[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.34 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk017-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk017-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk017.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.0 = CACAGTATCAGCATGT-1

using 8904 reads

====================================================================================

graph has 8186 edges initially, 76 edges after simplification

total ucounts = 2065
nonsolo ucounts = 1002[2^413, 3^215, 4^146, 5^89, 6^51, 7^27, 8^13, 9^10, 10^3, 11^5, 12^3, 14^3, 15^7, 16^3, 19, 56, 64, 167, 203, 224, 225, 251, 267, 297, 348, 526, 745, 943]
surviving nonsolo ucounts = 13[56, 64, 167, 203, 224, 225, 251, 267, 297, 348, 526, 745, 943]
ids = [1315, 788, 414, 396, 1124, 118, 612, 653, 460, 601, ...]

====================================================================================

UMI info for barcode CACAGTATCAGCATGT-1 contig 1 = GGAGTCTCCC...
umi ACATAAGAGG = 228 reads: +427 validated
umi ATGCGCTGCG = 205 reads: +412 -15 non-validated
umi ATTAACGCCA = 167 reads: +427 validated
umi CCAACCGCCA = 249 reads: +427 validated
umi CCCATTTCTC = 268 reads: +427 validated
umi GCCCGTCTGC = 226 reads: +427 validated
umi GTCCTGACGG = 53 reads: +412 -1 +3 -1 +10 non-validated

GOOD CONTIGS

TIG 1[bases=557]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=7)
415-446 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=6)
438-486 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
486-557 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 59 reads
cdr3 = CARPLSYCSGGSCHFGYW at 401, score = 8 + 7
umis assigned: [118, 396, 414, 612, 653, 1124, 1315]
of which 7 are surviving nonsolos
reads assigned: 1371
start codons at 59, 233, 257, 392
confident = true

REJECT CONTIGS

TIG 1[bases=684]
1-137 ==> 157-293 on segment before IGLV3-1 exon 2 [len=293] (mis=0)
135-437 ==> 44-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=6)
435-473 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
473-684 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CQAWDSSTACYVF at 406, score = 6 + 8
umis assigned: [325, 460, 583, 601]
of which 4 are surviving nonsolos
reads assigned: 2278
start codons at 10, 152, 239, 385, 389, 437
confident = false
not full
VJ delta = 21
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.3 = CACAGTATCAGTTGAC-1

using 50 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 9[2^4, 3, 7^2, 11^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.11 = CACAGTATCCCTCTTT-1

using 1061 reads

====================================================================================

graph has 1596 edges initially, 12 edges after simplification

total ucounts = 460
nonsolo ucounts = 233[2^86, 3^59, 4^38, 5^20, 6^11, 7^8, 8^4, 9, 10^2, 11^2, 12, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.14 = CACAGTATCCTAAGTG-1

using 330 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 6, 318]
surviving nonsolo ucounts = 1[318]
ids = [4]

====================================================================================

UMI info for barcode CACAGTATCCTAAGTG-1 contig 1 = GAGTCAGACT...
umi GTACCGTTGT = 291 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=509]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
413-509 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYNSYALSF at 352, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 25, 31, 87, 100, 236, 239, 332, 371, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.21 = CACAGTATCGGTGTTA-1

using 871 reads

====================================================================================

graph has 270 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 9[2, 3, 4^3, 5, 249, 294, 303]
surviving nonsolo ucounts = 3[249, 294, 303]
ids = [3, 7, 8]

====================================================================================

UMI info for barcode CACAGTATCGGTGTTA-1 contig 1 = GGAGTCAGAC...
umi GTCTGAAGTC = 294 reads: +382 validated
umi TACTGTGCGT = 308 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=544]
0-26 ==> 21-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=10)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 89 reads
cdr3 = CQQAKSFSF at 353, score = 9 + 7
umis assigned: [7, 8]
of which 2 are surviving nonsolos
reads assigned: 592
start codons at 26, 32, 88, 101, 237, 450
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.27 = CACAGTATCTAGCACA-1

using 520 reads

====================================================================================

graph has 264 edges initially, 30 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 5, 252, 255]
surviving nonsolo ucounts = 2[252, 255]
ids = [3, 0]

====================================================================================

UMI info for barcode CACAGTATCTAGCACA-1 contig 1 = GAGTCAGTCT...
umi CTACATGTCC = 232 reads: +388 validated

UMI info for barcode CACAGTATCTAGCACA-1 contig 2 = TCAGTCCCAC...
umi ACAAGTCACG = 244 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=481]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=13)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
413-481 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQTHSPPRTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 25, 31, 87, 100, 278, 455
confident = false

TIG 2[bases=478]
0-22 ==> 5-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
22-373 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
372-410 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
410-478 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CLQYSSSPWTF at 349, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 22, 28, 97, 233, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.28 = CACAGTATCTATCCCG-1

using 338 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 4[2, 3, 4, 317]
surviving nonsolo ucounts = 1[317]
ids = [13]

====================================================================================

UMI info for barcode CACAGTATCTATCCCG-1 contig 1 = AGGAGTCAGA...
umi GCGCTTGTTA = 298 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=487]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=8)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-487 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQANSFPLTF at 354, score = 9 + 9
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 27, 33, 89, 102, 238, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.32 = CACAGTATCTCGCTTG-1

using 369 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 363]
surviving nonsolo ucounts = 1[363]
ids = [1]

====================================================================================

UMI info for barcode CACAGTATCTCGCTTG-1 contig 1 = GAGCTCTGGA...
umi CTCGTCATGA = 347 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=514]
0-43 ==> 9-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
43-391 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
392-431 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
431-514 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQYGSSPMYTF at 367, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 341
start codons at 43, 92, 251, 350, 391, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.33 = CACAGTATCTCGTATT-1

using 680 reads

====================================================================================

graph has 242 edges initially, 24 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[5, 327, 340]
surviving nonsolo ucounts = 2[327, 340]
ids = [9, 10]

====================================================================================

UMI info for barcode CACAGTATCTCGTATT-1 contig 1 = AGAGCTGCTC...
umi TCTTTCGCCT = 333 reads: +49 -1XX +12 -2XX +80 -1XX +3 -1XX +5 -1XX +227 invalidated

UMI info for barcode CACAGTATCTCGTATT-1 contig 2 = GGAGAAGAGC...
umi TGATCGTGTC = 342 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=549]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYGNSRTF at 355, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 320
start codons at 31, 239, 365, 455
confident = false

TIG 2[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYGSSPVTF at 360, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 336
start codons at 36, 244, 247, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.50 = CACATAGAGCGTAATA-1

using 197 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 4, 190]
surviving nonsolo ucounts = 1[190]
ids = [2]

====================================================================================

UMI info for barcode CACATAGAGCGTAATA-1 contig 1 = GGACTCCTGT...
umi GACCGCCGAA = 170 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=530]
18-376 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=21)
406-454 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
454-530 ==> 0-76 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CAHIVGFYFPNSGYYYFDSW at 363, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 18, 62, 241, 244, 333, 508
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.53 = CACATAGAGGACAGCT-1

using 229 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[3, 219]
surviving nonsolo ucounts = 1[219]
ids = [5]

====================================================================================

UMI info for barcode CACATAGAGGACAGCT-1 contig 1 = AGCTTCAGCT...
umi CGATACTTTG = 208 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=531]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-531 ==> 0-96 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 207
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.54 = CACATAGAGGACATTA-1

using 373 reads

====================================================================================

graph has 159 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^2, 3^2, 4, 356]
surviving nonsolo ucounts = 1[356]
ids = [7]

====================================================================================

UMI info for barcode CACATAGAGGACATTA-1 contig 1 = AGTCTGGGCC...
umi GTTGAATCCT = 356 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=633]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-385 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=0)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
422-633 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 77 reads
cdr3 = CQVWDSSSDHVVF at 355, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 352
start codons at 40, 101, 239, 242, 338, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.56 = CACATAGAGGCTCTTA-1

using 334 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 328]
surviving nonsolo ucounts = 1[328]
ids = [2]

====================================================================================

UMI info for barcode CACATAGAGGCTCTTA-1 contig 1 = GGACTCCTGT...
umi CATTTGCGAA = 300 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=535]
18-368 ==> 0-350 on |94|IGHV2-26|L-REGION+V-REGION| [len=357] (mis=24)
385-436 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
436-535 ==> 0-99 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CASAAAPGDWFDPW at 363, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 18, 174, 241, 333, 490
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.59 = CACATAGAGTCCATAC-1

using 409 reads

====================================================================================

graph has 150 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 4, 103, 298]
surviving nonsolo ucounts = 2[103, 298]
ids = [3, 5]

====================================================================================

UMI info for barcode CACATAGAGTCCATAC-1 contig 1 = GAGTCAGTCC...
umi TTCGATTCCA = 302 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 33-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
25-376 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=1)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQLNSYPLTF at 352, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 298
start codons at 25, 31, 87, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.63 = CACATAGCAAACCCAT-1

using 194 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[194]
surviving nonsolo ucounts = 1[194]
ids = [0]

====================================================================================

UMI info for barcode CACATAGCAAACCCAT-1 contig 1 = AGCTTCAGCT...
umi CTCGGTGCGC = 188 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=528]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-528 ==> 0-93 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.65 = CACATAGCAAATCCGT-1

using 1233 reads

====================================================================================

graph has 370 edges initially, 10 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2, 3, 8, 197, 245, 776]
surviving nonsolo ucounts = 3[197, 245, 776]
ids = [6, 1, 0]

====================================================================================

UMI info for barcode CACATAGCAAATCCGT-1 contig 1 = GAGAGCATCA...
umi TGCTAGCGTA = 199 reads: +424 validated

UMI info for barcode CACATAGCAAATCCGT-1 contig 2 = GGGAGGAACT...
umi AACCAGCCAT = 824 reads: +92 -1XX +2 -1XX +1 -6XX +1 -3XX +1 -5XX +269 invalidated
umi AATACCGTCG = 247 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=609]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=5)
440-488 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
488-609 ==> 0-121 on |40|IGHG1|C-REGION| [len=884] (mis=2)
junction support: 1 umis using 27 reads
cdr3 = CARSLVSYSSSWIFDYW at 406, score = 8 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 64, 262, 267, 299, 328, 361
confident = true

TIG 2[bases=553]
0-35 ==> 12-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
35-380 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
379-417 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=7)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 173 reads
cdr3 = CQQRRTWPPAF at 356, score = 9 + 6
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 1002
start codons at 35, 84, 240, 459
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.68 = CACATAGCAAGTACCT-1

using 636 reads

====================================================================================

graph has 250 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[633]
surviving nonsolo ucounts = 1[633]
ids = [3]

====================================================================================

UMI info for barcode CACATAGCAAGTACCT-1 contig 1 = GGAGTCAGAC...
umi CCCGGTAAGG = 604 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=506]
0-32 ==> 21-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=3)
32-377 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=38)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-506 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 97 reads
cdr3 = CQQYNSYPWTF at 353, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 592
start codons at 32, 88, 101, 333, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.70 = CACATAGCAATGCCAT-1

using 403 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 13, 384]
surviving nonsolo ucounts = 1[384]
ids = [2]

====================================================================================

UMI info for barcode CACATAGCAATGCCAT-1 contig 1 = GATCAGGACT...
umi CTTTCGGTCG = 383 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 0-30 on |274|IGKV2D-29|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=1)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CMQSIQLPLYTF at 366, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 381
start codons at 30, 63, 99, 187, 250, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.81 = CACATAGCACGACGAA-1

using 311 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 3, 8, 292]
surviving nonsolo ucounts = 1[292]
ids = [2]

====================================================================================

UMI info for barcode CACATAGCACGACGAA-1 contig 1 = AGGAATCAGA...
umi CCCCAGTCCG = 295 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
383-415 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYNSYPPTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.91 = CACATAGCAGCTATTG-1

using 74 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 65]
surviving nonsolo ucounts = 1[65]
ids = [4]

====================================================================================

UMI info for barcode CACATAGCAGCTATTG-1 contig 1 = AGTCTGGGCC...
umi ATATCCCCGT = 60 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=487]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-391 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=6)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
422-487 ==> 0-65 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CQVWDSSSDHRVF at 355, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 59
start codons at 40, 101, 239, 242, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.94 = CACATAGCAGTCGATT-1

using 305 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 300]
surviving nonsolo ucounts = 1[300]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.98 = CACATAGCATCACAAC-1

using 286 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 3, 275]
surviving nonsolo ucounts = 1[275]
ids = [2]

====================================================================================

UMI info for barcode CACATAGCATCACAAC-1 contig 1 = AGCTTCAGCT...
umi CAGACGATTT = 266 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=520]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-520 ==> 0-85 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.105 = CACATAGCATGGATGG-1

using 27 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 4, 17]
surviving nonsolo ucounts = 1[17]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.110 = CACATAGGTAAATGAC-1

using 5524 reads

====================================================================================

graph has 1890 edges initially, 14 edges after simplification

total ucounts = 191
nonsolo ucounts = 95[2^29, 3^15, 4^9, 5^7, 6^5, 7^9, 8^2, 9^3, 12, 67, 129, 187, 264, 271^2, 278, 287, 300, 320, 342, 358, 418, 604, 1010]
surviving nonsolo ucounts = 15[67, 129, 187, 264, 271^2, 278, 287, 300, 320, 342, 358, 418, 604, 1010]
ids = [167, 162, 155, 35, 80, 83, 131, 133, 163, 164, ...]

====================================================================================

UMI info for barcode CACATAGGTAAATGAC-1 contig 1 = GGAGAAGAGC...
umi ACTCAGTCTC = 354 reads: +388 validated
umi AGCGTTGTAC = 586 reads: -316X +1 -3XX +1 -1XX +1 -5XX +1 -2XX +1 -4XX +1 -4XX +6 -3XX +38 invalidated
umi ATCTTCCCTG = 267 reads: +388 validated
umi CGCGTAGTCA = 272 reads: +388 validated
umi CGTACATGTG = 270 reads: +388 validated
umi GAACTGCCCC = 342 reads: +388 validated
umi GTCTTATCTC = 274 reads: +388 validated
umi GTGCCGTTGC = 283 reads: +388 validated
umi TCCTTACATG = 187 reads: +388 validated
umi TGAAATCCCC = 127 reads: +388 validated
umi TGACTGCTCC = 296 reads: +388 validated
umi TGAGCATTAC = 325 reads: +388 validated
umi TGGATCTTCC = 65 reads: -5 +332 -22 +29 non-validated
umi TTGCCCGGTA = 417 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=560]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
386-424 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 12 umis using 502 reads
cdr3 = CQQYGSSLPWTF at 360, score = 9 + 8
umis assigned: [19, 23, 35, 80, 83, 107, 131, 133, 155, 162] and 4 others
of which 14 are surviving nonsolos
reads assigned: 4015
start codons at 36, 244, 370, 466
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.115 = CACATAGGTACAAGTA-1

using 811 reads

====================================================================================

graph has 290 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 7[2^3, 3, 6, 267, 528]
surviving nonsolo ucounts = 2[267, 528]
ids = [5, 3]

====================================================================================

UMI info for barcode CACATAGGTACAAGTA-1 contig 1 = GGAGTCAGTC...
umi TCCTCTCGCG = 271 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=24)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYDDLPITF at 353, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 26, 32, 88, 101, 363, 366, 456
confident = false

REJECT CONTIGS

TIG 1[bases=303]
0-75 ==> 4-79 on |156|IGHV3-7|5'UTR| [len=79] (mis=1)
0-75 ==> 5925-6000 on rc of segment after IGHV3-7 exon 1 [len=6000] (mis=1)
60-111 ==> 6523-6574 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=3)
75-121 ==> 0-46 on |157|IGHV3-7|L-REGION+V-REGION| [len=351] (mis=2)
121-303 ==> 0-182 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 521
start codons at 75
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.118 = CACATAGGTAGAGCTG-1

using 194 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[192]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode CACATAGGTAGAGCTG-1 contig 1 = GGGGAGGGTC...
umi TCGGATTTGC = 167 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=489]
62-410 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=8)
432-480 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
junction support: 1 umis using 10 reads
cdr3 = CARAGSYHTPFDYW at 407, score = 9 + 7
umis assigned: [1]
of which 0 are surviving nonsolos
reads assigned: 165
start codons at 18, 62, 106
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.123 = CACATAGGTAGCGCAA-1

using 16 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.126 = CACATAGGTATAGGGC-1

using 199 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[199]
surviving nonsolo ucounts = 1[199]
ids = [0]

====================================================================================

UMI info for barcode CACATAGGTATAGGGC-1 contig 1 = GAGAGAGGAG...
umi GTGCTTTTTC = 201 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=521]
0-73 ==> 6-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=31)
440-476 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=1)
476-521 ==> 0-45 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CAKNSGIYAW at 415, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 73, 139, 229, 376, 437
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.128 = CACATAGGTATGAATG-1

using 229 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[2, 3^3, 5, 7, 200]
surviving nonsolo ucounts = 1[200]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=535]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-367 ==> 0-316 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=20)
367-405 ==> 318-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=2) [SHIFT!]
402-440 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
440-535 ==> 0-95 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSTLSGSVF at 373, score = 4 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 51, 135, 208, 358, 383
confident = false
not full
frameshifted full length stopped transcript of length 535
VJ delta = 24
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.129 = CACATAGGTCAAAGAT-1

using 323 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[323]
surviving nonsolo ucounts = 1[323]
ids = [0]

====================================================================================

UMI info for barcode CACATAGGTCAAAGAT-1 contig 1 = GAGGAATCAG...
umi AGGGTACCCA = 320 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=6)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQHKSYPFTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.131 = CACATAGGTCAAGCGA-1

using 134 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 4^2, 123]
surviving nonsolo ucounts = 1[123]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.132 = CACATAGGTCACAAGG-1

using 229 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[226]
surviving nonsolo ucounts = 1[226]
ids = [1]

====================================================================================

UMI info for barcode CACATAGGTCACAAGG-1 contig 1 = TGAGTCTCCC...
umi AGGACGCTCT = 226 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=557]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=1)
410-431 ==> 0-21 on |33|IGHD6-19|D-REGION| [len=21] (mis=2)
436-486 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
486-557 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARRDSSGWYSPDAFDIW at 401, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 59, 233, 257, 392, 438, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.138 = CACATAGGTCGAGATG-1

using 493 reads

====================================================================================

graph has 174 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 170, 315]
surviving nonsolo ucounts = 2[170, 315]
ids = [4, 6]

====================================================================================

UMI info for barcode CACATAGGTCGAGATG-1 contig 1 = GGTGTTTCCA...
umi TCTTATCAAT = 314 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=558]
0-44 ==> 177-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=0)
44-394 ==> 0-350 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=34)
452-477 ==> 36-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
477-558 ==> 0-81 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CATHSRRWSPNHYYFYAMDVW at 383, score = 8 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 44, 200, 344, 363, 403, 434
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.139 = CACATAGGTCTACCTC-1

using 22 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.140 = CACATAGGTCTAGCCG-1

using 454 reads

====================================================================================

graph has 198 edges initially, 22 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[208, 241]
surviving nonsolo ucounts = 2[208, 241]
ids = [1, 5]

====================================================================================

UMI info for barcode CACATAGGTCTAGCCG-1 contig 1 = CCTGGATTCC...
umi AGACCGACTC = 195 reads: +424 validated

UMI info for barcode CACATAGGTCTAGCCG-1 contig 2 = GGATTCCGAG...
umi CTATCGCTTT = 237 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=523]
0-56 ==> 23-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
56-409 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
433-480 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
480-523 ==> 0-43 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARDRAATARLGGMDVW at 398, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 56, 207, 212, 359, 437
confident = false

TIG 2[bases=495]
0-53 ==> 168-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=1)
53-268 ==> 0-215 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=22)
295-430 ==> 215-350 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=11)
452-492 ==> 6-46 on |54|IGHJ4|J-REGION| [len=46] (mis=2)
junction support: 1 umis using 18 reads
cdr3 = CARDTHSGHRADYW at 419, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 53, 122, 209, 270, 297, 380
confident = false
see insertion of CGATGCTACCAGAAACTACGCAGATTC at pos 215 on |146|IGHV3-53|L-REGION+V-REGION|
>vscore_17.140_70.6%
ATGGAGTTTTGGCTGAGCTGGGTTTTCCTTGTTGCTATTTCAAAAGGAGTCCAGTGTAAAGAACAAGTGATGGAGACTGGAGGAGGCTTGATCCAGCCTGGGGGGTCCCTGAGACTCTCTTGTTCAGCCTCTGAGTTTAGCGTCTCCAACAACTACATGAGTTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGATCTCAATCATTTACAGCGATGCTACCAGAAACTACGCAGATTCCGATGCTACCACATACTACGCAGACTCCGTGAAGGGCCGATTCACAATCTCCAGAGACAATTCCAGGAACACAGTGTATCTTCAGATGAACAACCTGAGAGCCGAGGA
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.142 = CACATAGGTCTTCGTC-1

using 118 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[118]
surviving nonsolo ucounts = 1[118]
ids = [0]

====================================================================================

UMI info for barcode CACATAGGTCTTCGTC-1 contig 1 = GGGGGGGTCT...
umi ATTGGTTTGT = 116 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=500]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=4)
41-368 ==> 0-327 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=17)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
432-500 ==> 0-68 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CGSSTISSALVVF at 365, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 116
start codons at 41, 198, 249, 252
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.149 = CACATAGGTTCAGCGC-1

using 180 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 174]
surviving nonsolo ucounts = 1[174]
ids = [3]

====================================================================================

UMI info for barcode CACATAGGTTCAGCGC-1 contig 1 = GGGGGGGGTC...
umi TGGCTAAGCC = 171 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=535]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=3)
42-386 ==> 0-344 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=10)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
430-535 ==> 0-105 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CCSYAGRYSWVF at 366, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 42, 181, 199, 250, 253, 349, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.150 = CACATAGGTTCCCTTG-1

using 39 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 39
nonsolo ucounts = 0[]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.154 = CACATAGGTTTCCACC-1

using 20 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.160 = CACATAGTCACCCGAG-1

using 146 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[142]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.161 = CACATAGTCACGAAGG-1

using 3535 reads

====================================================================================

graph has 3098 edges initially, 26 edges after simplification

total ucounts = 718
nonsolo ucounts = 349[2^131, 3^66, 4^52, 5^35, 6^23, 7^14, 8^7, 9^3, 10^3, 11^4, 12, 13, 28, 42, 161, 213, 243, 269, 284, 298, 367]
surviving nonsolo ucounts = 8[28, 161, 213, 243, 269, 284, 298, 367]
ids = [57, 694, 474, 646, 336, 489, 570, 130]

====================================================================================

UMI info for barcode CACATAGTCACGAAGG-1 contig 1 = AGAGCTCTGG...
umi ATACCGGCCT = 365 reads: +394 validated
umi GAAAACATTA = 190 reads: +32 -2X +1 -7XX +1 -3XX +348 invalidated
umi GTTTCGGGGC = 214 reads: +394 validated
umi TAAGGGTATA = 283 reads: +394 validated
umi TCGTAGGGCT = 299 reads: +394 validated
umi TTACTATGGA = 246 reads: +394 validated
umi TTTATTAGCG = 156 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=627]
0-22 ==> 38-60 on |373|IGLV4-69|5'UTR| [len=60] (mis=0)
22-381 ==> 0-359 on |374|IGLV4-69|L-REGION+V-REGION| [len=359] (mis=5)
378-416 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
416-627 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 6 umis using 279 reads
cdr3 = CQTWGTGQGVF at 355, score = 8 + 8
umis assigned: [130, 336, 474, 489, 570, 646, 694]
of which 7 are surviving nonsolos
reads assigned: 1732
start codons at 22, 183, 223, 239, 338
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.163 = CACATAGTCAGAGGTG-1

using 451 reads

====================================================================================

graph has 190 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 443]
surviving nonsolo ucounts = 1[443]
ids = [2]

====================================================================================

UMI info for barcode CACATAGTCAGAGGTG-1 contig 1 = GAGTCAGACC...
umi CTAACGGGCG = 447 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-31 ==> 22-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
31-376 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=1)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 78 reads
cdr3 = CQQYYSYPYTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 439
start codons at 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.167 = CACATAGTCCACGCAG-1

using 222 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 217]
surviving nonsolo ucounts = 1[217]
ids = [2]

====================================================================================

UMI info for barcode CACATAGTCCACGCAG-1 contig 1 = GGAGTCAGAC...
umi TCGACTTTAT = 215 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=547]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=6)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYNSYSTF at 353, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 26, 32, 88, 101, 237, 240, 333, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.171 = CACATAGTCCGCATCT-1

using 84 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[80]
surviving nonsolo ucounts = 1[80]
ids = [3]

====================================================================================

UMI info for barcode CACATAGTCCGCATCT-1 contig 1 = AGTCAGGACA...
umi TGTTAATTCT = 77 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=431]
14-365 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=1)
365-402 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
402-431 ==> 0-29 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 7 reads
cdr3 = CQQANSFPLTF at 341, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 76
start codons at 14, 20, 76, 89, 225
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.175 = CACATAGTCCTGTACC-1

using 17 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.183 = CACATAGTCTAACTGG-1

using 1625 reads

====================================================================================

graph has 1578 edges initially, 20 edges after simplification

total ucounts = 438
nonsolo ucounts = 189[2^79, 3^39, 4^27, 5^15, 6^11, 7^6, 8^2, 9^2, 10, 11, 12, 13, 109, 141, 159, 321]
surviving nonsolo ucounts = 3[109, 159, 321]
ids = [130, 91, 114]

====================================================================================

UMI info for barcode CACATAGTCTAACTGG-1 contig 1 = GCAGGAGTCA...
umi CATTGGAACA = 297 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=506]
0-29 ==> 18-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
29-380 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
417-506 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQSYRRPITF at 356, score = 8 + 8
umis assigned: [114]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 29, 35, 91, 104, 240, 339, 459
confident = false

REJECT CONTIGS

TIG 1[bases=540]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-79 ==> 0-43 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=0)
82-191 ==> 0-109 on segment before IGLV1-51 exon 2 [len=109] (mis=0)
188-498 ==> 43-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=2) [SHIFT!]
501-539 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
cdr3 = CGTWDSSLSAGLWVF at 466, score = 7 + 8
umis assigned: [91]
of which 1 are surviving nonsolos
reads assigned: 157
start codons at 36, 122, 299, 350, 474, 501
confident = false
not full
frameshifted full length stopped transcript of length 540
VJ delta = -87
delta too large
not full

TIG 2[bases=372]
0-56 ==> 4687-4743 on rc of segment before IGHVII-28-1 exon 1 [len=4743] (mis=0)
56-372 ==> 0-316 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=4)
umis assigned: [130]
of which 1 are surviving nonsolos
reads assigned: 93
start codons at 12, 56, 100
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.184 = CACATAGTCTATCCCG-1

using 378 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 6[2^2, 3^2, 7, 351]
surviving nonsolo ucounts = 1[351]
ids = [2]

====================================================================================

UMI info for barcode CACATAGTCTATCCCG-1 contig 1 = GGGGAGGAGT...
umi ATGTCCCTCG = 351 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQSYTTPWTF at 358, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 346
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.187 = CACATAGTCTGAGTGT-1

using 197 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 5, 184]
surviving nonsolo ucounts = 1[184]
ids = [6]

====================================================================================

REJECT CONTIGS

TIG 1[bases=450]
0-349 ==> 2-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
348-386 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
386-450 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 325, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 169
start codons at 4, 73, 209, 428
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.205 = CACATTTAGCCGATTT-1

using 267 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[3, 256]
surviving nonsolo ucounts = 1[256]
ids = [5]

====================================================================================

UMI info for barcode CACATTTAGCCGATTT-1 contig 1 = GGAGGAACTG...
umi GTCCTCCTCG = 240 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=476]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
419-476 ==> 0-57 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQRSNWPGYTF at 355, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 34, 239, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.210 = CACATTTAGCGATATA-1

using 314 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 305]
surviving nonsolo ucounts = 1[305]
ids = [4]

====================================================================================

UMI info for barcode CACATTTAGCGATATA-1 contig 1 = AGTCAGTCTC...
umi CTCATTCGGC = 300 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 23-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
24-375 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
374-412 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQSYRRPITF at 351, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 298
start codons at 24, 30, 86, 99, 235, 334, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.236 = CACATTTCAACTGGCC-1

using 75 reads

====================================================================================

graph has 95 edges initially, 6 edges after simplification

total ucounts = 22
nonsolo ucounts = 13[2^4, 3^4, 5, 8^2, 9, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.239 = CACATTTCAAGCCGTC-1

using 4268 reads

====================================================================================

graph has 3062 edges initially, 58 edges after simplification

total ucounts = 865
nonsolo ucounts = 494[2^142, 3^98, 4^57, 5^47, 6^35, 7^30, 8^11, 9^18, 10^10, 11^14, 12^6, 13^7, 14^5, 15^2, 16^3, 17, 61, 142, 159, 202, 246, 247, 256, 291]
surviving nonsolo ucounts = 8[61, 142, 159, 202, 246, 247, 256, 291]
ids = [769, 125, 574, 176, 794, 617, 541, 115]

====================================================================================

UMI info for barcode CACATTTCAAGCCGTC-1 contig 1 = AGCCTGGGCC...
umi ACTCGAGCCT = 299 reads: +376 validated
umi ACTTTCCCAC = 143 reads: +376 validated
umi ATAAAGCACT = 204 reads: +376 validated
umi GCTTTGCTGC = 257 reads: +376 validated
umi GTACATAATC = 151 reads: +376 validated
umi TAAAATGCTC = 251 reads: +376 validated
umi TGCTCAACCC = 64 reads: +376 validated

UMI info for barcode CACATTTCAAGCCGTC-1 contig 2 = GGGGGAATCC...
umi TTAAAGGCCA = 241 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=627]
0-40 ==> 75-115 on |368|IGLV3-9|5'UTR| [len=115] (mis=0)
40-375 ==> 0-335 on |369|IGLV3-9|L-REGION+V-REGION| [len=346] (mis=24)
378-416 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
416-627 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 7 umis using 263 reads
cdr3 = CQVWDSRTYVF at 355, score = 7 + 7
umis assigned: [115, 125, 176, 541, 574, 617, 769]
of which 7 are surviving nonsolos
reads assigned: 1336
start codons at 40, 101, 188, 338, 380, 548
confident = true

TIG 2[bases=571]
21-379 ==> 0-358 on |99|IGHV2-70|L-REGION+V-REGION| [len=358] (mis=20)
389-436 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
436-571 ==> 0-135 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 34 reads
cdr3 = CARILEPSGMDVW at 366, score = 7 + 6
umis assigned: [794]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 21, 27, 244, 276, 327, 336, 393
confident = true
now this is a cell
paired!

ATGGACCCTGTGGACACAGCCACATATTACTGTGCACGGATACTGGAACCCTCCGGTATGGACGTCTGGGGCCAAGGGACCACGGTCGCTGTCTCCTCAG <==> ATCAGCGGAGCCCAAGTCGGGGATGAGGCTGACTATTACTGTCAGGTGTGGGACAGCAGAACGTATGTCTTCGGACCTGGGACCACGGTCACCGTCCTTG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.240 = CACATTTCAAGCTGAG-1

using 290 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 4, 279]
surviving nonsolo ucounts = 1[279]
ids = [0]

====================================================================================

UMI info for barcode CACATTTCAAGCTGAG-1 contig 1 = AGGAGTCAGT...
umi AAGTACAGAA = 280 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQSYSTLRTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 17.242 = CACATTTCAAGGGTCA-1

using 25 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^3, 3, 4, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!
sorting bam, mem = 0.06
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk017-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk017-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

7.950 seconds used processing barcodes, peak mem = 0.23
