[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.34 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GE...
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 15.0 = AGTGTCAAGATATGGT-1

using 458 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[4, 447]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 15.9 = AGTGTCAAGCGTCTAT-1

using 12999 reads

====================================================================================

graph has 6320 edges initially, 86 edges after simplification

total ucounts = 805
nonsolo ucounts = 388[2^141, 3^76, 4^49, 5^22, 6^17, 7^9, 8^3, 9^3, 10^2, 11, 12^2, 13^2, 16, 17, 18, 30, 46, 48, 51, 53, 64, 76, 78, 81, 88, 102, 106, 109,...
surviving nonsolo ucounts = 54[46, 48, 51, 53, 64, 78, 81, 88, 106, 113, 117, 130, 131, 138, 144, 145, 147^2, 156, 158, 160, 162, 168, 171, 175, 178, 182, 1...
ids = [57, 545, 293, 223, 59, 482, 81, 344, 177, 66, ...]

====================================================================================

UMI info for barcode AGTGTCAAGCGTCTAT-1 contig 1 = AGCTCTCAGA...
umi ACACCAATGC = 43 reads: +373 -1 +21 -1 +6 -10 non-validated
umi ACACTGACCG = 59 reads: +412 validated
umi ACATGGAGTC = 110 reads: +412 validated
umi ACCGGGCGAA = 84 reads: +412 validated
umi AGCTGGATAG = 194 reads: +26 -1XX +1 -1X +376 -1 +6 invalidated
umi AGTACTATGC = 251 reads: +412 validated
umi AGTTGTGCCA = 118 reads: +412 validated
umi ATAACTCCAC = 147 reads: +405 -7 non-validated
umi ATGCAACCAA = 191 reads: +397 -1 +1 -1X +1 -1 +9 -1 invalidated
umi CACGTCCCCT = 52 reads: +211 -1 +200 non-validated
umi CCGCAAAACG = 52 reads: -2 +400 -10 non-validated
umi CTAATACACT = 160 reads: +412 validated
umi CTGAAAATCA = 133 reads: +412 validated
umi CTGTATCCCC = 251 reads: +412 validated
umi GATCAGGCCA = 184 reads: +412 validated
umi GCTAGGACAT = 77 reads: +403 -2 +7 non-validated
umi GGTGTCTTCG = 180 reads: +143 -9XX +246 -14 invalidated
umi TATGACCTAG = 183 reads: +412 validated
umi TCTCGCCAGT = 148 reads: +412 validated
umi TGGGTTATCA = 159 reads: +412 validated

UMI info for barcode AGTGTCAAGCGTCTAT-1 contig 2 = AGGAATCAGA...
umi AAATTCTGCA = 306 reads: +388 validated
umi ACATATTTCG = 204 reads: +388 validated
umi ACGCTAGCTT = 220 reads: +388 validated
umi AGCATACTAG = 470 reads: +388 validated
umi AGGAGGTTCT = 196 reads: +388 validated
umi ATCCTCCTGC = 261 reads: +388 validated
umi ATCTCCTGCT = 266 reads: +388 validated
umi ATGCGTATGC = 199 reads: +388 validated
umi ATTTTCCCTG = 243 reads: +388 validated
umi CACATTGCAT = 204 reads: +388 validated
umi CATATCTGCA = 277 reads: +388 validated
umi CCGTAACCCG = 147 reads: +388 validated
umi CCTCCACGCA = 491 reads: -198 +190 non-validated
umi CGCCATTGCT = 214 reads: +388 validated
umi CGTTAACCCG = 88 reads: +388 validated
umi CTGGTCCCAC = 535 reads: -129 +259 non-validated
umi GATCATTGGA = 246 reads: +388 validated
umi GGAAGACCTA = 282 reads: +388 validated
umi TAGGTTACCG = 288 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=562]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=10)
455-491 ==> 10-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
491-562 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 14 umis using 176 reads
cdr3 = CARSPAVAGTVHW at 421, score = 9 + 7
umis assigned: [57, 59, 66, 81, 121, 131, 143, 145, 174, 223] and 10 others
of which 20 are surviving nonsolos
reads assigned: 2683
start codons at 79, 235, 356, 382
confident = true

... 36097 lines elided ...
using 605 reads

====================================================================================

graph has 270 edges initially, 4 edges after simplification

total ucounts = 19
nonsolo ucounts = 10[2^3, 3^2, 4, 5, 6, 255, 314]
surviving nonsolo ucounts = 2[255, 314]
ids = [4, 2]

====================================================================================

UMI info for barcode CAACTAGCATCTATGG-1 contig 1 = AAAAACCACA...
umi ATATAAGGAC = 308 reads: +436 validated

UMI info for barcode CAACTAGCATCTATGG-1 contig 2 = GGGGGTCTCA...
umi CCATCGTCGT = 255 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=558]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-558 ==> 0-72 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 301
start codons at 50, 248, 253, 270, 314, 347, 540
confident = false

TIG 2[bases=562]
39-382 ==> 0-343 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=7)
389-427 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
427-562 ==> 0-135 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CSSYTSTITVVF at 363, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 39, 196, 240, 250
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 15.4433 = CAACTAGGTACAGTGG-1

using 367 reads

====================================================================================

graph has 120 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[4, 41, 320]
surviving nonsolo ucounts = 2[41, 320]
ids = [0, 4]

====================================================================================

UMI info for barcode CAACTAGGTACAGTGG-1 contig 1 = GGGATGCTTT...
umi TTCGGGATTT = 319 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=551]
19-396 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=15)
417-467 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
467-551 ==> 0-84 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 36 reads
cdr3 = CGRQGVSVGGFDAFDIW at 385, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 3, 19, 28, 40, 84, 419, 448
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 15.4436 = CAACTAGGTAGCCTCG-1

using 361 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 354]
surviving nonsolo ucounts = 1[354]
ids = [2]

====================================================================================

UMI info for barcode CAACTAGGTAGCCTCG-1 contig 1 = GACACAGCAT...
umi CATAATAGTC = 319 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=481]
8-361 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=14)
358-396 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
396-481 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQSYKAPLTF at 335, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 8, 14, 70, 219, 387, 438
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 15.4437 = CAACTAGGTAGCGTCC-1

using 160 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 158]
surviving nonsolo ucounts = 1[158]
ids = [1]

====================================================================================

UMI info for barcode CAACTAGGTAGCGTCC-1 contig 1 = GTCTCAGTCA...
umi GTCCCAGGCC = 153 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=474]
0-19 ==> 4-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
19-372 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
368-407 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
407-474 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQTYSTPTSF at 346, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 152
start codons at 19, 25, 81, 94, 230, 449
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 15.4448 = CAACTAGGTCTCACCT-1

using 54 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2^2, 3, 5^2, 7, 12, 14]
surviving nonsolo ucounts = 1[14]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 15.4454 = CAACTAGGTGCACGAA-1

using 8222 reads

====================================================================================

graph has 6710 edges initially, 42 edges after simplification

total ucounts = 1661
nonsolo ucounts = 747[2^304, 3^158, 4^111, 5^54, 6^26, 7^27, 8^18, 9^10, 10^2, 11^2, 12^4, 13^2, 14, 15^2, 16, 17, 31, 39, 79, 88, 95, 101, 132, 146, 151, 1...
surviving nonsolo ucounts = 22[39, 79, 88, 95, 101, 132, 146, 151, 163, 206, 212, 226, 238, 247, 255, 257^2, 262, 287, 302, 320, 483]
ids = [110, 310, 1542, 751, 56, 82, 25, 688, 1608, 1047, ...]

====================================================================================

UMI info for barcode CAACTAGGTGCACGAA-1 contig 1 = GGGGGAGTCA...
umi CCCATCTCGT = 322 reads: +391 validated
umi GAACGCGGAG = 223 reads: +391 validated
umi GTATGAGGTT = 207 reads: +391 validated
umi TTATCACTTA = 259 reads: +391 validated

UMI info for barcode CAACTAGGTGCACGAA-1 contig 2 = AGCTCTGGGA...
umi AACATTCATC = 142 reads: +391 -1 +5 -24 non-validated
umi AATACCCGCC = 101 reads: +417 -4 non-validated
umi AATTGGTTTA = 136 reads: +421 validated
umi ACCACGTACG = 218 reads: +421 validated
umi ACCATTTTGA = 36 reads: +333 -23 +65 non-validated
umi ATTGCTAGGG = 78 reads: +394 -1 +1 -1 +1 -2 +2 -1 +3 -3 +1 -1 +3 -1 +2 -1 +1 -1 +1 non-validated
umi CAGGTGGCGG = 239 reads: +421 validated
umi CCTACGCGAC = 261 reads: +421 validated
umi CTATATGCTT = 153 reads: +421 validated
umi CTCCCCGGCT = 270 reads: +421 validated
umi CTGTAATCAG = 88 reads: +421 validated
umi GCCCCTATTT = 494 reads: +421 validated
umi GTACTGCGTT = 257 reads: +421 validated
umi TAGCGTCCTT = 249 reads: +421 validated
umi TATATTAGAT = 246 reads: +421 validated
umi TCAGGCTATA = 285 reads: +421 validated
umi TTATGTAGCC = 87 reads: +421 validated
umi TTGTGAGGGT = 159 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=556]
29-382 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=0)
382-420 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 4 umis using 173 reads
cdr3 = CQQSYSTPPITF at 356, score = 9 + 8
umis assigned: [488, 805, 1047, 1537]
of which 4 are surviving nonsolos
reads assigned: 990
start codons at 29, 35, 91, 104, 240, 462
confident = true

TIG 2[bases=572]
0-80 ==> 0-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=2)
463-501 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
501-572 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 15 umis using 270 reads
cdr3 = CTRDGGKWEPPGYW at 428, score = 8 + 7
umis assigned: [25, 56, 82, 105, 110, 310, 391, 536, 688, 705] and 8 others
of which 18 are surviving nonsolos
reads assigned: 3439
start codons at 80, 133, 231, 236, 303, 360, 389, 438
confident = true
now this is a cell
paired!

AAAACCGAGGACACAGCCGTGTATTACTGTACTAGAGATGGGGGAAAGTGGGAGCCCCCAGGCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTA...

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 15.4459 = CAACTAGGTGTGCCTG-1

using 1064 reads

====================================================================================

graph has 1520 edges initially, 16 edges after simplification

total ucounts = 528
nonsolo ucounts = 211[2^83, 3^53, 4^34, 5^16, 6^8, 7^3, 8^6, 9^4, 11, 12, 13, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 15.4464 = CAACTAGGTTCCACGG-1

using 1765 reads

====================================================================================

graph has 2358 edges initially, 24 edges after simplification

total ucounts = 726
nonsolo ucounts = 292[2^134, 3^62, 4^26, 5^20, 6^13, 7^15, 8^8, 9^3, 10, 11^3, 12^2, 13, 15, 18^2, 268]
surviving nonsolo ucounts = 1[268]
ids = [5]

====================================================================================

UMI info for barcode CAACTAGGTTCCACGG-1 contig 1 = GATCAGGACT...
umi AACAAGCCTT = 269 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 15.4466 = CAACTAGGTTCCCTTG-1

using 157 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[157]
surviving nonsolo ucounts = 1[157]
ids = [0]

====================================================================================

UMI info for barcode CAACTAGGTTCCCTTG-1 contig 1 = CTACAACAGG...
umi CACTCCTGGC = 148 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=511]
0-27 ==> 148-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
27-390 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
388-427 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
427-511 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQYYGSPRTF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 144
start codons at 24, 27, 82, 96, 349, 379, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 15.4476 = CAACTAGTCAGGCCCA-1

using 407 reads

====================================================================================

graph has 139 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^2, 4, 5^2, 386]
surviving nonsolo ucounts = 1[386]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=520]
0-38 ==> 143-181 on |260|IGKV1D-8|5'UTR| [len=181] (mis=0)
0-44 ==> 5956-6000 on rc of segment after IGKV1-8 exon 1 [len=6000] (mis=2)
8-89 ==> 5659-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
38-358 ==> 0-320 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=1)
363-384 ==> 17-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
384-520 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 380
start codons at 7, 38, 44, 100, 113, 176, 249, 426
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 15.4477 = CAACTAGTCAGTTGAC-1

using 277 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[3^2, 4, 5, 256]
surviving nonsolo ucounts = 1[256]
ids = [4]

====================================================================================

UMI info for barcode CAACTAGTCAGTTGAC-1 contig 1 = GACTGATCAG...
umi CGTCTGTTAT = 247 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=506]
0-34 ==> 2-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
34-394 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=3)
394-431 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
431-506 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CMQALQTFLTF at 370, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 34, 67, 103, 191, 353, 373, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 15.4490 = CAACTAGTCCTTCAAT-1

using 476 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[4, 11, 459]
surviving nonsolo ucounts = 1[459]
ids = [4]

====================================================================================

UMI info for barcode CAACTAGTCCTTCAAT-1 contig 1 = AATCAGTCCC...
umi TAGGCCAGGT = 460 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 3-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
24-375 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 87 reads
cdr3 = CLQYSSSPWTF at 351, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 454
start codons at 24, 30, 99, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 15.4493 = CAACTAGTCGCCATAA-1

using 124 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 22
nonsolo ucounts = 12[3, 5^2, 6, 7, 8, 10^2, 11, 14, 15, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 15.4496 = CAACTAGTCTACCAGA-1

using 310 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[4, 7, 296]
surviving nonsolo ucounts = 2[7, 296]
ids = [4, 1]

====================================================================================

UMI info for barcode CAACTAGTCTACCAGA-1 contig 1 = TGGGGAGGAA...
umi CAGCAGTGTC = 282 reads: +110 -1XX +13 -1XX +263 invalidated
umi GTCTAGACTT = 7 reads: -38 +64 -1 +45 -1X +8 -1X +1 -1X +2 -95 +1 -2X +20 -1XX +36 -1X +2 -68 invalidated

GOOD CONTIGS

TIG 1[bases=507]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=17)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-507 ==> 0-87 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 285
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!
sorting bam, mem = 0.16
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ...

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

226.653 seconds used processing barcodes, peak mem = 0.35
