAAGGTT = 297 reads: +391 validated
umi TAAGCTATAT = 107 reads: -52X +339 invalidated
umi TATAAGATGC = 269 reads: +391 validated
umi TCCAATCCTA = 262 reads: +391 validated
umi TCTCTTGCGT = 3 reads: -345X +1 -4XX +1 -5XX +33 -1XX +1 invalidated
umi TGGCTTCCGC = 320 reads: +391 validated
umi TTTAATCCTT = 292 reads: +391 validated
umi TTTATTCCCC = 286 reads: +391 validated
umi TTTATTCTCC = 102 reads: +391 validated

UMI info for barcode CAGCTAAAGAAGATTC-1 contig 2 = AGCTCTGGGA...
umi AAATATTGCT = 198 reads: -5 +1 -2X +437 invalidated
umi AATTTGCATT = 195 reads: +445 validated
umi AGTTTTTCGT = 48 reads: +327 -1 +20 -72 +25 non-validated
umi CCAGTTTCCT = 166 reads: +402 -7 +3 -1 +1 -1 +3 -1 +1 -1 +12 -1 +7 -1X +3 invalidated
umi CTCTATCTAT = 242 reads: +445 validated
umi CTGTGATCAG = 288 reads: +417 -1 +4 -2 +1 -1 +1 -2 +16 non-validated
umi GATGCTCCGC = 251 reads: +445 validated
umi TAACCCTCGC = 222 reads: +445 validated
umi TCCGCACTTG = 194 reads: +435 -10 non-validated
umi TGTCAATCGA = 164 reads: +445 validated
umi TTCATGAGAG = 773 reads: -207X +238 invalidated
umi TTTAATTACT = 97 reads: +445 validated
umi TTTCATCAAT = 300 reads: +445 validated

GOOD CONTIGS

TIG 1[bases=653]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-374 ==> 0-323 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=15)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
442-653 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 32 umis using 1414 reads
cdr3 = CQSFDSSLSAWVF at 375, score = 8 + 8
umis assigned: [23, 64, 75, 131, 167, 178, 198, 222, 231, 238] and 26 others
of which 36 are surviving nonsolos
reads assigned: 10179
start codons at 51, 208, 259, 358
confident = true

TIG 2[bases=684]
0-79 ==> 0-79 on |154|IGHV3-66|5'UTR| [len=79] (mis=0)
79-429 ==> 0-350 on |155|IGHV3-66|L-REGION+V-REGION| [len=350] (mis=31)
461-524 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=6)
524-684 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 9 umis using 290 reads
cdr3 = CARERPEDGDPLRRALYHYYYMDVW at 418, score = 9 + 7
umis assigned: [17, 92, 210, 355, 489, 515, 574, 710, 800, 885] and 3 others
of which 13 are surviving nonsolos
reads assigned: 3066
start codons at 79, 230, 235, 286, 296, 364, 379, 481, 578
confident = true

REJECT CONTIGS

TIG 1[bases=442]
2-74 ==> 5665-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
26-78 ==> 0-52 on |229|IGKV1-37|L-REGION+V-REGION| [len=351] (mis=0)
83-229 ==> 52-198 on |229|IGKV1-37|L-REGION+V-REGION| [len=351] (mis=6) [SHIFT!]
268-306 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
306-442 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [28, 106, 187, 227, 374, 564]
of which 6 are surviving nonsolos
reads assigned: 4154
start codons at 26, 32, 93, 262, 348
confident = false
did not find CDR3
now this is a cell
paired!

AGAGAACGCCCTGAAGACGGTGACCCCCTACGTCGGGCACTCTACCACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCGCAG <==> GGCCTCCAGGCTGAAGATGAGGCTGATTATTATTGTCAGTCCTTTGACAGCAGTCTGAGTGCCTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1229 = CAGCTAAAGAATTGTG-1

using 19 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1234 = CAGCTAAAGATCCGAG-1

using 84 reads

====================================================================================

graph has 58 edges initially, 10 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 12, 65]
surviving nonsolo ucounts = 2[12, 65]
ids = [0, 6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1235 = CAGCTAAAGATGCCAG-1

using 419 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[2, 4, 5, 408]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1243 = CAGCTAAAGCTATGCT-1

using 1266 reads

====================================================================================

graph has 544 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[4, 238, 349, 672]
surviving nonsolo ucounts = 3[238, 349, 672]
ids = [6, 5, 3]

====================================================================================

UMI info for barcode CAGCTAAAGCTATGCT-1 contig 1 = GGGAATCAGT...
umi CTTGGTCTCC = 674 reads: +388 validated
umi GGGTTAATCA = 346 reads: +388 validated
umi TTGATACAAC = 238 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 197 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [3, 5, 6]
of which 3 are surviving nonsolos
reads assigned: 1236
start codons at 27, 33, 102, 238, 457
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1247 = CAGCTAAAGGACTGGT-1

using 274 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[7, 267]
surviving nonsolo ucounts = 1[267]
ids = [1]

====================================================================================

UMI info for barcode CAGCTAAAGGACTGGT-1 contig 1 = GGGGTCACAA...
umi TTTGGAGACT = 264 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=492]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
432-492 ==> 0-60 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CCSEAGGGVPGLLF at 362, score = 7 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 38, 192
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1249 = CAGCTAAAGGCAAAGA-1

using 344 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 4, 331]
surviving nonsolo ucounts = 1[331]
ids = [1]

====================================================================================

UMI info for barcode CAGCTAAAGGCAAAGA-1 contig 1 = GCTCTGCTTC...
umi ATAGATCATT = 327 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=596]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-355 ==> 0-304 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=28)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
442-596 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQSYDISLSAVVF at 375, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 319
start codons at 51, 175, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1252 = CAGCTAAAGGTAGCTG-1

using 637 reads

====================================================================================

graph has 234 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[284, 345]
surviving nonsolo ucounts = 2[284, 345]
ids = [2, 8]

====================================================================================

UMI info for barcode CAGCTAAAGGTAGCTG-1 contig 1 = GGGAGGAATC...
umi GAAAAGAACT = 287 reads: +388 validated
umi TGTTTACCAA = 348 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
30-381 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 90 reads
cdr3 = CLQYSSSPWTF at 357, score = 9 + 8
umis assigned: [2, 8]
of which 2 are surviving nonsolos
reads assigned: 620
start codons at 30, 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1253 = CAGCTAAAGGTGATTA-1

using 346 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4^2, 334]
surviving nonsolo ucounts = 1[334]
ids = [5]

====================================================================================

UMI info for barcode CAGCTAAAGGTGATTA-1 contig 1 = GGGGAGGAAT...
umi GTGAGACCAG = 309 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=496]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-496 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1255 = CAGCTAAAGTAAGTAC-1

using 1471 reads

====================================================================================

graph has 2079 edges initially, 12 edges after simplification

total ucounts = 623
nonsolo ucounts = 292[2^113, 3^59, 4^39, 5^24, 6^20, 7^13, 8^4, 9^10, 10^3, 11^3, 12, 13, 19, 21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1261 = CAGCTAAAGTTCGATC-1

using 13997 reads

====================================================================================

graph has 5166 edges initially, 54 edges after simplification

total ucounts = 683
nonsolo ucounts = 346[2^96, 3^74, 4^53, 5^32, 6^18, 7^10, 8^7, 9^2, 10^2, 11^2, 15, 64, 101, 107, 113, 118, 142, 151, 168, 174, 183, 185, 190, 204, 208, 210, 214, 217, 229, 235, 239, 242, 244, 249, 257, 262, 264^2, 268^2, 270, 279, 280, 281, 285, 293, 297, 304^2, 306, 310^2, 324, 342, 352, 375, 407, 441, 498, 537]
surviving nonsolo ucounts = 46[64, 101, 107, 113, 142, 151, 168, 174, 183, 185, 190, 204, 208, 210, 214, 217, 229, 235, 239, 242, 244, 249, 257, 262, 264, 268^2, 270, 279, 280, 281, 285, 293, 297, 304^2, 310^2, 324, 342, 352, 375, 407, 441, 498, 537]
ids = [5, 367, 14, 32, 622, 264, 395, 52, 6, 228, ...]

====================================================================================

UMI info for barcode CAGCTAAAGTTCGATC-1 contig 1 = AGCATCATCC...
umi AAAAACTGTA = 310 reads: +427 validated
umi AAACCATTCG = 56 reads: +16 -6 +1 -1 +403 non-validated
umi AAACCGTTTA = 160 reads: +427 validated
umi AAATCATCCG = 95 reads: +427 validated
umi AACCCAAGGT = 263 reads: +422 -5 non-validated
umi ACAATACCCT = 177 reads: -7X +420 invalidated
umi AGCTTGGTCC = 373 reads: +427 validated
umi CAAGGCTCCA = 206 reads: +427 validated
umi CAAGTTTCCG = 334 reads: +427 validated
umi CCCTGGTCAC = 249 reads: +427 validated
umi GGGATGACGG = 302 reads: +427 validated
umi TACTTGATAG = 411 reads: +427 validated
umi TATACTATAT = 210 reads: +427 validated
umi TATTTTGTCT = 205 reads: +414 -13 non-validated

UMI info for barcode CAGCTAAAGTTCGATC-1 contig 2 = GCTCTGCTTC...
umi AAGCGATACA = 204 reads: +397 validated
umi AAGGACACCT = 112 reads: +397 validated
umi AATAGCTCTT = 214 reads: +397 validated
umi ACCACTCTGC = 37 reads: -395X +2 invalidated
umi ACGATTTGTT = 272 reads: +397 validated
umi ACGCATTCTC = 247 reads: +397 validated
umi ACTTATATCC = 229 reads: +397 validated
umi ACTTATTCGT = 285 reads: +397 validated
umi ACTTCGGCCA = 34 reads: -395X +2 invalidated
umi ATAAATACTG = 502 reads: +397 validated
umi CATCATACCG = 180 reads: +397 validated
umi CCGACATGCC = 254 reads: +397 validated
umi CCGTAATCAG = 150 reads: +397 validated
umi CGCCTATACC = 312 reads: +397 validated
umi CTAGTTTGCA = 285 reads: +397 validated
umi CTTATGGCTG = 350 reads: +397 validated
umi GATCAATTCG = 305 reads: +397 validated
umi GATTAACATT = 100 reads: +397 validated
umi GCGTATGGGC = 322 reads: +397 validated
umi GGAAGAATCG = 169 reads: +397 validated
umi GTCAACTTAT = 288 reads: +397 validated
umi GTCCGAGATC = 280 reads: +397 validated
umi GTTTTTTTTA = 17 reads: -212X +1 -2X +3 -1XX +17 -2XX +2 -1XX +1 -1XX +2 -1XX +22 -1XX +1 -1XX +1 -1XX +9 -1XX +5 -1XX +9 -99 invalidated
umi TCATTTACTC = 279 reads: +397 validated
umi TCCGTTTTGG = 266 reads: +397 validated
umi TCCTGTACCT = 264 reads: +397 validated
umi TCGGGTTGGG = 233 reads: +397 validated
umi TGTATTTCTG = 237 reads: +397 validated
umi TTATATGATA = 141 reads: +397 validated
umi TTCGCGGTTT = 215 reads: +397 validated
umi TTGCTATCCT = 302 reads: +397 validated
umi TTTCAACATC = 269 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=559]
0-61 ==> 0-61 on |80|IGHV1-58|5'UTR| [len=61] (mis=0)
61-414 ==> 0-353 on |81|IGHV1-58|L-REGION+V-REGION| [len=353] (mis=2)
417-433 ==> 0-16 on |25|IGHD4-17|D-REGION| [len=16] (mis=2)
440-488 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
488-559 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 12 umis using 236 reads
cdr3 = CAAATYYGDYNEGAFDYW at 403, score = 9 + 7
umis assigned: [0, 5, 6, 14, 21, 52, 116, 192, 194, 255] and 4 others
of which 14 are surviving nonsolos
reads assigned: 3295
start codons at 61, 121, 264, 337, 358
confident = true

TIG 2[bases=659]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=2)
410-448 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
448-659 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 29 umis using 1082 reads
cdr3 = CQSYDSSLSGLHVVF at 375, score = 8 + 8
umis assigned: [31, 32, 35, 71, 82, 84, 97, 98, 101, 136] and 22 others
of which 30 are surviving nonsolos
reads assigned: 7256
start codons at 51, 205, 208, 259, 358, 385, 409
confident = true

REJECT CONTIGS

TIG 1[bases=490]
3-322 ==> 5681-6000 on rc of segment after IGHD1-1 exon 1 [len=6000] (mis=0)
338-388 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
388-490 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [340, 369]
of which 2 are surviving nonsolos
reads assigned: 963
start codons at 8, 29, 134, 236, 369, 406, 467
confident = false
did not find CDR3
now this is a cell
paired!

ACGGCCGTGTATTACTGTGCGGCCGCCACCTACTACGGTGACTACAACGAGGGAGCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> CAGGCTGAGGATGAGGCTGATTATTACTGCCAGTCCTATGACAGCAGCCTGAGTGGTCTCCATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1270 = CAGCTAACAACGATCT-1

using 294 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 8, 279]
surviving nonsolo ucounts = 1[279]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=516]
0-34 ==> 18-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-34 ==> 5966-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
34-188 ==> 0-154 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
191-385 ==> 154-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=10)
384-422 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
422-516 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYGISPRTF at 361, score = 8 + 8
umis assigned: [2, 3]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 34, 245, 371, 464
confident = false
see insertion of ACT at pos 154 on |283|IGKV3-20|L-REGION+V-REGION|
not full
full length stopped transcript of length 516
frameshifted full length stopped transcript of length 516
VJ delta = 11
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1273 = CAGCTAACAAGGCTCC-1

using 268 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 262]
surviving nonsolo ucounts = 1[262]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=482]
0-304 ==> 52-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
304-342 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
342-482 ==> 0-140 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 272, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 102, 105, 156, 255, 282, 306, 474
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1275 = CAGCTAACAATAGCAA-1

using 523 reads

====================================================================================

graph has 180 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[3, 4, 508]
surviving nonsolo ucounts = 1[508]
ids = [7]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1280 = CAGCTAACACACCGAC-1

using 283 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[280]
surviving nonsolo ucounts = 1[280]
ids = [3]

====================================================================================

UMI info for barcode CAGCTAACACACCGAC-1 contig 1 = AGGCTGGTCA...
umi TCCAACCGAC = 266 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=509]
0-47 ==> 134-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
47-398 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
397-435 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
435-509 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYNGQSRAF at 374, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 47, 53, 122, 258, 261, 354, 387, 477
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1281 = CAGCTAACACACTGCG-1

using 521 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[519]
surviving nonsolo ucounts = 1[519]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1285 = CAGCTAACACCTATCC-1

using 599 reads

====================================================================================

graph has 540 edges initially, 8 edges after simplification

total ucounts = 133
nonsolo ucounts = 53[2^25, 3^13, 4^6, 5, 6, 7^3, 10, 13, 18, 333]
surviving nonsolo ucounts = 1[333]
ids = [14]

====================================================================================

UMI info for barcode CAGCTAACACCTATCC-1 contig 1 = GGAGTCAGTC...
umi ACTCACCAGC = 333 reads: +388 validated
umi CACAGAAATA = 6 reads: -249 +8 -1XX +2 -1XX +2 -1XX +9 -1XX +4 -1XX +2 -2XX +20 -3XX +5 -68X +4 -1X +4 invalidated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-365 ==> 0-339 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=10)
376-414 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYINALFTF at 353, score = 8 + 8
umis assigned: [14, 32]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 26, 32, 88, 101, 240, 369, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1286 = CAGCTAACACGACTCG-1

using 1068 reads

====================================================================================

graph has 1312 edges initially, 6 edges after simplification

total ucounts = 371
nonsolo ucounts = 154[2^66, 3^29, 4^26, 5^12, 6^5, 7^7, 8, 9^2, 10, 11, 12, 13, 14, 303]
surviving nonsolo ucounts = 1[303]
ids = [36]

====================================================================================

UMI info for barcode CAGCTAACACGACTCG-1 contig 1 = TGGGGAGGAA...
umi ACGAAGCCTA = 302 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [36]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1290 = CAGCTAACACGTTGGC-1

using 232 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 5, 221]
surviving nonsolo ucounts = 1[221]
ids = [4]

====================================================================================

UMI info for barcode CAGCTAACACGTTGGC-1 contig 1 = GCTCTGCTTC...
umi GTTGCAAGCA = 217 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=520]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=4)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
445-520 ==> 0-75 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQSYDSSLSALYVF at 375, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1291 = CAGCTAACAGCAGTTT-1

using 324 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[321]
surviving nonsolo ucounts = 1[321]
ids = [2]

====================================================================================

UMI info for barcode CAGCTAACAGCAGTTT-1 contig 1 = GGGAGGAATC...
umi ATCCTTTGTT = 319 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
30-381 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CLQYSSSPWTF at 357, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 314
start codons at 30, 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1295 = CAGCTAACAGGTCTCG-1

using 350 reads

====================================================================================

graph has 152 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 12, 62, 267]
surviving nonsolo ucounts = 3[12, 62, 267]
ids = [4, 2, 3]

====================================================================================

UMI info for barcode CAGCTAACAGGTCTCG-1 contig 1 = GGCTGGGGTC...
umi ATAGCGCGAC = 261 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=525]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-385 ==> 0-343 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=7)
389-427 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
427-525 ==> 0-98 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CCSYAGTFYVF at 366, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 42, 181, 199, 243, 253, 349, 376, 391
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1296 = CAGCTAACAGGTTTCA-1

using 51 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 6^2, 31]
surviving nonsolo ucounts = 1[31]
ids = [7]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1298 = CAGCTAACAGTCAGCC-1

using 15 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1305 = CAGCTAACATGTTGAC-1

using 381 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[7, 372]
surviving nonsolo ucounts = 1[372]
ids = [2]

====================================================================================

UMI info for barcode CAGCTAACATGTTGAC-1 contig 1 = GAAGAGCTGC...
umi GCGTTGAAAC = 372 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-370 ==> 0-337 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=12)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYDRSWTF at 357, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 368
start codons at 33, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1322 = CAGCTAAGTCGCGTGT-1

using 159 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 8[2^3, 4, 6, 8, 10, 120]
surviving nonsolo ucounts = 1[120]
ids = [3]

====================================================================================

UMI info for barcode CAGCTAAGTCGCGTGT-1 contig 1 = ACCCAAAAAC...
umi AATTAGCGCC = 116 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=539]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=18)
430-466 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=0)
466-539 ==> 0-73 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARDHGPLPQDSW at 396, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 116
start codons at 54, 205, 252, 257, 282, 289, 318, 351, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1325 = CAGCTAAGTGGCCCTA-1

using 269 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 4, 259]
surviving nonsolo ucounts = 1[259]
ids = [6]

====================================================================================

UMI info for barcode CAGCTAAGTGGCCCTA-1 contig 1 = AGTCTCAGTC...
umi TTCCTAGGTG = 263 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 27-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
20-371 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQSYRRPITF at 347, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 20, 26, 82, 95, 231, 330, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1330 = CAGCTAAGTGTTGGGA-1

using 424 reads

====================================================================================

graph has 204 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 4, 7, 181, 228]
surviving nonsolo ucounts = 2[181, 228]
ids = [3, 6]

====================================================================================

UMI info for barcode CAGCTAAGTGTTGGGA-1 contig 1 = AGCTTCAGCT...
umi CATCTGGCGC = 177 reads: +388 validated

UMI info for barcode CAGCTAAGTGTTGGGA-1 contig 2 = GGGGTCTCCC...
umi GTGCTTGATA = 221 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=558]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-558 ==> 0-123 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 174
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=521]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=2)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=20)
431-477 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
477-521 ==> 0-44 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARPYNSYWLGFDYW at 401, score = 8 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 59, 233
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1333 = CAGCTAAGTTCCCTTG-1

using 216 reads

====================================================================================

graph has 69 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[216]
surviving nonsolo ucounts = 1[216]
ids = [0]

====================================================================================

UMI info for barcode CAGCTAAGTTCCCTTG-1 contig 1 = GAGCTACAAC...
umi GGGTCTTGCT = 199 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=522]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-522 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 27, 30, 85, 99, 352, 382, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1338 = CAGCTAATCAACGAAA-1

using 10 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1339 = CAGCTAATCAAGCCTA-1

using 384 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 379]
surviving nonsolo ucounts = 1[379]
ids = [3]

====================================================================================

UMI info for barcode CAGCTAATCAAGCCTA-1 contig 1 = GGAGTCAGAC...
umi TCGTCCGCGC = 361 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=499]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-499 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 66 reads
cdr3 = CQQYDSFSWTF at 353, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 354
start codons at 26, 32, 88, 101, 237, 240, 333, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1341 = CAGCTAATCACCATAG-1

using 279 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[278]
surviving nonsolo ucounts = 1[278]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1342 = CAGCTAATCACCTTAT-1

using 79 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 8[2^3, 3, 4, 6^2, 45]
surviving nonsolo ucounts = 1[45]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1352 = CAGCTAATCCCGACTT-1

using 26 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3^2, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1354 = CAGCTAATCCGCATAA-1

using 368 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 6, 357]
surviving nonsolo ucounts = 1[357]
ids = [3]

====================================================================================

UMI info for barcode CAGCTAATCCGCATAA-1 contig 1 = ATCAGTCCCA...
umi CCTTCACGGG = 357 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 355
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1359 = CAGCTAATCGCCAAAT-1

using 299 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[298]
surviving nonsolo ucounts = 1[298]
ids = [1]

====================================================================================

UMI info for barcode CAGCTAATCGCCAAAT-1 contig 1 = TGAGCGCAGA...
umi CCGTCAGCAG = 299 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=635]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=13)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CGAWDTSLSAWVF at 357, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1362 = CAGCTAATCGTTACAG-1

using 294 reads

====================================================================================

graph has 357 edges initially, 34 edges after simplification

total ucounts = 65
nonsolo ucounts = 45[2^6, 3^7, 4^4, 5^3, 6^9, 7^3, 8^4, 9^2, 10, 11^2, 12, 13^2, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1371 = CAGCTAATCTTGCCGT-1

using 33 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[7, 25]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1375 = CAGCTGGAGAAGCCCA-1

using 138 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 14[2^4, 3, 4^3, 5^2, 8, 9, 11, 73]
surviving nonsolo ucounts = 1[73]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1377 = CAGCTGGAGAATTGTG-1

using 263 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 3, 250]
surviving nonsolo ucounts = 1[250]
ids = [6]

====================================================================================

UMI info for barcode CAGCTGGAGAATTGTG-1 contig 1 = AATCAGTCCC...
umi CTCTGCCTAG = 253 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 3-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
24-375 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CLQYSSSPWTF at 351, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 24, 30, 99, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1379 = CAGCTGGAGACGCTTT-1

using 182 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[5, 173]
surviving nonsolo ucounts = 1[173]
ids = [4]

====================================================================================

UMI info for barcode CAGCTGGAGACGCTTT-1 contig 1 = ATCAGTCCCA...
umi GTTTCGTGGA = 173 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=7)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CLQHKNYPWTF at 350, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 172
start codons at 23, 29, 98, 180, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1380 = CAGCTGGAGACTAGGC-1

using 150 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[5, 143]
surviving nonsolo ucounts = 1[143]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1383 = CAGCTGGAGAGATGAG-1

using 234 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 3, 223]
surviving nonsolo ucounts = 1[223]
ids = [5]

====================================================================================

UMI info for barcode CAGCTGGAGAGATGAG-1 contig 1 = AGAGAAGACA...
umi CGTTTTGATT = 224 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=583]
0-31 ==> 25-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
31-382 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
419-583 ==> 0-164 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CAAWDDSLSGWVF at 352, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 31, 185, 335, 360, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1384 = CAGCTGGAGAGGACGG-1

using 200 reads

====================================================================================

graph has 124 edges initially, 4 edges after simplification

total ucounts = 19
nonsolo ucounts = 12[2^2, 3, 5, 6^2, 7, 8, 9, 13, 17, 115]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1385 = CAGCTGGAGAGGTTAT-1

using 321 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 313]
surviving nonsolo ucounts = 1[313]
ids = [3]

====================================================================================

UMI info for barcode CAGCTGGAGAGGTTAT-1 contig 1 = GCAGAAGTCT...
umi GAATACCTCA = 292 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
0-29 ==> 2-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=0)
29-380 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=1)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
417-495 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQKYNSAPYTF at 356, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 29, 35, 91, 104, 240, 339, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1388 = CAGCTGGAGCACCGCT-1

using 325 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[4, 8, 313]
surviving nonsolo ucounts = 1[313]
ids = [0]

====================================================================================

UMI info for barcode CAGCTGGAGCACCGCT-1 contig 1 = GCTCTGCTTC...
umi CAGCACTCCT = 313 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=653]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-653 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 60 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1392 = CAGCTGGAGCGCCTCA-1

using 777 reads

====================================================================================

graph has 268 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[773]
surviving nonsolo ucounts = 1[773]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=389]
20-137 ==> 236-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=4)
183-229 ==> 17-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
229-389 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARDAPYMIGGGTAQWVPMGMDVW at 126, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 768
start codons at 10, 87, 136, 147, 170, 180, 186, 210, 283
confident = false
VJ delta = 23
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1400 = CAGCTGGAGGCTAGAC-1

using 461 reads

====================================================================================

graph has 143 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 8, 141, 309]
surviving nonsolo ucounts = 2[141, 309]
ids = [1, 3]

====================================================================================

UMI info for barcode CAGCTGGAGGCTAGAC-1 contig 1 = GAGTCAGACT...
umi TAGTAATCAT = 287 reads: +388 validated

UMI info for barcode CAGCTGGAGGCTAGAC-1 contig 2 = GGACTCCTGT...
umi GTATATTATG = 132 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=479]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
413-479 ==> 0-66 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYDSFSWTF at 352, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 285
start codons at 25, 31, 87, 100, 236, 239, 332, 362, 455
confident = false

TIG 2[bases=518]
18-376 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
401-451 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
451-518 ==> 0-67 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 363, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 129
start codons at 18, 62, 241, 244, 247, 333, 403
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1416 = CAGCTGGAGTGGAGAA-1

using 124 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[4, 7, 111]
surviving nonsolo ucounts = 1[111]
ids = [3]

====================================================================================

UMI info for barcode CAGCTGGAGTGGAGAA-1 contig 1 = CTGGGCCTCA...
umi TTCTAAACGT = 107 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=491]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-383 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=5)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
413-491 ==> 0-78 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CQAWDSSTAVF at 352, score = 6 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 105
start codons at 37, 42, 98, 185, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1417 = CAGCTGGAGTGGAGTC-1

using 252 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[250]
surviving nonsolo ucounts = 1[250]
ids = [1]

====================================================================================

UMI info for barcode CAGCTGGAGTGGAGTC-1 contig 1 = GGGAATCAGT...
umi ATATATACGT = 237 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=510]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-510 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1464 = CAGCTGGCATCGTCGG-1

using 286 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[285]
surviving nonsolo ucounts = 1[285]
ids = [0]

====================================================================================

UMI info for barcode CAGCTGGCATCGTCGG-1 contig 1 = GGAGGAACTG...
umi TTGTATGGGG = 261 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=505]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
416-505 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CLQYSDWPRTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1465 = CAGCTGGCATGAACCT-1

using 382 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[4, 5^2, 7, 356]
surviving nonsolo ucounts = 1[356]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=505]
0-32 ==> 21-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
0-32 ==> 5968-6000 on rc of segment after IGKV1-8 exon 1 [len=6000] (mis=0)
13-77 ==> 5676-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
32-78 ==> 0-46 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=0)
81-106 ==> 5854-5879 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=0)
92-391 ==> 46-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=0) [SHIFT!]
390-428 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
428-505 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYYSYPRTF at 367, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 330
start codons at 32, 102, 115, 251, 470
confident = false
not full
frameshifted full length stopped transcript of length 505
VJ delta = 0
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1470 = CAGCTGGCATGTCGAT-1

using 39 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[4, 8, 27]
surviving nonsolo ucounts = 1[27]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 22.1477 = CAGCTGGGTAAGTGGC-1

using 287 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[2, 4^2, 277]
surviving nonsolo ucounts = 1[277]
ids = [0]

====================================================================================

UMI info for barcode CAGCTGGGTAAGTGGC-1 contig 1 = GGAGTCAGAC...
umi CAAGTCGGCT = 267 reads: +394 validated
umi TCCTTAGGAA = 1 reads: -349X +1 -3X +2 -2X +36 -1X invalidated

GOOD CONTIGS

TIG 1[bases=465]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
420-465 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYNSYSPQLTF at 353, score = 8 + 9
umis assigned: [0, 2]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 26, 32, 88, 101, 333
confident = false
NOT paired!
sorting bam, mem = 0.08
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk022-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk022-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

71.912 seconds used processing barcodes, peak mem = 0.24
