[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.38 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk004-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk004-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk004.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.0 = AAGACCTGTCTTGCGG-1

using 34045 reads

====================================================================================

graph has 8691 edges initially, 38 edges after simplification

total ucounts = 895
nonsolo ucounts = 411[2^134, 3^90, 4^33, 5^20, 6^17, 7^4, 8, 9^3, 10, 12, 13^2, 14, 15, 20, 29, 43, 45, 47^2, 57, 58, 62, 72, 109, 136, 139, 154, 160, 171, 186, 190, 201, 207, 208, 222, 224, 229, 232, 234, 238^2, 240, 242^2, 248^2, 250, 251, 255^3, 256, 259, 261, 262, 263, 267^2, 271, 273, 274, 275^3, 277, 279, 280, 282, 283^3, 286, 290, 291^2, 292, 293, 294, 297, 301^2, 304, 312, 314, 319, 324, 330, 332, 350, 373, 379, 380, 386, 389, 414, 425, 427, 442, 444, 450, 530, 538, 583, 591, 593^2, 598, 614, 684, 692, 695, 710, 723, 756, 842, 886]
surviving nonsolo ucounts = 93[47, 136, 139, 154, 160, 171, 186, 190, 201, 207, 208, 222, 224, 229, 232, 234, 238^2, 240, 242^2, 248^2, 250, 251, 255^3, 256, 259, 261, 262, 263, 267^2, 271, 273, 274, 275^3, 277, 279, 280, 282, 283^3, 286, 290, 291^2, 292, 293, 294, 297, 301^2, 304, 312, 314, 319, 324, 330, 332, 350, 373, 379, 380, 386, 389, 414, 425, 427, 442, 444, 450, 530, 538, 583, 591, 593^2, 598, 614, 684, 692, 695, 710, 723, 756, 842, 886]
ids = [186, 721, 258, 132, 273, 44, 833, 319, 759, 353, ...]

====================================================================================

UMI info for barcode AAGACCTGTCTTGCGG-1 contig 1 = TGGGAGGAGT...
umi AACCATCCAC = 248 reads: +388 validated
umi AACTAACTTA = 278 reads: +388 validated
umi AAGCTTGGAA = 208 reads: +388 validated
umi AAGGGAGCTT = 225 reads: +388 validated
umi AATCAATACT = 170 reads: +388 validated
umi ACAGGTGTTG = 391 reads: +388 validated
umi ACCAACTTTA = 298 reads: +388 validated
umi AGGGCCCTAA = 248 reads: +388 validated
umi AGTCTTTAGT = 239 reads: +388 validated
umi ATAAAGCGGG = 153 reads: +388 validated
umi ATAGAAGTCC = 297 reads: +388 validated
umi ATCAACTATC = 218 reads: +388 validated
umi ATGCCATACT = 247 reads: +388 validated
umi ATGCGCTATC = 280 reads: +388 validated
umi ATTAAACTGT = 294 reads: +388 validated
umi ATTCAGGCCC = 354 reads: +388 validated
umi ATTGACCTGT = 534 reads: +388 validated
umi CACAGTACGT = 383 reads: +388 validated
umi CACTTAGTAG = 339 reads: +388 validated
umi CAGCATAAGC = 232 reads: +388 validated
umi CATCTCGTCA = 265 reads: +388 validated
umi CCACCTGGCC = 136 reads: +388 validated
umi CCACTCACAG = 247 reads: +388 validated
umi CCAGCTTGGC = 258 reads: +388 validated
umi CCCACTTCGT = 254 reads: +388 validated
umi CCCTGTCCTG = 291 reads: +388 validated
umi CCCTTACCGC = 264 reads: +388 validated
umi CCGTTCAGGG = 540 reads: +388 validated
umi CCTAGGTTTG = 229 reads: +388 validated
umi CGAATAATAT = 315 reads: +388 validated
umi CGAATCCACT = 273 reads: +388 validated
umi CGACTGTTTA = 190 reads: +388 validated
umi CGGTCACAAT = 300 reads: +388 validated
umi CGGTCGGTTT = 275 reads: +388 validated
umi CGTACAGAGT = 206 reads: +388 validated
umi CGTAGAATCG = 256 reads: +388 validated
umi CTATTGTCCT = 284 reads: +388 validated
umi CTTAAGCCTT = 239 reads: +388 validated
umi CTTGGGTGGC = 256 reads: +388 validated
umi GAACAATTTC = 298 reads: +388 validated
umi GACTATAGTA = 295 reads: +388 validated
umi GATAACATCA = 281 reads: +388 validated
umi GATTACAACA = 322 reads: +388 validated
umi GGCAGATTGC = 246 reads: +388 validated
umi GGGGACGCGT = 302 reads: +388 validated
umi GTATTCCTCT = 452 reads: +138 -1XX +1 -5XX +1 -7XX +1 -3XX +1 -1XX +2 -1XX +1 -124XX +2 -1XX +2 -1XX +2 -5XX +88 invalidated
umi GTCATCCCCC = 275 reads: +388 validated
umi GTGTTCGGGC = 310 reads: +388 validated
umi TAACAGCTTC = 282 reads: +388 validated
umi TAATATTGCG = 254 reads: +388 validated
umi TATCCTCATG = 282 reads: +388 validated
umi TATGTTGAAC = 592 reads: -260X +128 invalidated
umi TATTATCTGA = 239 reads: +388 validated
umi TCCATTTTGT = 266 reads: +388 validated
umi TCGCAGCTGG = 271 reads: +388 validated
umi TCGCCTTTCC = 137 reads: +388 validated
umi TCGTAAAACT = 285 reads: +388 validated
umi TCTAGGATGA = 264 reads: +388 validated
umi TCTCCTGTTT = 411 reads: +388 validated
umi TCTCTGGGAA = 290 reads: +388 validated
umi TCTTTCATCG = 381 reads: +388 validated
umi TGACTATCAA = 381 reads: +388 validated
umi TGACTGAGTT = 202 reads: +388 validated
umi TGAGCACCTT = 274 reads: +388 validated
umi TGCACAGGGT = 429 reads: +388 validated
umi TGCATAACTC = 335 reads: +388 validated
umi TTAAGTTTCG = 232 reads: +388 validated
umi TTAATCCCAT = 279 reads: +388 validated
umi TTATTCCAGC = 276 reads: +388 validated
umi TTCATGAGGC = 191 reads: +12 -1XX +375 invalidated
umi TTCTAATTTA = 243 reads: +388 validated
umi TTGCCTGGCC = 327 reads: +388 validated
umi TTGTTCGCAT = 301 reads: +388 validated
umi TTGTTCTACC = 476 reads: +139 -1XX +1 -3XX +2 -2XX +1 -3XX +1 -7XX +1 -1XX +2 -50X +1 -6XX +1 -1XX +2 -7XX +156 invalidated
umi TTTCGTTAGT = 275 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=3)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=4)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 74 umis using 3283 reads
cdr3 = CQQYDNLPLTF at 358, score = 9 + 9
umis assigned: [15, 23, 29, 30, 44, 60, 66, 114, 126, 132] and 65 others
of which 75 are surviving nonsolos
reads assigned: 21307
start codons at 31, 37, 93, 106, 245, 368, 461
confident = true

REJECT CONTIGS

TIG 1[bases=447]
4-80 ==> 3258-3334 on rc of segment before IGKV2-24 exon 2 [len=3774] (mis=7)
4-80 ==> 3255-3331 on segment before IGKV2D-23 exon 1 [len=3772] (mis=7)
30-256 ==> 0-226 on |269|IGKV2D-24|L-REGION+V-REGION| [len=360] (mis=0)
273-311 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
311-447 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [115, 186, 187, 202, 232, 237, 273, 344, 494, 542] and 8 others
of which 18 are surviving nonsolos
reads assigned: 10218
start codons at 30, 63, 99, 187, 256, 353
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.7 = AAGACCTGTTATCCGA-1

using 318 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[314]
surviving nonsolo ucounts = 1[314]
ids = [2]

====================================================================================

UMI info for barcode AAGACCTGTTATCCGA-1 contig 1 = GAGGAACTGC...
umi TACCCACGAG = 300 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=469]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-469 ==> 0-54 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 44 reads
cdr3 = CQQYNNWPLTF at 354, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 298
start codons at 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.9 = AAGACCTGTTCGGCAC-1

using 10297 reads

====================================================================================

graph has 4271 edges initially, 100 edges after simplification

total ucounts = 689
nonsolo ucounts = 293[2^103, 3^43, 4^50, 5^19, 6^9, 7^4, 8^3, 9^5, 11^2, 12, 13^2, 14, 15, 16, 53, 62, 63, 77, 81, 82, 83, 99, 105, 107, 111^2, 120, 129, 139, 145, 157, 158, 159, 166, 170, 186, 199, 200, 201, 203, 206^2, 207, 210, 211, 212, 216, 219, 222, 229, 230, 234, 238, 239, 246, 247, 252, 254, 258, 275, 305, 323, 410]
surviving nonsolo ucounts = 47[62, 63, 77, 81, 82, 83, 99, 105, 107, 111^2, 120, 129, 145, 157, 158, 159, 166, 170, 186, 199, 200, 201, 203, 206^2, 207, 210, 211, 212, 216, 219, 222, 229, 230, 234, 238, 239, 246, 247, 252, 254, 258, 275, 305, 323, 410]
ids = [335, 253, 466, 106, 51, 171, 143, 635, 334, 133, ...]

====================================================================================

UMI info for barcode AAGACCTGTTCGGCAC-1 contig 1 = AGCTCTGGGA...
umi ACGTACACTT = 205 reads: +422 -17 non-validated
umi ACGTCATCAA = 119 reads: +430 -9 non-validated
umi ACTTTTACTA = 215 reads: +370 -1 +68 non-validated
umi AGCAGACTCT = 320 reads: +439 validated
umi AGGCCAACGA = 82 reads: +430 -9 non-validated
umi ATATGTTGGA = 98 reads: +439 validated
umi ATTCTAGGGG = 86 reads: +363 -26 +9 -1 +40 non-validated
umi CCCGTCGTCG = 155 reads: +385 -4 +7 -1 +42 non-validated
umi CGGAGCGGTT = 235 reads: +439 validated
umi GAATATCTTA = 108 reads: +394 -1 +8 -1 +3 -32 non-validated
umi GCTATACGCG = 255 reads: +429 -10 non-validated
umi TAAAAGTGTC = 252 reads: +395 -3X +1 -2 +1 -37 invalidated
umi TCACTTTTCC = 211 reads: +419 -4 +16 non-validated
umi TTATGTCCCC = 105 reads: +411 -28 non-validated
umi TTCACTCTAC = 277 reads: +428 -11 non-validated
umi TTTTGAGTCA = 315 reads: +439 validated

UMI info for barcode AAGACCTGTTCGGCAC-1 contig 2 = GCTGGGGTCT...
umi AATAGGTTTG = 229 reads: +388 validated
umi ACAGCCCAGT = 83 reads: +388 validated
umi ACGGCACAGC = 173 reads: +388 validated
umi ATACCATACC = 112 reads: +388 validated
umi CCTGGGTACG = 64 reads: +388 validated
umi CGATACCATA = 213 reads: +388 validated
umi CGCCCGCGGC = 250 reads: +388 validated
umi CGCTCCCTAT = 168 reads: +388 validated
umi CTCAATGTCA = 164 reads: +12 -5X +1 -3XX +2 -3XX +1 -4XX +1 -2XX +3 -6XX +345 invalidated
umi GACTGACGTA = 187 reads: +388 validated
umi GATCAATGAA = 208 reads: +388 validated
umi GCCTTTGAGC = 131 reads: +388 validated
umi GCTCCGCGCA = 161 reads: +24 -2X +1 -4XX +1 -2XX +3 -6XX +345 invalidated
umi GGAGCTCGTC = 113 reads: +11 -6X +1 -3XX +2 -3XX +1 -4XX +1 -2XX +3 -6XX +345 invalidated
umi TAATTGACAT = 77 reads: +388 validated
umi TAGAGGAATC = 148 reads: +29 -2X +1 -2XX +3 -6XX +335 -1 +9 invalidated
umi TATGATTCCC = 248 reads: +388 validated
umi TCATTTCTCT = 202 reads: +388 validated
umi TCTTTACCGG = 110 reads: +388 validated
umi TGCCTTTCGC = 248 reads: +388 validated
umi TTTCGACATT = 162 reads: +388 validated
umi TTTTGGGCCA = 241 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=590]
0-80 ==> 0-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=3)
80-435 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=35)
456-519 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
519-590 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 67 reads
cdr3 = CAKDILSSSGWYYYYYYGMDVW at 422, score = 9 + 7
umis assigned: [72, 73, 82, 88, 106, 143, 171, 239, 270, 334] and 6 others
of which 16 are surviving nonsolos
reads assigned: 2993
start codons at 80, 225, 231, 236, 315, 383, 476
confident = true

TIG 2[bases=640]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=6)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
429-640 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 21 umis using 527 reads
cdr3 = CSSYAGSNILVF at 365, score = 8 + 9
umis assigned: [32, 51, 68, 133, 253, 257, 261, 268, 295, 338] and 12 others
of which 22 are surviving nonsolos
reads assigned: 3633
start codons at 41, 198, 242, 249, 348, 375
confident = true

REJECT CONTIGS

TIG 1[bases=635]
1-28 ==> 5785-5812 on segment before IGLV2-34 exon 1 [len=6000] (mis=1)
23-89 ==> 5809-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=2)
42-186 ==> 0-144 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=0)
186-382 ==> 145-341 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=4) [SHIFT!]
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [12, 36, 117, 335, 492, 537, 560, 655, 674]
of which 9 are surviving nonsolos
reads assigned: 1906
start codons at 42, 181, 198, 242, 249, 252, 348, 375
confident = false
did not find CDR3
now this is a cell
paired!

TACTGTGCAAAAGATATATTATCTAGCAGTGGCTGGTATTACTACTACTACTACGGCATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCAGCTCATATGCAGGCAGCAACATTTTGGTGTTCGGCGGAGGCACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.17 = AAGACCTTCACCCGAG-1

using 254 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 3^2, 4, 237]
surviving nonsolo ucounts = 2[2, 237]
ids = [7, 8]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.22 = AAGACCTTCATAAAGG-1

using 175 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2^5, 3, 158]
surviving nonsolo ucounts = 1[158]
ids = [2]

====================================================================================

UMI info for barcode AAGACCTTCATAAAGG-1 contig 1 = CCTGGGCCTC...
umi CACTCCTGCT = 156 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=564]
0-38 ==> 14-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
38-384 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=5)
379-417 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
417-564 ==> 0-147 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQAWDSSTAVVF at 353, score = 6 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 154
start codons at 38, 43, 99, 186, 332, 336
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.24 = AAGACCTTCATTGCCC-1

using 329 reads

====================================================================================

graph has 149 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 320]
surviving nonsolo ucounts = 1[320]
ids = [4]

====================================================================================

UMI info for barcode AAGACCTTCATTGCCC-1 contig 1 = GGAGTCAGTC...
umi GGTTTCCGTC = 326 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 26, 32, 88, 101, 237, 336, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.25 = AAGACCTTCCAAAGTC-1

using 299 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 293]
surviving nonsolo ucounts = 1[293]
ids = [4]

====================================================================================

UMI info for barcode AAGACCTTCCAAAGTC-1 contig 1 = GGGACTGATC...
umi TCACATCATG = 285 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=501]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=2)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
398-436 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
436-501 ==> 0-65 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CMQALQTPLFTF at 372, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 36, 69, 105, 193, 355, 375, 478
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.28 = AAGACCTTCCGGCACA-1

using 279 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 5, 267]
surviving nonsolo ucounts = 1[267]
ids = [4]

====================================================================================

UMI info for barcode AAGACCTTCCGGCACA-1 contig 1 = AGCTCTGAGA...
umi TTACAGTCTT = 268 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=589]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-589 ==> 0-86 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.32 = AAGACCTTCCGTCAAA-1

using 429 reads

====================================================================================

graph has 176 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 9, 200, 216]
surviving nonsolo ucounts = 3[9, 200, 216]
ids = [0, 5, 3]

====================================================================================

UMI info for barcode AAGACCTTCCGTCAAA-1 contig 1 = AGGAATCAGT...
umi AGTTGTATGC = 7 reads: -22 +34 -1 +13 -1 +7 -44 +56 -11 +1 -1 +2 -1 +126 -12 +56 non-validated
umi TATTCATTTC = 194 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=463]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-463 ==> 0-48 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [0, 5]
of which 2 are surviving nonsolos
reads assigned: 200
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.33 = AAGACCTTCCGTCATC-1

using 14 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.37 = AAGACCTTCGACGGAA-1

using 182 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^3, 3, 4, 166]
surviving nonsolo ucounts = 1[166]
ids = [0]

====================================================================================

UMI info for barcode AAGACCTTCGACGGAA-1 contig 1 = CCACTCAGGA...
umi ACCTCTTCAT = 154 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=448]
16-367 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
366-404 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
404-448 ==> 0-44 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CLQYSSSPWTF at 343, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 152
start codons at 16, 22, 91, 227
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.38 = AAGACCTTCGCACTCT-1

using 291 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 3^2, 5, 272]
surviving nonsolo ucounts = 1[272]
ids = [8]

====================================================================================

UMI info for barcode AAGACCTTCGCACTCT-1 contig 1 = GAGCTGCTCA...
umi TCGGGAACAG = 258 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=508]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-508 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYGTSPPTF at 354, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 30, 238, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.39 = AAGACCTTCGGACAAG-1

using 259 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 5, 247]
surviving nonsolo ucounts = 1[247]
ids = [3]

====================================================================================

UMI info for barcode AAGACCTTCGGACAAG-1 contig 1 = CCCACCATGG...
umi TCAAACTCTT = 239 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=492]
6-364 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=12)
395-445 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
445-492 ==> 0-47 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CAHRLSGALVWEYVKDTFDIW at 351, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 6, 50, 229, 232, 312, 321, 388, 426
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.43 = AAGACCTTCTAACTGG-1

using 17 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.50 = AAGACCTTCTTTAGTC-1

using 1085 reads

====================================================================================

graph has 1496 edges initially, 22 edges after simplification

total ucounts = 524
nonsolo ucounts = 228[2^89, 3^62, 4^36, 5^18, 6^3, 7^11, 8, 9^2, 10^2, 11^2, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.51 = AAGCCGCAGAATGTGT-1

using 646 reads

====================================================================================

graph has 232 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 263, 376]
surviving nonsolo ucounts = 2[263, 376]
ids = [3, 2]

====================================================================================

UMI info for barcode AAGCCGCAGAATGTGT-1 contig 1 = CCCCACCATG...
umi CTGCAACTAT = 255 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=521]
7-357 ==> 0-350 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=23)
388-440 ==> 0-52 on |49|IGHJ1|J-REGION| [len=52] (mis=4)
440-521 ==> 0-81 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 35 reads
cdr3 = CAGPWSSGFFATAEYFPHW at 352, score = 8 + 6
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 7, 51, 230, 313
confident = false

REJECT CONTIGS

TIG 1[bases=543]
0-20 ==> 77-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
0-20 ==> 5980-6000 on segment before IGKV3OR2-268 exon 1 [len=6000] (mis=0)
0-20 ==> 5980-6000 on rc of segment after IGKV3-7 exon 1 [len=6000] (mis=0)
0-20 ==> 5980-6000 on rc of segment after IGKV3-15 exon 1 [len=6000] (mis=0)
14-34 ==> 5730-5750 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
20-365 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=11)
369-407 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
407-543 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 371
start codons at 20, 69, 89, 225, 449
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.69 = AAGCCGCAGCTAGTCT-1

using 16339 reads

====================================================================================

graph has 6785 edges initially, 64 edges after simplification

total ucounts = 976
nonsolo ucounts = 342[2^150, 3^58, 4^27, 5^18, 6^12, 7^2, 8^2, 9^2, 10, 11^3, 12, 13, 14^2, 19^2, 22, 27, 32, 96, 110, 125, 135, 137, 138, 145, 147, 153, 166, 168, 172, 173, 184, 186, 187, 188, 192^2, 193, 196, 199, 200, 201, 207, 213, 216, 217, 221, 227, 229, 235^2, 236, 242, 243, 248, 249^2, 257, 260, 273, 276^2, 281, 282^2, 291, 305^2, 321, 359, 364, 472, 550, 559, 758, 777]
surviving nonsolo ucounts = 57[96, 110, 125, 135, 137, 138, 145, 147, 153, 166, 168, 172, 173, 184, 186, 187, 188, 192, 193, 196, 199, 200, 201, 207, 213, 216, 217, 221, 227, 229, 235^2, 236, 242, 243, 248, 249^2, 257, 260, 273, 276^2, 281, 282^2, 291, 305^2, 321, 359, 364, 472, 550, 559, 758, 777]
ids = [189, 567, 500, 665, 137, 737, 477, 794, 58, 669, ...]

====================================================================================

UMI info for barcode AAGCCGCAGCTAGTCT-1 contig 1 = GGGGGGGGTC...
umi AAACTCACAA = 248 reads: +391 validated
umi AACTGTGGAT = 195 reads: +391 validated
umi AATAAGCCTC = 185 reads: +391 validated
umi ACAACCGGGC = 153 reads: +391 validated
umi ACCACTGTTT = 204 reads: +391 validated
umi ACCTCCTGGT = 185 reads: +391 validated
umi ACTCGATGCC = 186 reads: +391 validated
umi AGGCCTGCTA = 283 reads: +391 validated
umi AGGTTGGGGC = 241 reads: +391 validated
umi ATCTTGTCAT = 165 reads: +391 validated
umi ATGGTTCCGA = 95 reads: +391 validated
umi CACCACACCC = 211 reads: +391 validated
umi CATCCTCCAA = 169 reads: +391 validated
umi CATTTAATCT = 231 reads: +391 validated
umi CCAGCGACTG = 277 reads: +391 validated
umi CCATCGGTTT = 190 reads: +391 validated
umi CCTATGCCGT = 222 reads: +391 validated
umi CGGCCTATTT = 352 reads: +391 validated
umi CTCGATTCAT = 238 reads: +391 validated
umi GACAACCCTG = 143 reads: +391 validated
umi GACAGCGTAA = 265 reads: -359X +1 -4XX +1 -11XX +3 -10XX +2 invalidated
umi GCGCAGCAAT = 254 reads: +391 validated
umi GCTGATTCTG = 198 reads: +391 validated
umi GCTGCCATTT = 201 reads: +391 validated
umi GGCATCTCAT = 293 reads: +391 validated
umi GGTCGGGTAT = 273 reads: +391 validated
umi GTCCTGTCTG = 165 reads: +391 validated
umi GTGTCATGGG = 241 reads: +391 validated
umi GTTTAGTTAA = 196 reads: +391 validated
umi TAATATGATT = 355 reads: +391 validated
umi TACCTAACAG = 135 reads: +391 validated
umi TAGTTTATCC = 217 reads: +391 validated
umi TATACCACAG = 173 reads: +391 validated
umi TCAGTCACCG = 145 reads: +391 validated
umi TGGGCTGGAA = 226 reads: +391 validated
umi TGTACGTATA = 279 reads: +391 validated
umi TTGATCCGGC = 256 reads: +391 validated
umi TTTCGTATCA = 250 reads: +391 validated

UMI info for barcode AAGCCGCAGCTAGTCT-1 contig 2 = AGCTCTGAGA...
umi AGGTATTCTG = 138 reads: +328 -100 +1 -2 +2 non-validated
umi CAACGGACTA = 253 reads: +433 validated
umi CAGGGTATCG = 237 reads: +433 validated
umi CGGGTTCTGG = 193 reads: +433 validated
umi GAGGTAAGTT = 129 reads: +417 -16 non-validated
umi GCGTTCCGCA = 114 reads: +22 -1XX +335 -27 +3 -1 +13 -1 +1 -1 +28 invalidated
umi GGCTGACGTC = 283 reads: +433 validated
umi GGTATACTGC = 206 reads: +425 -1 +5 -1 +1 non-validated
umi GTCCGATTTA = 133 reads: +428 -5 non-validated
umi TACCAATCTG = 314 reads: +433 validated
umi TAGATCATAT = 240 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=644]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=3)
42-393 ==> 0-351 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=10)
395-433 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
433-644 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 37 umis using 1232 reads
cdr3 = CCSYAGTYTHVVF at 366, score = 7 + 7
umis assigned: [1, 24, 36, 58, 74, 86, 108, 134, 140, 182] and 28 others
of which 38 are surviving nonsolos
reads assigned: 8095
start codons at 42, 181, 243, 250, 253, 349, 376, 394
confident = true

TIG 2[bases=583]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=1)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=28)
464-512 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
512-583 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 96 reads
cdr3 = CVKLTWYYAYVWGSFYFDDW at 421, score = 8 + 7
umis assigned: [137, 228, 264, 384, 500, 567, 605, 627, 665, 733] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2192
start codons at 79, 235, 382, 443
confident = true

REJECT CONTIGS

TIG 1[bases=326]
0-80 ==> 0-80 on |107|IGHV3-13|5'UTR| [len=80] (mis=0)
0-80 ==> 5920-6000 on rc of segment after IGHV3-13 exon 1 [len=6000] (mis=0)
1-83 ==> 5918-6000 on rc of segment after IGHV3-47 exon 1 [len=6000] (mis=3)
50-118 ==> 6508-6576 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=6)
80-236 ==> 0-156 on |108|IGHV3-13|L-REGION+V-REGION| [len=350] (mis=8)
255-326 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [434, 964]
of which 1 are surviving nonsolos
reads assigned: 761
start codons at 80
confident = false
did not find CDR3
now this is a cell
paired!

ATTTATTACTGTGTGAAATTGACTTGGTATTATGCCTACGTTTGGGGGAGTTTCTACTTTGACGACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGACTCCAGGCTGAGGATGAGGGTGATTATCACTGCTGCTCATATGCAGGCACCTACACTCATGTGGTATTCGGCGGAGGGACCTACCTTACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.72 = AAGCCGCAGCTTCGCG-1

using 93 reads

====================================================================================

graph has 96 edges initially, 4 edges after simplification

total ucounts = 29
nonsolo ucounts = 17[2^3, 3^2, 4^3, 5^3, 6^3, 7, 8, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.76 = AAGCCGCAGGCATTGG-1

using 626 reads

====================================================================================

graph has 186 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 621]
surviving nonsolo ucounts = 1[621]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.78 = AAGCCGCAGGCGTACA-1

using 208 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 5, 196]
surviving nonsolo ucounts = 1[196]
ids = [6]

====================================================================================

UMI info for barcode AAGCCGCAGGCGTACA-1 contig 1 = AGCTGTGGGC...
umi TTAGACTATG = 194 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=564]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
422-564 ==> 0-142 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CNSRDSSGNHVVF at 355, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 40, 159, 188, 239, 338, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.87 = AAGCCGCAGTAGGCCA-1

using 1305 reads

====================================================================================

graph has 576 edges initially, 14 edges after simplification

total ucounts = 42
nonsolo ucounts = 10[2^2, 3^3, 4, 9, 285, 306, 656]
surviving nonsolo ucounts = 3[285, 306, 656]
ids = [11, 9, 39]

====================================================================================

UMI info for barcode AAGCCGCAGTAGGCCA-1 contig 1 = GAGGGTCCTG...
umi AGTAATCCAT = 289 reads: +436 validated

UMI info for barcode AAGCCGCAGTAGGCCA-1 contig 2 = GAGAAGAGCT...
umi TGATGTTGGG = 656 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=521]
59-415 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=42)
432-495 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=8)
495-521 ==> 0-26 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARGREYASGQDYYYGMDVW at 404, score = 9 + 7
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 15, 59, 103, 282, 423, 452
confident = false

TIG 2[bases=556]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 95 reads
cdr3 = CQQYGSSPRTF at 359, score = 9 + 8
umis assigned: [39]
of which 1 are surviving nonsolos
reads assigned: 645
start codons at 35, 243, 369, 462
confident = false

REJECT CONTIGS

TIG 1[bases=489]
0-22 ==> 9-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=0)
0-22 ==> 7778-7800 on rc of segment before IGKV2-28 exon 2 [len=7800] (mis=0)
7-78 ==> 8895-8966 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=7)
7-78 ==> 8904-8975 on rc of segment before IGKV2OR2-10 exon 1 [len=9109] (mis=7)
7-78 ==> 8903-8974 on segment before IGKV1OR2-11 exon 1 [len=9108] (mis=7)
22-75 ==> 0-53 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=0)
75-316 ==> 110-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=7)
315-353 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
353-489 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQKYNIAPRTF at 292, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 301
start codons at 22, 28, 176, 275, 395
confident = false
not full
full length transcript of length 489
VJ delta = 71
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.88 = AAGCCGCAGTAGTGCG-1

using 197 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 6[2^2, 3^3, 173]
surviving nonsolo ucounts = 1[173]
ids = [4]

====================================================================================

UMI info for barcode AAGCCGCAGTAGTGCG-1 contig 1 = GAAGAGCTGC...
umi ACCTGCCACA = 168 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=490]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-369 ==> 0-336 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-490 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQYRNSITF at 357, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 33, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.89 = AAGCCGCAGTATCTCG-1

using 7732 reads

====================================================================================

graph has 3732 edges initially, 54 edges after simplification

total ucounts = 913
nonsolo ucounts = 294[2^138, 3^52, 4^34, 5^18, 6^4, 7^7, 8^3, 9^5, 10, 11^4, 13, 16, 17^2, 40, 96, 134, 138, 156, 165, 170, 172, 173, 228, 232, 264, 269, 277, 312, 315, 316, 332, 347, 352, 386, 407, 412, 502]
surviving nonsolo ucounts = 19[165, 170, 172, 173, 228, 232, 264, 269, 277, 312, 315, 316, 332, 347, 352, 386, 407, 412, 502]
ids = [316, 690, 702, 785, 735, 541, 121, 200, 209, 359, ...]

====================================================================================

UMI info for barcode AAGCCGCAGTATCTCG-1 contig 1 = GGAGAAGAGC...
umi ACGGCAACCC = 322 reads: +388 validated
umi ACTCCACTTC = 261 reads: +388 validated
umi ATTACACGCC = 265 reads: +388 validated
umi CCTCCTCTTC = 404 reads: +388 validated
umi CGGATTACCC = 313 reads: +388 validated
umi CGGGGCGCTG = 396 reads: +49 -1XX +1 -3XX +1 -2XX +1 -6XX +1 -4XX +1 -2XX +1 -1X +2 -10X +1 -3XX +2 -4XX +1 -1XX +1 -3XX +286 invalidated
umi GCATACATGT = 350 reads: +388 validated
umi GCGTTTCGGG = 232 reads: +388 validated
umi GTCTTTCCTT = 422 reads: +49 -1XX +1 -3XX +1 -2XX +1 -6XX +1 -4XX +1 -2XX +1 -1XX +1 -11X +1 -3XX +2 -4XX +1 -1XX +1 -3XX +286 invalidated
umi GTTCTGCTCA = 318 reads: +388 validated
umi TAACGTCCCA = 515 reads: +49 -1XX +1 -3XX +1 -2XX +1 -6XX +1 -4XX +1 -2X +1 -13X +1 -3XX +2 -4XX +1 -1XX +1 -3XX +286 invalidated
umi TACCGCTTGT = 174 reads: +388 validated
umi TAGTATCGGA = 172 reads: +388 validated
umi TCCACAACTT = 232 reads: +388 validated
umi TCTAGATCCT = 335 reads: +20 -1XX +367 invalidated
umi TCTTTTGAAC = 180 reads: +388 validated
umi TGGCAGCGCT = 353 reads: +388 validated
umi TGTTACGCCC = 6 reads: -17X +1 -2XX +1 -2XX +3 -5XX +1 -2XX +2 -1XX +1 -5XX +2 -1XX +32 -310 invalidated

UMI info for barcode AAGCCGCAGTATCTCG-1 contig 2 = AGCTCTGAGA...
umi ATTCGGAAGG = 275 reads: +415 validated
umi CCGGCGGTTA = 166 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=560]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=13)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 17 umis using 895 reads
cdr3 = CQQYGISPRYTF at 360, score = 9 + 8
umis assigned: [110, 121, 200, 324, 359, 367, 505, 541, 634, 658] and 8 others
of which 17 are surviving nonsolos
reads assigned: 5125
start codons at 36, 244, 370, 466
confident = true

TIG 2[bases=595]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=1)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=25)
450-494 ==> 19-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
494-595 ==> 0-101 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 34 reads
cdr3 = CAKKSGWLSAMDVW at 421, score = 8 + 7
umis assigned: [209, 316]
of which 2 are surviving nonsolos
reads assigned: 435
start codons at 79, 230, 235, 296, 382, 451, 548
confident = true
now this is a cell
paired!

AGAGGCGAGGACACGGCCGTATACTACTGTGCGAAAAAGTCCGGGTGGTTAAGTGCTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> AGCAAACTGGAACCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTATCTCACCTCGGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAGC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.102 = AAGCCGCCAACTGCTA-1

using 700 reads

====================================================================================

graph has 320 edges initially, 2 edges after simplification

total ucounts = 25
nonsolo ucounts = 7[2^5, 211, 461]
surviving nonsolo ucounts = 2[211, 461]
ids = [13, 1]

====================================================================================

UMI info for barcode AAGCCGCCAACTGCTA-1 contig 1 = ACCCAAAAAC...
umi ACAAGGCCTG = 444 reads: +436 validated
umi GCATGTACTC = 203 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=520]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-520 ==> 0-30 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 52 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [1, 13]
of which 2 are surviving nonsolos
reads assigned: 631
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.109 = AAGCCGCCACAAGCCC-1

using 151 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[150]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.111 = AAGCCGCCACACGCTG-1

using 1343 reads

====================================================================================

graph has 1302 edges initially, 18 edges after simplification

total ucounts = 804
nonsolo ucounts = 250[2^146, 3^43, 4^25, 5^13, 6^8, 7^5, 8, 9^2, 11^3, 12, 14, 16, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.112 = AAGCCGCCACAGACAG-1

using 386 reads

====================================================================================

graph has 202 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 5[2^2, 3, 7, 362]
surviving nonsolo ucounts = 1[362]
ids = [5]

====================================================================================

UMI info for barcode AAGCCGCCACAGACAG-1 contig 1 = GGGAGGAGTC...
umi ATTACCGCGC = 342 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=493]
30-383 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
421-493 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQSYSTLALTF at 357, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 30, 36, 92, 105, 241, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.113 = AAGCCGCCACCAGATT-1

using 77 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^5, 61]
surviving nonsolo ucounts = 1[61]
ids = [9]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.116 = AAGCCGCCACGAGGTA-1

using 318 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 312]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.118 = AAGCCGCCACTAAGTC-1

using 294 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[294]
surviving nonsolo ucounts = 1[294]
ids = [0]

====================================================================================

UMI info for barcode AAGCCGCCACTAAGTC-1 contig 1 = GCTCTGCTTC...
umi CTTGGCAGGC = 275 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=575]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=0)
407-445 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
445-575 ==> 0-130 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQSYDSSLSGSVVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.123 = AAGCCGCCAGACACTT-1

using 469 reads

====================================================================================

graph has 170 edges initially, 6 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[212, 257]
surviving nonsolo ucounts = 2[212, 257]
ids = [0, 1]

====================================================================================

UMI info for barcode AAGCCGCCAGACACTT-1 contig 1 = GCTGGGGTCA...
umi CCTCAGTGGA = 210 reads: +385 validated
umi TAGGTGAGTT = 254 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=545]
0-41 ==> 121-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
41-381 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
398-426 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
426-545 ==> 0-119 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 2 umis using 79 reads
cdr3 = CFSYGTSGRTF at 365, score = 8 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 455
start codons at 41, 249, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.133 = AAGCCGCCATCAGTAC-1

using 796 reads

====================================================================================

graph has 282 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 2[3, 784]
surviving nonsolo ucounts = 1[784]
ids = [1]

====================================================================================

UMI info for barcode AAGCCGCCATCAGTAC-1 contig 1 = CCATGGAAGC...
umi AGCCGTCATA = 782 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=517]
2-347 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
344-381 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
381-517 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 113 reads
cdr3 = CQQRSNWLTF at 323, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 764
start codons at 2, 207, 210, 423
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.136 = AAGCCGCCATCGTCGG-1

using 104 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 40
nonsolo ucounts = 23[2^7, 3^4, 4^6, 5^2, 6^3, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.140 = AAGCCGCCATGCTGGC-1

using 294 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 1[285]
surviving nonsolo ucounts = 1[285]
ids = [1]

====================================================================================

UMI info for barcode AAGCCGCCATGCTGGC-1 contig 1 = GCTCTGCTTC...
umi CCTTTCCAGG = 274 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=559]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-559 ==> 0-117 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.142 = AAGCCGCCATTCTCAT-1

using 391 reads

====================================================================================

graph has 168 edges initially, 4 edges after simplification

total ucounts = 16
nonsolo ucounts = 11[2^3, 3, 4, 6^2, 8^2, 9, 336]
surviving nonsolo ucounts = 1[336]
ids = [13]

====================================================================================

UMI info for barcode AAGCCGCCATTCTCAT-1 contig 1 = AATCAGTCCC...
umi TGCGGCTGGT = 338 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 3-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
24-375 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CLQYSSSPWTF at 351, score = 9 + 8
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 332
start codons at 24, 30, 99, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.145 = AAGCCGCGTAAGGGAA-1

using 35 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2^3, 4, 7, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.146 = AAGCCGCGTAATCGTC-1

using 588 reads

====================================================================================

graph has 176 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 8, 281, 293]
surviving nonsolo ucounts = 2[281, 293]
ids = [0, 5]

====================================================================================

UMI info for barcode AAGCCGCGTAATCGTC-1 contig 1 = TGAGCGCAGA...
umi TACGCAGCAC = 294 reads: +388 validated

UMI info for barcode AAGCCGCGTAATCGTC-1 contig 2 = GGAGAAGAGC...
umi AAAGGCGCAA = 269 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=635]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 36, 241, 365
confident = false

TIG 2[bases=513]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
421-513 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYGSSPLTF at 360, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 36, 244, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.147 = AAGCCGCGTACACCGC-1

using 30 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 9, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.148 = AAGCCGCGTACGAAAT-1

using 12 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.152 = AAGCCGCGTCAAAGAT-1

using 242 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 234]
surviving nonsolo ucounts = 1[234]
ids = [2]

====================================================================================

UMI info for barcode AAGCCGCGTCAAAGAT-1 contig 1 = GGAGGAACTG...
umi CACCGCGCTT = 1 reads: +3 -1 +3 -1 +1 -1 +1 -1 +1 -1 +9 -1 +2 -1 +12 -1 +1 -2X +1 -3X +9 -326 invalidated
umi CCCCGCGGTT = 185 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=442]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-442 ==> 0-26 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQRSNWPWTF at 355, score = 9 + 8
umis assigned: [1, 2]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 34, 239, 242
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.156 = AAGCCGCGTCCAGTTA-1

using 1076 reads

====================================================================================

graph has 816 edges initially, 12 edges after simplification

total ucounts = 666
nonsolo ucounts = 188[2^101, 3^52, 4^13, 5^5, 6^4, 7^3, 8^2, 10, 11^3, 13^2, 15, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.159 = AAGCCGCGTCCTCCAT-1

using 135 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 132]
surviving nonsolo ucounts = 1[132]
ids = [0]

====================================================================================

UMI info for barcode AAGCCGCGTCCTCCAT-1 contig 1 = TAGGACCCAG...
umi CGATGTGGGT = 118 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=478]
18-363 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
360-397 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
397-478 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQQRSNWPTF at 339, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 118
start codons at 18, 223, 226, 439
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.160 = AAGCCGCGTCGAACAG-1

using 28 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[26]
surviving nonsolo ucounts = 1[26]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.165 = AAGCCGCGTCTCACCT-1

using 109 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[109]
surviving nonsolo ucounts = 1[109]
ids = [0]

====================================================================================

UMI info for barcode AAGCCGCGTCTCACCT-1 contig 1 = GGGTGCTTTC...
umi GATTCGTCAT = 111 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=489]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=42)
403-466 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=6)
466-489 ==> 0-23 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CTRGLRLRYVHYYYGMDVW at 378, score = 9 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 107
start codons at 18, 39, 83, 233, 253, 342, 403, 418, 423
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.174 = AAGCCGCGTTATCACG-1

using 43 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 27
nonsolo ucounts = 9[2^6, 4^2, 5]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.179 = AAGCCGCGTTGCGCAC-1

using 34 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[5, 21]
surviving nonsolo ucounts = 1[21]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.182 = AAGCCGCTCAACGAAA-1

using 311 reads

====================================================================================

graph has 110 edges initially, 4 edges after simplification

total ucounts = 18
nonsolo ucounts = 7[2^4, 3, 33, 256]
surviving nonsolo ucounts = 2[33, 256]
ids = [13, 7]

====================================================================================

UMI info for barcode AAGCCGCTCAACGAAA-1 contig 1 = AGTGACTCCT...
umi CTTATTTCCG = 252 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=536]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
403-453 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
453-536 ==> 0-83 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 45 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 365, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 20, 64, 243, 246, 249, 335, 405
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.184 = AAGCCGCTCAACTCTT-1

using 518 reads

====================================================================================

graph has 208 edges initially, 4 edges after simplification

total ucounts = 18
nonsolo ucounts = 6[2^3, 3, 218, 279]
surviving nonsolo ucounts = 2[218, 279]
ids = [6, 3]

====================================================================================

UMI info for barcode AAGCCGCTCAACTCTT-1 contig 1 = GCTCTGCTTC...
umi GGGCCGATCA = 213 reads: +394 validated

UMI info for barcode AAGCCGCTCAACTCTT-1 contig 2 = ACAACAGGCA...
umi CGTTTCTCGC = 258 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=564]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-564 ==> 0-119 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false

TIG 2[bases=442]
0-25 ==> 150-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
25-388 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=10)
386-425 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
junction support: 1 umis using 41 reads
cdr3 = CQQYYSTPRSF at 364, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 25, 94, 238, 290, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.188 = AAGCCGCTCATGCATG-1

using 53 reads

====================================================================================

graph has 48 edges initially, 4 edges after simplification

total ucounts = 17
nonsolo ucounts = 6[2^4, 3, 31]
surviving nonsolo ucounts = 1[31]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.191 = AAGCCGCTCCCGGATG-1

using 27 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2^3, 5, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.198 = AAGCCGCTCGCATGAT-1

using 605 reads

====================================================================================

graph has 184 edges initially, 6 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2, 4, 5, 242, 344]
surviving nonsolo ucounts = 2[242, 344]
ids = [12, 8]

====================================================================================

UMI info for barcode AAGCCGCTCGCATGAT-1 contig 1 = ATCAGTCCCA...
umi GGTCTTCTTT = 343 reads: +388 validated

UMI info for barcode AAGCCGCTCGCATGAT-1 contig 2 = TGGGGACTGA...
umi TTCTACTCGT = 245 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 338
start codons at 23, 29, 98, 234, 453
confident = false

TIG 2[bases=574]
38-398 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=2)
401-438 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
438-574 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CMQGTHWLALTF at 374, score = 9 + 9
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 38, 71, 99, 107, 195, 357, 377, 480
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.201 = AAGCCGCTCGCTAGCG-1

using 193 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[5, 183]
surviving nonsolo ucounts = 1[183]
ids = [5]

====================================================================================

UMI info for barcode AAGCCGCTCGCTAGCG-1 contig 1 = ACATGGGAAG...
umi TCATGATTAG = 182 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=535]
0-25 ==> 6-31 on |185|IGHV4-34|5'UTR| [len=31] (mis=0)
25-396 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=16)
434-464 ==> 16-46 on |54|IGHJ4|J-REGION| [len=46] (mis=1)
464-535 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARGSARSPTVILDYW at 385, score = 9 + 6
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 2, 25, 46, 90, 176
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.202 = AAGCCGCTCGGCTACG-1

using 364 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 5, 351]
surviving nonsolo ucounts = 1[351]
ids = [0]

====================================================================================

UMI info for barcode AAGCCGCTCGGCTACG-1 contig 1 = GAAGAGCTGC...
umi AAAGGCATGT = 314 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=479]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-479 ==> 0-58 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYGSSPMYTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 33, 82, 241, 340, 381, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.217 = AAGGAGCAGAAGCCCA-1

using 39 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[37]
surviving nonsolo ucounts = 1[37]
ids = [1]

====================================================================================

UMI info for barcode AAGGAGCAGAAGCCCA-1 contig 1 = TCAGGACACA...
umi GCTTGCATTA = 34 reads: +386 -1 +1 non-validated

GOOD CONTIGS

TIG 1[bases=425]
12-363 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
362-400 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
400-425 ==> 0-25 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 8 reads
cdr3 = CLQYSSSPWTF at 339, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 32
start codons at 12, 18, 87, 223
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.220 = AAGGAGCAGACAATAC-1

using 148 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[148]
surviving nonsolo ucounts = 1[148]
ids = [0]

====================================================================================

UMI info for barcode AAGGAGCAGACAATAC-1 contig 1 = GGGGTCACAA...
umi TTGGTTAGCC = 143 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=6)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
426-554 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CCSYAVSSTWVF at 362, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 142
start codons at 38, 177, 239, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.226 = AAGGAGCAGAGCTATA-1

using 5169 reads

====================================================================================

graph has 4896 edges initially, 76 edges after simplification

total ucounts = 911
nonsolo ucounts = 691[2^88, 3^82, 4^90, 5^67, 6^54, 7^47, 8^46, 9^32, 10^36, 11^30, 12^21, 13^17, 14^27, 15^11, 16^14, 17^5, 18^6, 19^5, 20^5, 21, 23, 24^3, 25, 27, 37]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.229 = AAGGAGCAGATCACGG-1

using 515 reads

====================================================================================

graph has 200 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[513]
surviving nonsolo ucounts = 1[513]
ids = [2]

====================================================================================

UMI info for barcode AAGGAGCAGATCACGG-1 contig 1 = ATCCAACAAC...
umi TTTGCTCCAC = 511 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=602]
0-55 ==> 249-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
55-408 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=28)
401-428 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=6)
429-479 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
479-602 ==> 0-123 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 60 reads
cdr3 = CARIMVRGVIMAPFDIW at 397, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 502
start codons at 55, 142, 253, 319, 352, 382, 409, 427
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.234 = AAGGAGCAGCAGACTG-1

using 172 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 169]
surviving nonsolo ucounts = 1[169]
ids = [0]

====================================================================================

UMI info for barcode AAGGAGCAGCAGACTG-1 contig 1 = GTCTCAGTCA...
umi ATTCACTTCT = 166 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=546]
0-19 ==> 4-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
19-372 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
372-410 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQSYSTPGITF at 346, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 19, 25, 81, 94, 230, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.239 = AAGGAGCAGCTAAGAT-1

using 272 reads

====================================================================================

graph has 146 edges initially, 6 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[7, 30, 234]
surviving nonsolo ucounts = 2[30, 234]
ids = [1, 3]

====================================================================================

UMI info for barcode AAGGAGCAGCTAAGAT-1 contig 1 = GTCAGACCCA...
umi TCGTGGCCCG = 216 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=452]
0-23 ==> 24-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=0)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-452 ==> 0-41 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQQANSFPLTF at 350, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 23, 29, 85, 98, 234
confident = false

REJECT CONTIGS

TIG 1[bases=394]
0-283 ==> 32-315 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=8)
316-353 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
353-394 ==> 0-41 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQANSFPLTF at 292, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 26
start codons at 176
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.245 = AAGGAGCAGGAATTAC-1

using 14 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.259 = AAGGAGCAGTGTTGAA-1

using 20 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.272 = AAGGAGCCACCACGTG-1

using 799 reads

====================================================================================

graph has 1194 edges initially, 2 edges after simplification

total ucounts = 425
nonsolo ucounts = 156[2^67, 3^37, 4^19, 5^13, 6^8, 7^7, 8^2, 9, 11^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.274 = AAGGAGCCACCCATTC-1

using 288 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[288]
surviving nonsolo ucounts = 1[288]
ids = [0]

====================================================================================

UMI info for barcode AAGGAGCCACCCATTC-1 contig 1 = GAGGAATCAG...
umi ACAAACCGCT = 271 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=499]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-499 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.275 = AAGGAGCCACCCTATC-1

using 265 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[261]
surviving nonsolo ucounts = 1[261]
ids = [2]

====================================================================================

UMI info for barcode AAGGAGCCACCCTATC-1 contig 1 = GAAGAGCTGC...
umi TACTGGAGCG = 247 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=507]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-507 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQYGSSPPWSF at 357, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 33, 241, 367, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.284 = AAGGAGCCAGCTCCGA-1

using 519 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[4, 6, 504]
surviving nonsolo ucounts = 1[504]
ids = [4]

====================================================================================

UMI info for barcode AAGGAGCCAGCTCCGA-1 contig 1 = GAAGAGCTGC...
umi TCATCTGATG = 468 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=512]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-512 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYGSSPWTF at 357, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 462
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.288 = AAGGAGCCAGGTTTCA-1

using 18 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[6, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.289 = AAGGAGCCAGTAACGG-1

using 201 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[4, 5, 187]
surviving nonsolo ucounts = 1[187]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=480]
0-75 ==> 5533-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=9)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
420-480 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWGFLLHASSTNSF at 350, score = 4 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 30, 63, 99, 187, 349, 369, 462
confident = false
not full
frameshifted full length transcript of length 480
VJ delta = 29
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.298 = AAGGAGCCATCTATGG-1

using 581 reads

====================================================================================

graph has 206 edges initially, 18 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[7, 248, 324]
surviving nonsolo ucounts = 2[248, 324]
ids = [3, 0]

====================================================================================

UMI info for barcode AAGGAGCCATCTATGG-1 contig 1 = GGGATCTCAG...
umi ATATTCGAGT = 323 reads: +391 validated

UMI info for barcode AAGGAGCCATCTATGG-1 contig 2 = GGGCACAAGA...
umi GCCTGATCGT = 235 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=595]
38-376 ==> 0-338 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=16)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=5)
429-595 ==> 0-166 on |306|IGLC2|C-REGION| [len=317] (mis=5)
junction support: 1 umis using 54 reads
cdr3 = CSSYTNSTTPGVF at 362, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 38, 174, 246
confident = false

TIG 2[bases=592]
0-35 ==> 16-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
35-391 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
426-592 ==> 0-166 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQSYDTSLSGSVF at 359, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 35, 189, 192, 243, 342, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.301 = AAGGAGCCATTGCGGC-1

using 353 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[352]
surviving nonsolo ucounts = 1[352]
ids = [0]

====================================================================================

UMI info for barcode AAGGAGCCATTGCGGC-1 contig 1 = GAGCTGCTCA...
umi CCACGTATTC = 325 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=497]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
418-497 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQYGSSPMYTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 30, 79, 238, 337, 378, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.307 = AAGGAGCGTACGAAAT-1

using 430 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 426]
surviving nonsolo ucounts = 1[426]
ids = [1]

====================================================================================

UMI info for barcode AAGGAGCGTACGAAAT-1 contig 1 = GGGAGGAATC...
umi ACAAGTTCAG = 431 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
30-381 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 77 reads
cdr3 = CLQYSSSPWTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 421
start codons at 30, 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.308 = AAGGAGCGTACGCTGC-1

using 4372 reads

====================================================================================

graph has 2236 edges initially, 60 edges after simplification

total ucounts = 331
nonsolo ucounts = 144[2^61, 3^33, 4^15, 5^5, 6, 7^4, 8^4, 9, 11, 14^2, 109, 113, 128, 137, 149, 154^2, 160, 182, 197, 203, 209, 233, 255, 266, 542, 574]
surviving nonsolo ucounts = 17[109, 113, 128, 137, 149, 154^2, 160, 182, 197, 203, 209, 233, 255, 266, 542, 574]
ids = [56, 1, 79, 261, 64, 17, 69, 150, 14, 152, ...]

====================================================================================

UMI info for barcode AAGGAGCGTACGCTGC-1 contig 1 = GGGGACTCAA...
umi AACGCTTTTC = 261 reads: +403 validated
umi AATGTGGGCA = 156 reads: +386 -2 +1 -14 non-validated
umi ATCACATTAC = 102 reads: +403 validated
umi ATTCATGGGG = 152 reads: +403 validated
umi GACGCTTCCT = 161 reads: +403 validated
umi GACTATGGGC = 197 reads: +403 validated
umi GATAACTCCG = 207 reads: +403 validated
umi TATCCGCTTC = 182 reads: +394 -9 non-validated
umi TCCACACTCC = 191 reads: +403 validated
umi TTTTTGACTT = 246 reads: +403 validated

UMI info for barcode AAGGAGCGTACGCTGC-1 contig 2 = AGCTTCAGCT...
umi AAAGGCGTGA = 114 reads: +388 validated
umi AATGCACAGC = 181 reads: +388 validated
umi ATCTATGTGT = 299 reads: -349X +1 -1X +1 -1X +3 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi ATGGATATCG = 145 reads: +388 validated
umi CAGCAACCAG = 127 reads: +388 validated
umi TCTGGCACTA = 137 reads: +388 validated
umi TGGTCTCCGC = 358 reads: -346X +1 -2X +1 -1X +1 -2X +2 -1X +5 -4XX +9 -1XX +1 -1XX +10 invalidated

GOOD CONTIGS

TIG 1[bases=533]
59-412 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=2)
414-462 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
462-533 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 171 reads
cdr3 = CARQGDFDYW at 401, score = 9 + 7
umis assigned: [6, 17, 56, 69, 150, 152, 155, 228, 245, 330]
of which 10 are surviving nonsolos
reads assigned: 1806
start codons at 59, 210, 257, 262, 266, 294, 323, 356
confident = true

TIG 2[bases=609]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=3)
397-435 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
435-609 ==> 0-174 on |305|IGLC1|C-REGION| [len=317] (mis=3)
junction support: 5 umis using 106 reads
cdr3 = CAAWDDSLNGGVF at 368, score = 8 + 8
umis assigned: [1, 14, 59, 64, 79, 261, 279]
of which 7 are surviving nonsolos
reads assigned: 1312
start codons at 47, 351, 376, 381, 393
confident = true
now this is a cell
paired!

CTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGACAGGGGGACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAATGGGGGGGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.318 = AAGGAGCGTTACCGAT-1

using 126 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[17, 102]
surviving nonsolo ucounts = 2[17, 102]
ids = [7, 6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.321 = AAGGAGCGTTTGGCGC-1

using 396 reads

====================================================================================

graph has 135 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[4^2, 6, 380]
surviving nonsolo ucounts = 1[380]
ids = [5]

====================================================================================

UMI info for barcode AAGGAGCGTTTGGCGC-1 contig 1 = GGGAGAGCCC...
umi TCACATAGCA = 358 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=500]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
391-429 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
429-500 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQRSNWPRTF at 368, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 349
start codons at 47, 252, 255, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.322 = AAGGAGCTCACAACGT-1

using 207 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[4^2, 196]
surviving nonsolo ucounts = 1[196]
ids = [4]

====================================================================================

UMI info for barcode AAGGAGCTCACAACGT-1 contig 1 = AGCTGTGGGC...
umi TCGCGCATGC = 194 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=547]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
422-547 ==> 0-125 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CNSRDSSGNHVVF at 355, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 40, 159, 188, 239, 338, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.331 = AAGGAGCTCCGTAGTA-1

using 342 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 335]
surviving nonsolo ucounts = 1[335]
ids = [1]

====================================================================================

UMI info for barcode AAGGAGCTCCGTAGTA-1 contig 1 = AGGAGTCAGA...
umi GACACGTGTC = 326 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=471]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=0)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
415-471 ==> 0-56 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQANSFPPTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.332 = AAGGAGCTCCGTCAAA-1

using 251 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2^2, 242]
surviving nonsolo ucounts = 1[242]
ids = [7]

====================================================================================

UMI info for barcode AAGGAGCTCCGTCAAA-1 contig 1 = TGAGCGCAGA...
umi TTCACACCGT = 238 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=500]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=3)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
424-500 ==> 0-76 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CGTWDSSLSAVVF at 357, score = 7 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.333 = AAGGAGCTCCTGCAGG-1

using 280 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[276]
surviving nonsolo ucounts = 1[276]
ids = [3]

====================================================================================

UMI info for barcode AAGGAGCTCCTGCAGG-1 contig 1 = GGGAATCAGT...
umi GCGAGTGTAT = 259 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-505 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.334 = AAGGAGCTCGATAGAA-1

using 681 reads

====================================================================================

graph has 238 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 8[2^3, 4^2, 191, 231, 242]
surviving nonsolo ucounts = 3[191, 231, 242]
ids = [7, 6, 5]

====================================================================================

UMI info for barcode AAGGAGCTCGATAGAA-1 contig 1 = GGAGTCAGAC...
umi GCCCAGTGCT = 237 reads: +385 validated

UMI info for barcode AAGGAGCTCGATAGAA-1 contig 2 = GCTGTGCTGT...
umi GTAGTTATAT = 228 reads: +382 validated
umi TTACCACCTG = 192 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=547]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=25)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CHQYNSYSTF at 353, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 26, 32, 88, 101, 237, 240, 333, 453
confident = true

TIG 2[bases=579]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
425-579 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 45 reads
cdr3 = CQSADSSGTYVVF at 358, score = 8 + 8
umis assigned: [6, 7]
of which 2 are surviving nonsolos
reads assigned: 414
start codons at 43, 104, 173, 191, 386
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.349 = AAGGAGCTCTTACCGC-1

using 289 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 285]
surviving nonsolo ucounts = 1[285]
ids = [2]

====================================================================================

UMI info for barcode AAGGAGCTCTTACCGC-1 contig 1 = GATCAGGACT...
umi TACTCGCATT = 274 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=513]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-513 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.355 = AAGGCAGAGACCCACC-1

using 314 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 3^2, 4, 5, 292]
surviving nonsolo ucounts = 1[292]
ids = [8]

====================================================================================

UMI info for barcode AAGGCAGAGACCCACC-1 contig 1 = GGGGGACTCC...
umi TCCAGGGCAT = 277 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=558]
21-372 ==> 0-351 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=26)
391-439 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
439-558 ==> 0-119 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 38 reads
cdr3 = CAVSSRADGYFDSW at 366, score = 7 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 21, 65, 247, 327, 336
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.377 = AAGGCAGAGGGATGGG-1

using 284 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[5, 6, 8, 264]
surviving nonsolo ucounts = 1[264]
ids = [3]

====================================================================================

UMI info for barcode AAGGCAGAGGGATGGG-1 contig 1 = CACAAGAGGC...
umi GCATAGATAC = 257 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=585]
0-33 ==> 129-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
33-373 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=33)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
424-585 ==> 0-161 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 36 reads
cdr3 = CCSYGGWSALVLF at 357, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 33, 184, 241, 367
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.381 = AAGGCAGAGTGATCGG-1

using 308 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[303]
surviving nonsolo ucounts = 1[303]
ids = [2]

====================================================================================

UMI info for barcode AAGGCAGAGTGATCGG-1 contig 1 = TGGGGAGGAA...
umi AGGGCTCAGT = 284 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=516]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-516 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 44 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.386 = AAGGCAGCAACGATCT-1

using 392 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[391]
surviving nonsolo ucounts = 1[391]
ids = [0]

====================================================================================

UMI info for barcode AAGGCAGCAACGATCT-1 contig 1 = GAAGAGCTGC...
umi ATTTGCGAAC = 360 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-505 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQYGSSPMYTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 355
start codons at 33, 82, 241, 340, 381, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.387 = AAGGCAGCAACTGGCC-1

using 287 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[3, 5^2, 7, 266]
surviving nonsolo ucounts = 1[266]
ids = [4]

====================================================================================

UMI info for barcode AAGGCAGCAACTGGCC-1 contig 1 = AGCTTCAGCT...
umi TTGTATGTAT = 259 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=569]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=6)
390-428 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
428-569 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CAAWDDSLSVF at 367, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.393 = AAGGCAGCAAGTTCTG-1

using 230 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 4, 219]
surviving nonsolo ucounts = 1[219]
ids = [1]

====================================================================================

UMI info for barcode AAGGCAGCAAGTTCTG-1 contig 1 = GAGAAGAGCT...
umi ACTGCAATCT = 193 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=465]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-350 ==> 0-315 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
420-465 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQYYGGSYWTF at 359, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 35, 160, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.395 = AAGGCAGCAATGGACG-1

using 86 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 21
nonsolo ucounts = 16[2^5, 3^2, 4^2, 5, 6^2, 8^2, 9, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.402 = AAGGCAGCACCCAGTG-1

using 380 reads

====================================================================================

graph has 216 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[63, 314]
surviving nonsolo ucounts = 2[63, 314]
ids = [3, 1]

====================================================================================

UMI info for barcode AAGGCAGCACCCAGTG-1 contig 1 = GGGAATCAGT...
umi TAGGATTGTC = 282 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=501]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-501 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.407 = AAGGCAGCAGACACTT-1

using 290 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[290]
surviving nonsolo ucounts = 1[290]
ids = [0]

====================================================================================

UMI info for barcode AAGGCAGCAGACACTT-1 contig 1 = ACAAGAGGCA...
umi CTCATAGGGA = 278 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=580]
0-32 ==> 130-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
32-372 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
389-417 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
417-580 ==> 0-163 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 46 reads
cdr3 = CFSYGTSGRTF at 356, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 32, 240, 366
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.414 = AAGGCAGCAGCCTTGG-1

using 249 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[249]
surviving nonsolo ucounts = 1[249]
ids = [0]

====================================================================================

UMI info for barcode AAGGCAGCAGCCTTGG-1 contig 1 = GGGGGCTGGG...
umi TTCTAGCGTG = 246 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=585]
45-389 ==> 0-344 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=20)
395-433 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
433-585 ==> 0-152 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CSSYISSTTLGF at 369, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 45, 253, 256, 565
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.426 = AAGGCAGCATATACGC-1

using 298 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 294]
surviving nonsolo ucounts = 1[294]
ids = [0]

====================================================================================

UMI info for barcode AAGGCAGCATATACGC-1 contig 1 = GGAGAAGAGC...
umi CGATGGTTTT = 270 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=490]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-373 ==> 0-337 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=12)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-490 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYDRSWTF at 360, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 36, 370, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.430 = AAGGCAGCATCTCCCA-1

using 713 reads

====================================================================================

graph has 228 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[711]
surviving nonsolo ucounts = 1[711]
ids = [2]

====================================================================================

UMI info for barcode AAGGCAGCATCTCCCA-1 contig 1 = TGGGGAGGAA...
umi GACTCATCCT = 671 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=512]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=6)
382-420 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
420-512 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 101 reads
cdr3 = CLQHKSYPFTF at 359, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 664
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.435 = AAGGCAGGTAAGAGGA-1

using 47 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[10, 34]
surviving nonsolo ucounts = 2[10, 34]
ids = [2, 0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.437 = AAGGCAGGTAAGTAGT-1

using 135 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 9[2, 3^2, 4, 5, 8^2, 10, 90]
surviving nonsolo ucounts = 1[90]
ids = [8]

====================================================================================

UMI info for barcode AAGGCAGGTAAGTAGT-1 contig 1 = GAGTCAGACC...
umi TCCGCCTATG = 85 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=447]
0-31 ==> 22-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=2)
31-348 ==> 0-317 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=18)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
413-447 ==> 0-34 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CQQANSFPPTF at 352, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 84
start codons at 31, 87, 100, 236
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.447 = AAGGCAGGTATCTGCA-1

using 286 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 7, 275]
surviving nonsolo ucounts = 1[275]
ids = [2]

====================================================================================

UMI info for barcode AAGGCAGGTATCTGCA-1 contig 1 = AGAGCTCTGG...
umi GTACAATCGC = 241 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=453]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
388-426 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
426-453 ==> 0-27 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYNNWPWTF at 365, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 44, 113, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.457 = AAGGCAGGTCTAAAGA-1

using 207 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 200]
surviving nonsolo ucounts = 1[200]
ids = [2]

====================================================================================

UMI info for barcode AAGGCAGGTCTAAAGA-1 contig 1 = GAGGAACTGC...
umi CAGGCAACGC = 180 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=499]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=13)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
421-499 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQRSNWPPVYTF at 354, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 175
start codons at 33, 238, 241, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.480 = AAGGCAGTCAACGGCC-1

using 1297 reads

====================================================================================

graph has 1020 edges initially, 12 edges after simplification

total ucounts = 389
nonsolo ucounts = 173[2^72, 3^36, 4^25, 5^12, 6^8, 7^4, 8^2, 9^4, 10^2, 11^2, 12, 13, 14, 21, 106, 333]
surviving nonsolo ucounts = 2[106, 333]
ids = [362, 151]

====================================================================================

UMI info for barcode AAGGCAGTCAACGGCC-1 contig 1 = GAGTCAGTCT...
umi CGCGTACTGC = 328 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQSYTTLLTF at 352, score = 9 + 9
umis assigned: [151]
of which 1 are surviving nonsolos
reads assigned: 325
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.488 = AAGGCAGTCCCGACTT-1

using 1305 reads

====================================================================================

graph has 1400 edges initially, 4 edges after simplification

total ucounts = 413
nonsolo ucounts = 142[2^62, 3^30, 4^18, 5^9, 6^4, 7^2, 8^3, 9^5, 10^3, 11, 12, 13^2, 27, 490]
surviving nonsolo ucounts = 1[490]
ids = [235]

====================================================================================

REJECT CONTIGS

TIG 1[bases=449]
1-270 ==> 82-351 on |211|IGHV7-81|L-REGION+V-REGION| [len=351] (mis=0)
284-347 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
347-449 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [235]
of which 1 are surviving nonsolos
reads assigned: 482
start codons at 1, 70, 75, 117, 122, 154, 189, 246, 252, 304, 365, 426
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.491 = AAGGCAGTCCGCGGTA-1

using 5141 reads

====================================================================================

graph has 2638 edges initially, 38 edges after simplification

total ucounts = 501
nonsolo ucounts = 210[2^83, 3^48, 4^22, 5^14, 6^10, 7^6, 8^4, 9^2, 11^3, 12, 18, 21, 82, 149, 194, 200, 208, 226, 237, 249, 254, 280, 284, 302, 322, 343, 816]
surviving nonsolo ucounts = 14[149, 194, 200, 208, 226, 237, 249, 254, 280, 284, 302, 322, 343, 816]
ids = [385, 44, 403, 245, 86, 323, 134, 153, 485, 382, ...]

====================================================================================

UMI info for barcode AAGGCAGTCCGCGGTA-1 contig 1 = AGTCTGGGCC...
umi ACCAACGCTT = 795 reads: -358 +4 -1XX +3 -1XX +13 -1XX +1 invalidated
umi AGGTGAATAT = 227 reads: +382 validated
umi CACGAATCGA = 260 reads: +382 validated
umi CTAGACCCCA = 212 reads: -7X +375 invalidated
umi GGGTAACTGT = 238 reads: +382 validated
umi TAGCTATTCA = 281 reads: +382 validated
umi TCCCCACGCT = 193 reads: +382 validated

UMI info for barcode AAGGCAGTCCGCGGTA-1 contig 2 = GGGGGAATCC...
umi ACCCCTTACG = 196 reads: +427 validated
umi ACCCTCCCTT = 301 reads: +427 validated
umi ATTGTCCTCC = 252 reads: +427 validated
umi GAGGCATCTC = 326 reads: +427 validated
umi TATACGCACT = 150 reads: +427 validated
umi TTAATGAGTC = 343 reads: +427 validated
umi TTGATCCCTT = 276 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=633]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-367 ==> 0-327 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=22)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
422-633 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 6 umis using 233 reads
cdr3 = CQVWLSLSDQMVF at 355, score = 7 + 8
umis assigned: [43, 86, 153, 245, 323, 382, 403]
of which 7 are surviving nonsolos
reads assigned: 2167
start codons at 40, 124, 239, 242, 338, 385
confident = true

TIG 2[bases=608]
21-379 ==> 0-358 on |99|IGHV2-70|L-REGION+V-REGION| [len=358] (mis=23)
400-448 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
448-608 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 7 umis using 267 reads
cdr3 = CARVMFSSGYPHYFDSW at 366, score = 6 + 7
umis assigned: [44, 45, 134, 279, 385, 467, 485]
of which 7 are surviving nonsolos
reads assigned: 1810
start codons at 21, 177, 327, 336, 378, 502
confident = true
now this is a cell
paired!

GACACAGCCACATATTGGTGTGCACGGGTAATGTTTAGTAGTGGTTATCCGCACTACTTTGACTCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGGGTCGTGGCCGGGGATGAGGCCGACTATTACTGTCAGGTGTGGCTTAGTCTTAGTGATCAAATGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.508 = AAGGCAGTCTCACATT-1

using 286 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 278]
surviving nonsolo ucounts = 1[278]
ids = [3]

====================================================================================

UMI info for barcode AAGGCAGTCTCACATT-1 contig 1 = AGGAGTCAGA...
umi CGCTCTGCCC = 270 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=493]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=25)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
412-493 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CHQYNSYSTF at 354, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 27, 33, 89, 102, 238, 241, 334, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.510 = AAGGCAGTCTCGAGTA-1

using 53 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 46]
surviving nonsolo ucounts = 1[46]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.517 = AAGGCAGTCTGGTTCC-1

using 11 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 7]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.519 = AAGGCAGTCTTGTCAT-1

using 99 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 91]
surviving nonsolo ucounts = 1[91]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=461]
0-55 ==> 9-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
0-55 ==> 5945-6000 on rc of segment after IGHV1-2 exon 1 [len=6000] (mis=0)
47-73 ==> 10114-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=2)
55-408 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=38)
416-461 ==> 0-45 on |57|IGHJ5|J-REGION| [len=51] (mis=6)
cdr3 = CAREKRSGWFDLW at 397, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 83
start codons at 55, 142, 253, 258, 319
confident = false
VJ delta = 11
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.527 = AAGGTTCAGAGTACAT-1

using 1345 reads

====================================================================================

graph has 1891 edges initially, 26 edges after simplification

total ucounts = 601
nonsolo ucounts = 288[2^118, 3^59, 4^39, 5^35, 6^18, 7^5, 8^6, 9^2, 10, 11^2, 12^2, 23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.541 = AAGGTTCAGGACTGGT-1

using 287 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[287]
surviving nonsolo ucounts = 1[287]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=480]
38-175 ==> 0-137 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=25)
175-301 ==> 140-266 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=30)
cdr3 = CARGPLVRGILGKGYYLDLW at 377, score = 8 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 38, 82, 347
confident = false
see deletion of 3 bases at pos 137 on |197|IGHV4/OR15-8|L-REGION+V-REGION|
>vscore_4.541_77.1%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGCGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.562 = AAGGTTCCAAACGCGA-1

using 264 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 257]
surviving nonsolo ucounts = 1[257]
ids = [3]

====================================================================================

UMI info for barcode AAGGTTCCAAACGCGA-1 contig 1 = AGGAGTCAGA...
umi GTATTCTATC = 237 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=497]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=25)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-497 ==> 0-82 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQGNSFPYTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 27, 33, 89, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.572 = AAGGTTCCACATGTGT-1

using 559 reads

====================================================================================

graph has 218 edges initially, 30 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 3, 4, 271, 275]
surviving nonsolo ucounts = 2[271, 275]
ids = [3, 6]

====================================================================================

UMI info for barcode AAGGTTCCACATGTGT-1 contig 1 = GAGGAGTCAG...
umi GTGCCAGCCG = 274 reads: +388 validated

UMI info for barcode AAGGTTCCACATGTGT-1 contig 2 = ATCAGTCCCA...
umi GATGCACGTC = 268 reads: +110 -1XX +13 -1XX +263 invalidated

GOOD CONTIGS

TIG 1[bases=552]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQSYSTPWTF at 355, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 28, 34, 90, 103, 239, 458
confident = false

TIG 2[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=17)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.574 = AAGGTTCCACCGAATT-1

using 422 reads

====================================================================================

graph has 126 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[162, 255]
surviving nonsolo ucounts = 2[162, 255]
ids = [5, 2]

====================================================================================

UMI info for barcode AAGGTTCCACCGAATT-1 contig 1 = AACCACATCC...
umi CTTAGTCCCC = 154 reads: +412 validated

UMI info for barcode AAGGTTCCACCGAATT-1 contig 2 = TGGGGAGTCA...
umi ACACCAGCCT = 259 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=474]
0-48 ==> 10-58 on |74|IGHV1-45|5'UTR| [len=58] (mis=0)
48-401 ==> 0-353 on |75|IGHV1-45|L-REGION+V-REGION| [len=353] (mis=10)
412-460 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
junction support: 1 umis using 16 reads
cdr3 = CAVQEVAGAFDYW at 390, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 153
start codons at 48, 94, 108, 246, 251, 268, 330, 345, 381
confident = false

TIG 2[bases=553]
29-382 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQSYSTPRTF at 356, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 29, 35, 91, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.589 = AAGGTTCCATCACGAT-1

using 394 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[7, 22, 362]
surviving nonsolo ucounts = 2[22, 362]
ids = [5, 3]

====================================================================================

UMI info for barcode AAGGTTCCATCACGAT-1 contig 1 = GGAGTCAGTC...
umi GACGTAAGCA = 362 reads: +388 validated
umi GGTTCCGTAT = 23 reads: +356 -1 +1 -5 +2 -2X +1 -1X +11 -4 +4 invalidated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [3, 5]
of which 2 are surviving nonsolos
reads assigned: 374
start codons at 26, 32, 88, 101, 237, 336, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.592 = AAGGTTCCATTTCAGG-1

using 1713 reads

====================================================================================

graph has 588 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[4, 7, 392, 1309]
surviving nonsolo ucounts = 2[392, 1309]
ids = [4, 2]

====================================================================================

UMI info for barcode AAGGTTCCATTTCAGG-1 contig 1 = GAAGAGCTGC...
umi GTCTAGCTGC = 369 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=518]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-518 ==> 0-97 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYGSSPMYTF at 357, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 357
start codons at 33, 82, 241, 340, 381, 463
confident = false

REJECT CONTIGS

TIG 1[bases=347]
15-122 ==> 246-353 on |91|IGHV1/OR15-1|L-REGION+V-REGION| [len=353] (mis=12)
139-187 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=7)
187-347 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARDRAGSAWLLDNW at 111, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 1293
start codons at 66, 241
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.607 = AAGGTTCGTGATGCCC-1

using 409 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 8[2^3, 3, 4^2, 65, 322]
surviving nonsolo ucounts = 1[322]
ids = [5]

====================================================================================

UMI info for barcode AAGGTTCGTGATGCCC-1 contig 1 = GATCAGGACT...
umi CAGGTCCCGG = 310 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=523]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
427-523 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CMQALQTPVTF at 366, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 304
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.612 = AAGGTTCGTTGTGGCC-1

using 323 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[8, 314]
surviving nonsolo ucounts = 1[314]
ids = [2]

====================================================================================

UMI info for barcode AAGGTTCGTTGTGGCC-1 contig 1 = GGAGGAACTG...
umi CTTCCGATAT = 312 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=555]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQRSNWPMYTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 34, 239, 242, 379, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.620 = AAGGTTCTCAGCCTAA-1

using 7724 reads

====================================================================================

graph has 7759 edges initially, 82 edges after simplification

total ucounts = 1455
nonsolo ucounts = 684[2^272, 3^150, 4^90, 5^64, 6^31, 7^23, 8^12, 9^5, 10^2, 11^3, 12, 14^4, 15^2, 19, 41, 67, 72, 96, 105, 109, 153, 162^2, 187, 192, 200, 204, 206, 211, 227, 236, 247, 266, 268, 283, 296, 309, 322]
surviving nonsolo ucounts = 24[19, 67, 72, 96, 105, 109, 153, 162^2, 187, 192, 200, 204, 206, 211, 227, 236, 247, 266, 268, 283, 296, 309, 322]
ids = [1330, 299, 13, 703, 1389, 827, 1290, 249, 1204, 889, ...]

====================================================================================

UMI info for barcode AAGGTTCTCAGCCTAA-1 contig 1 = AGCCCTCAGA...
umi AAACCGTGCC = 72 reads: +421 -1 +8 non-validated
umi ACCGGGTCGT = 226 reads: +430 validated
umi AGTGTATTTC = 161 reads: +421 -9 non-validated
umi ATGACCCCGC = 67 reads: +402 -28 non-validated
umi CCTTACCGTG = 193 reads: +428 -2 non-validated
umi CTAGTCCTTC = 94 reads: +430 validated
umi CTATTAAGGA = 156 reads: -386X +1 -3XX +3 -2XX +6 -1XX +2 -1XX +2 -1XX +3 -2XX +17 invalidated
umi GAACCGACCA = 114 reads: +430 validated
umi GCCCAACAAA = 198 reads: +257 -1XX +172 invalidated
umi TAAATTCTGG = 207 reads: +430 validated
umi TAGCATGTGG = 269 reads: +249 -5XX +1 -1XX +1 -4XX +1 -6XX +1 -4XX +1 -32X +1 -2XX +2 -4XX +1 -1XX +1 -1XX +1 -2XX +1 -1XX +1 -6XX +99 invalidated
umi TCCTCTAAAA = 269 reads: +430 validated
umi TCCTGTCATC = 200 reads: +430 validated
umi TCGATTGGGC = 169 reads: +257 -1XX +156 -16 invalidated
umi TGTCACGGTT = 149 reads: +430 validated
umi TGTCCAGTAC = 233 reads: +430 validated
umi TTACGCCACC = 19 reads: +43 -21 +1 -2 +6 -1 +17 -1 +74 -7X +2 -1 +2 -1 +2 -2 +2 -2 +1 -2 +1 -1 +2 -2 +3 -2X +1 -1 +3 -1 +57 -12 +66 -2 +1 -1 +1 -1 +6 -1 +9 -2 +14 -50 invalidated
umi TTCTTCACGC = 111 reads: +380 -19 +31 non-validated
umi TTTCTCAGCG = 207 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=669]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=1)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=40)
463-509 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
509-669 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 11 umis using 166 reads
cdr3 = CARESYVGLYSSTSYPDYW at 421, score = 8 + 7
umis assigned: [13, 148, 249, 299, 592, 703, 718, 827, 889, 1047] and 9 others
of which 19 are surviving nonsolos
reads assigned: 2996
start codons at 79, 228, 235, 314, 356, 382, 437, 563
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.623 = AAGGTTCTCATACGGT-1

using 664 reads

====================================================================================

graph has 218 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[659]
surviving nonsolo ucounts = 1[659]
ids = [2]

====================================================================================

UMI info for barcode AAGGTTCTCATACGGT-1 contig 1 = GGGAATCAGT...
umi GAGCCCTTGG = 661 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 118 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 648
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.627 = AAGGTTCTCCAAATGC-1

using 331 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 324]
surviving nonsolo ucounts = 1[324]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=494]
1-321 ==> 40-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=8)
320-358 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
358-494 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQGTHWPWTF at 297, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 321
start codons at 22, 30, 118, 280, 300, 400
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.631 = AAGGTTCTCCTAGTGA-1

using 280 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 5, 266]
surviving nonsolo ucounts = 1[266]
ids = [0]

====================================================================================

UMI info for barcode AAGGTTCTCCTAGTGA-1 contig 1 = AGACTCAGTC...
umi AGACTTGGGC = 258 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=492]
20-371 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
408-492 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYNSYPLTF at 347, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 20, 26, 82, 95, 231, 234, 327, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.635 = AAGGTTCTCCTGCCAT-1

using 501 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[115, 382]
surviving nonsolo ucounts = 2[115, 382]
ids = [1, 2]

====================================================================================

UMI info for barcode AAGGTTCTCCTGCCAT-1 contig 1 = GCTGGGGTCT...
umi CGTTCGGCTT = 115 reads: +388 validated
umi GATCCCTGAT = 378 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=640]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=3)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
429-640 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 81 reads
cdr3 = CSSYAGSNNLVF at 365, score = 8 + 9
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 489
start codons at 41, 198, 242, 249, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.639 = AAGGTTCTCGCGTAGC-1

using 86 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 5, 77]
surviving nonsolo ucounts = 1[77]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=426]
3-53 ==> 65-115 on segment before IGLV1-44 exon 2 [len=115] (mis=0)
3-53 ==> 65-115 on segment before IGLV1-36 exon 2 [len=115] (mis=0)
50-358 ==> 43-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=3)
360-398 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
398-426 ==> 0-28 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CAAWDDSLSVPWVF at 328, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 68
start codons at 28, 161, 311, 336, 341
confident = false
not full
VJ delta = 20
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.640 = AAGGTTCTCGGAAATA-1

using 8 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.642 = AAGGTTCTCGTCACGG-1

using 218 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 6, 204]
surviving nonsolo ucounts = 1[204]
ids = [2]

====================================================================================

UMI info for barcode AAGGTTCTCGTCACGG-1 contig 1 = AGCTTCAGCT...
umi AGTTCTGATG = 202 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=604]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-604 ==> 0-169 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.643 = AAGGTTCTCTCGTATT-1

using 294 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[9, 283]
surviving nonsolo ucounts = 1[283]
ids = [2]

====================================================================================

UMI info for barcode AAGGTTCTCTCGTATT-1 contig 1 = AGAGCTCTGG...
umi CGTAACATTA = 260 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=508]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
391-429 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
429-508 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYNNWPPITF at 365, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 44, 113, 249, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.648 = AAGGTTCTCTGGTGTA-1

using 14 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.651 = AAGGTTCTCTTGAGAC-1

using 38 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[38]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.652 = AAGGTTCTCTTGCAAG-1

using 1546 reads

====================================================================================

graph has 2292 edges initially, 14 edges after simplification

total ucounts = 737
nonsolo ucounts = 285[2^119, 3^61, 4^38, 5^22, 6^19, 7^5, 8^9, 9, 10^3, 11^4, 16, 21, 22, 48]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.656 = AAGTCTGAGACGCTTT-1

using 462 reads

====================================================================================

graph has 198 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 4, 17, 200, 233]
surviving nonsolo ucounts = 2[200, 233]
ids = [8, 2]

====================================================================================

UMI info for barcode AAGTCTGAGACGCTTT-1 contig 1 = TCTCTGCTTC...
umi CCAGCTTGCG = 226 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=530]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-530 ==> 0-85 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.661 = AAGTCTGAGCAATATG-1

using 260 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3, 4, 247]
surviving nonsolo ucounts = 1[247]
ids = [8]

====================================================================================

UMI info for barcode AAGTCTGAGCAATATG-1 contig 1 = GTAGAGAAGA...
umi TTCTAAATTA = 243 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-33 ==> 81-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
33-386 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
383-421 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
421-549 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CASWDDSLRGRVF at 354, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 33, 187, 337, 362, 367
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.667 = AAGTCTGAGCTGCAAG-1

using 478 reads

====================================================================================

graph has 238 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 192, 279]
surviving nonsolo ucounts = 2[192, 279]
ids = [1, 5]

====================================================================================

UMI info for barcode AAGTCTGAGCTGCAAG-1 contig 1 = AGCTCTGAGA...
umi GACACCACTG = 277 reads: +424 validated

UMI info for barcode AAGTCTGAGCTGCAAG-1 contig 2 = AGCTTCAGCT...
umi ACAGACTTCA = 191 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-544 ==> 0-41 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 79, 230, 235, 382, 460
confident = false

TIG 2[bases=555]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-555 ==> 0-120 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 189
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.668 = AAGTCTGAGCTGCGAA-1

using 273 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 4, 263]
surviving nonsolo ucounts = 1[263]
ids = [4]

====================================================================================

UMI info for barcode AAGTCTGAGCTGCGAA-1 contig 1 = CTGGGCCTCA...
umi GTATCTTGAT = 257 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=531]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-367 ==> 0-330 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=11)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
413-531 ==> 0-118 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQAWDGSTAVF at 352, score = 6 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 37, 42, 98, 185, 236, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.671 = AAGTCTGAGGACAGAA-1

using 188 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 6, 176]
surviving nonsolo ucounts = 1[176]
ids = [1]

====================================================================================

UMI info for barcode AAGTCTGAGGACAGAA-1 contig 1 = ACAAGAGGCA...
umi CCGTTCTATA = 173 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=520]
0-32 ==> 130-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
32-372 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=0)
385-423 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
423-520 ==> 0-97 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CCSYAGSSTLRVF at 356, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 32, 171, 233, 240, 366
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.685 = AAGTCTGAGTGTTAGA-1

using 256 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 4, 247]
surviving nonsolo ucounts = 1[247]
ids = [1]

====================================================================================

UMI info for barcode AAGTCTGAGTGTTAGA-1 contig 1 = GAGGAGCCCA...
umi CCAAATGCTT = 232 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=521]
0-69 ==> 10-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
69-422 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=1)
439-475 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=0)
475-521 ==> 0-46 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CAKDLVVTATW at 411, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 69, 220, 225, 372, 493
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.690 = AAGTCTGCAAGCTGAG-1

using 192 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[191]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.691 = AAGTCTGCAAGCTGTT-1

using 8481 reads

====================================================================================

graph has 4654 edges initially, 56 edges after simplification

total ucounts = 688
nonsolo ucounts = 288[2^105, 3^53, 4^41, 5^18, 6^11, 7^8, 8^5, 9^3, 10^2, 11, 12^2, 14^2, 18, 21, 37, 41^2, 47, 84, 89, 142, 147, 148, 150^2, 151, 162^2, 175, 183, 212, 213, 215, 221, 237, 243, 252, 257, 258^2, 262, 269, 275, 281, 290, 299, 343, 348, 505]
surviving nonsolo ucounts = 30[41^2, 89, 142, 147, 150^2, 151, 162, 175, 183, 212, 213, 215, 221, 237, 243, 252, 257, 258^2, 262, 269, 275, 281, 290, 299, 343, 348, 505]
ids = [541, 682, 440, 387, 306, 157, 264, 560, 21, 93, ...]

====================================================================================

UMI info for barcode AAGTCTGCAAGCTGTT-1 contig 1 = AACCACATTC...
umi ACCCGAGCAA = 246 reads: +421 validated
umi CAATACGTGT = 124 reads: +421 validated
umi CCCTTAGCCT = 268 reads: +421 validated
umi GCAGGATGAT = 504 reads: -284X +137 invalidated
umi GCTCTCTGGG = 287 reads: +421 validated
umi TCGGTCCGCG = 131 reads: +421 validated
umi TGACGGGGTA = 346 reads: +421 validated
umi TTTGGTACGG = 40 reads: +322 -1X +1 -1 +7 -2 +7 -1 +2 -1 +65 -11 invalidated

UMI info for barcode AAGTCTGCAAGCTGTT-1 contig 2 = AGTCTGGGCC...
umi ACGTCCATCA = 258 reads: +382 validated
umi CAGTATATCT = 261 reads: +382 validated
umi CCTCCGGGAG = 297 reads: +382 validated
umi CTTTTTACCG = 217 reads: +382 validated
umi GAACATGTTA = 215 reads: +382 validated
umi GGGCCTTTGT = 249 reads: +382 validated
umi GGTCTGCCAG = 279 reads: +382 validated
umi GTACCCGTCA = 88 reads: +382 validated
umi GTGCGACGAG = 234 reads: +382 validated
umi GTGGCGATAA = 261 reads: +382 validated
umi GTTGAGTTCA = 281 reads: +382 validated
umi TGTGCACATC = 297 reads: +382 validated
umi TTTAAGGTGT = 270 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=571]
0-48 ==> 10-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
48-401 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=1)
400-420 ==> 0-20 on |30|IGHD5-24|D-REGION| [len=20] (mis=3)
421-469 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
469-571 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 7 umis using 176 reads
cdr3 = CARGIDGYNYEWFDYW at 390, score = 9 + 7
umis assigned: [58, 157, 220, 378, 405, 560, 592, 682]
of which 8 are surviving nonsolos
reads assigned: 1907
start codons at 48, 199, 246, 345, 406, 418, 487, 548
confident = true

TIG 2[bases=633]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-391 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=4)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
422-633 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 13 umis using 554 reads
cdr3 = CQVWDSSSDHPVF at 355, score = 8 + 8
umis assigned: [71, 179, 233, 339, 343, 426, 434, 440, 461, 463] and 3 others
of which 13 are surviving nonsolos
reads assigned: 3152
start codons at 40, 101, 239, 242, 338
confident = true

REJECT CONTIGS

TIG 1[bases=741]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=1)
36-82 ==> 0-46 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=0)
82-191 ==> 0-109 on segment before IGLV1-41 exon 2 [len=109] (mis=1)
191-469 ==> 46-324 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=16) [SHIFT!]
492-530 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
530-741 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CLAWDTSPRAPF at 466, score = 7 + 8
umis assigned: [21, 93, 264, 306, 387, 510, 516, 541, 667]
of which 9 are surviving nonsolos
reads assigned: 1399
start codons at 36, 122, 286, 296, 350, 474
confident = false
not full
frameshifted full length stopped transcript of length 741
VJ delta = -87
delta too large
not full
now this is a cell
paired!

GAGGACACGGCCGTGTATTACTGTGCGAGAGGAATAGATGGCTACAATTATGAGTGGTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGGGTCGAAGCCGGGGATGAGGCCGACTATTACTGTCAGGTGTGGGATAGTAGTAGTGATCATCCCGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.695 = AAGTCTGCAAGTTGTC-1

using 187 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[185]
surviving nonsolo ucounts = 1[185]
ids = [1]

====================================================================================

UMI info for barcode AAGTCTGCAAGTTGTC-1 contig 1 = GCTCTGCTTC...
umi ATTTCTCGGC = 179 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=530]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-530 ==> 0-85 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 175
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.696 = AAGTCTGCAATCCAAC-1

using 852 reads

====================================================================================

graph has 290 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[7, 841]
surviving nonsolo ucounts = 1[841]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=341]
4-89 ==> 11262-11347 on segment before IGLV3-6 exon 1 [len=11502] (mis=0)
92-130 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
130-341 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 829
start codons at 39
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.697 = AAGTCTGCAATCGAAA-1

using 301 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 6[4, 6^3, 7, 272]
surviving nonsolo ucounts = 1[272]
ids = [5]

====================================================================================

UMI info for barcode AAGTCTGCAATCGAAA-1 contig 1 = GCTCTGCTTC...
umi TTCCTCATTC = 266 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=566]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=10)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
442-566 ==> 0-124 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQSYDINLIGVIF at 375, score = 7 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 51, 114, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.699 = AAGTCTGCACAGGTTT-1

using 520 reads

====================================================================================

graph has 238 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[184, 328]
surviving nonsolo ucounts = 2[184, 328]
ids = [5, 6]

====================================================================================

UMI info for barcode AAGTCTGCACAGGTTT-1 contig 1 = ACACCCTGTG...
umi GTTATGGGAG = 21 reads: -320 +9 -4X +2 -1X +3 -9X +40 invalidated
umi TGATTACTGT = 331 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=562]
0-38 ==> 9-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
38-389 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=11)
389-426 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQANSFPLTF at 365, score = 9 + 9
umis assigned: [5, 6]
of which 2 are surviving nonsolos
reads assigned: 344
start codons at 38, 44, 100, 113, 252, 270, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.700 = AAGTCTGCACATTCGA-1

using 39 reads

====================================================================================

graph has 40 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 9, 21]
surviving nonsolo ucounts = 1[9]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.708 = AAGTCTGCAGGCAGTA-1

using 1197 reads

====================================================================================

graph has 480 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[282, 371, 541]
surviving nonsolo ucounts = 3[282, 371, 541]
ids = [5, 0, 3]

====================================================================================

UMI info for barcode AAGTCTGCAGGCAGTA-1 contig 1 = AGCTTCAGCT...
umi GTAAATTATC = 277 reads: +388 validated

UMI info for barcode AAGTCTGCAGGCAGTA-1 contig 2 = GGGAGCATCA...
umi CACATTTCGC = 375 reads: +424 validated
umi CGATCGTGCA = 545 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=577]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-577 ==> 0-142 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 47, 201, 351, 376, 381
confident = true

TIG 2[bases=559]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=1)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=7)
440-488 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
488-559 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 66 reads
cdr3 = CARSLVSYSSSWIFDYW at 406, score = 8 + 7
umis assigned: [0, 3]
of which 2 are surviving nonsolos
reads assigned: 897
start codons at 64, 262, 267, 299, 328, 361
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.711 = AAGTCTGCATAAGACA-1

using 300 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 6, 287]
surviving nonsolo ucounts = 1[287]
ids = [1]

====================================================================================

UMI info for barcode AAGTCTGCATAAGACA-1 contig 1 = GTCAGTCTCA...
umi CATACATTTC = 287 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=544]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQSYSTPSF at 350, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 23, 29, 85, 98, 234, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.718 = AAGTCTGCATTAGGCT-1

using 242 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[241]
surviving nonsolo ucounts = 1[241]
ids = [0]

====================================================================================

UMI info for barcode AAGTCTGCATTAGGCT-1 contig 1 = GCATCTTTCT...
umi CTCTAGCATC = 239 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=561]
79-430 ==> 0-351 on |63|IGHV1-18|L-REGION+V-REGION| [len=351] (mis=52)
455-503 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
503-561 ==> 0-58 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARLQVDAPLAHGGDYW at 421, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 79, 277, 440, 557
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.725 = AAGTCTGGTATCAGTC-1

using 226 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 221]
surviving nonsolo ucounts = 1[221]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.727 = AAGTCTGGTCAAAGAT-1

using 66 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 41
nonsolo ucounts = 6[2, 4^2, 7^3]
surviving nonsolo ucounts = 3[4^2, 7]
ids = [11, 38, 8]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.742 = AAGTCTGGTCTGATCA-1

using 7984 reads

====================================================================================

graph has 5745 edges initially, 50 edges after simplification

total ucounts = 1180
nonsolo ucounts = 551[2^230, 3^99, 4^63, 5^48, 6^33, 7^18, 8^8, 9^10, 10^6, 11^5, 12, 13, 15^2, 16, 25, 35, 80, 83^2, 89, 163, 166, 169, 176, 182, 184, 202, 206, 210, 221, 222, 241, 260, 266, 278, 308, 319, 374, 397, 503]
surviving nonsolo ucounts = 25[25, 35, 80, 83^2, 163, 166, 169, 176, 182, 184, 202, 206, 210, 221, 222, 241, 260, 266, 278, 308, 319, 374, 397, 503]
ids = [747, 317, 961, 826, 1156, 551, 89, 326, 563, 605, ...]

====================================================================================

UMI info for barcode AAGTCTGGTCTGATCA-1 contig 1 = AGCTCTCAGA...
umi AATTGCGCTT = 167 reads: +386 -1X +3 -1 +2 -2 +5 -1 +7 -2 +1 -1 +5 -1 +10 -11 invalidated
umi ATTCTGAGTA = 35 reads: +360 -79 non-validated
umi ATTGGTCCCG = 169 reads: +392 -2 +1 -3 +7 -1X +23 -1 +9 invalidated
umi CACCAATCAA = 278 reads: +439 validated
umi CCACTTCCCG = 407 reads: +285 -2XX +2 -2XX +1 -1XX +1 -6XX +1 -131XX +1 -3XX +1 -2XX invalidated
umi CGATAGTCGC = 241 reads: +439 validated
umi CGCTTATTAG = 164 reads: +439 validated
umi CTCCCGTATA = 181 reads: +439 validated
umi TCCACGCCTG = 178 reads: +439 validated
umi TCTATTTGCT = 80 reads: +424 -15 non-validated
umi TCTTCCCAGC = 221 reads: +439 validated
umi TTTGCTCACT = 84 reads: +363 -1 +1 -1 +1 -1 +3 -1 +8 -59 non-validated

UMI info for barcode AAGTCTGGTCTGATCA-1 contig 2 = AGTCTGGGCC...
umi AATTTGATAC = 305 reads: +382 validated
umi ATTGATTCCT = 255 reads: +382 validated
umi CAATTCCTTC = 503 reads: +382 validated
umi CCCGCTAGGC = 204 reads: +382 validated
umi CCTAGGTTTA = 264 reads: +382 validated
umi CGGTACTTGT = 180 reads: +382 validated
umi GTAACAGCGA = 25 reads: -25 +295 -11 +51 non-validated
umi TACTCCCCCC = 222 reads: +382 validated
umi TCTTATCCTA = 204 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=678]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=22)
468-518 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
518-678 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 5 umis using 72 reads
cdr3 = CASKMGGGPGISWRVDDAFDMW at 421, score = 9 + 7
umis assigned: [89, 317, 326, 371, 436, 529, 551, 605, 900, 961] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2155
start codons at 79, 132, 235, 356, 382, 433, 470, 481, 499, 572
confident = true

TIG 2[bases=633]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-391 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=14)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
422-633 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 8 umis using 345 reads
cdr3 = CQVWDSSSDHWVF at 355, score = 8 + 8
umis assigned: [94, 320, 362, 462, 496, 563, 747, 836, 977]
of which 9 are surviving nonsolos
reads assigned: 2129
start codons at 40, 101, 242, 338
confident = true

REJECT CONTIGS

TIG 1[bases=532]
3-75 ==> 5665-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
27-201 ==> 0-174 on |257|IGKV1D-43|L-REGION+V-REGION| [len=351] (mis=1)
201-368 ==> 184-351 on |257|IGKV1D-43|L-REGION+V-REGION| [len=351] (mis=9) [SHIFT!]
369-396 ==> 10-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
396-532 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYHSTP at 344, score = 8 + 6
umis assigned: [15, 22, 826, 1047]
of which 4 are surviving nonsolos
reads assigned: 974
start codons at 27, 33, 89, 102, 231, 438
confident = false
not full
frameshifted full length transcript of length 532
VJ delta = 23
not full
now this is a cell
paired!

TACTGTGCGAGTAAAATGGGGGGTGGTCCGGGGATTAGCTGGCGAGTGGACGATGCTTTTGATATGTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> AGGGTCGAAGCCGGGGATGAGGCCGCCTATTACTGTCAGGTGTGGGATAGTAGTAGTGATCATTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.746 = AAGTCTGGTGACCAAG-1

using 52 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 8[2^2, 4^2, 6, 7, 8, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.752 = AAGTCTGGTGTCAATC-1

using 216 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 212]
surviving nonsolo ucounts = 1[212]
ids = [2]

====================================================================================

UMI info for barcode AAGTCTGGTGTCAATC-1 contig 1 = GCTGGGGTCT...
umi ATGAGAAGCG = 213 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=648]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=10)
400-438 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
438-648 ==> 0-210 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CSSYAGSKNFVHVLF at 365, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 41, 198, 242, 249, 348, 375, 399
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.762 = AAGTCTGGTTTGTTGG-1

using 224 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[11, 210]
surviving nonsolo ucounts = 1[210]
ids = [4]

====================================================================================

UMI info for barcode AAGTCTGGTTTGTTGG-1 contig 1 = TGGGGCTGGG...
umi TGTTCTGCAC = 204 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=482]
45-383 ==> 0-338 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=16)
398-436 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=5)
436-482 ==> 0-46 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CSSYTNSTTPGVF at 369, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 45, 181, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.764 = AAGTCTGTCAAACCAC-1

using 317 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 3^3, 303]
surviving nonsolo ucounts = 1[303]
ids = [1]

====================================================================================

UMI info for barcode AAGTCTGTCAAACCAC-1 contig 1 = AGCTTCAGCT...
umi ATTCAACGCA = 301 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-505 ==> 0-70 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.766 = AAGTCTGTCAAAGTAG-1

using 12691 reads

====================================================================================

graph has 7348 edges initially, 56 edges after simplification

total ucounts = 1356
nonsolo ucounts = 662[2^257, 3^131, 4^84, 5^51, 6^36, 7^25, 8^12, 9^9, 10^6, 11^4, 12^3, 13^3, 14, 17, 18, 19^2, 20, 25, 129, 141, 148, 159, 170, 188, 201, 207, 232, 239, 264, 270, 273, 277, 278^2, 284, 297^2, 302, 312, 314^2, 323, 326, 330, 340, 356, 358, 359, 366, 383^2, 521]
surviving nonsolo ucounts = 34[129, 141, 148, 159, 170, 188, 201, 207, 232, 239, 264, 270, 273, 277, 278^2, 284, 297^2, 302, 312, 314^2, 323, 326, 330, 340, 356, 358, 359, 366, 383^2, 521]
ids = [172, 85, 401, 659, 302, 476, 165, 283, 332, 149, ...]

====================================================================================

UMI info for barcode AAGTCTGTCAAAGTAG-1 contig 1 = ACCCAAAAAC...
umi AACCAGCGCG = 282 reads: -11X +431 invalidated
umi AGCCCACAGC = 206 reads: +442 validated
umi AGCTATCCCT = 120 reads: +408 -5 +16 -1 +3 -1 +8 non-validated
umi ATTACGGGAA = 206 reads: +442 validated
umi CAAGGTCCTC = 344 reads: +442 validated
umi CCAAAATCGT = 150 reads: +442 validated
umi GAGGCCGGGT = 270 reads: +430 -1 +4 -2 +2 -1 +2 non-validated
umi GTTCAATGTA = 302 reads: +442 validated
umi TGAAATAGAC = 316 reads: +442 validated

UMI info for barcode AAGTCTGTCAAAGTAG-1 contig 2 = GGCAGGAGTC...
umi AATAGACTTT = 299 reads: +388 validated
umi ACATTGGGGT = 141 reads: +388 validated
umi ACGGATAGAA = 294 reads: +388 validated
umi ACTGGAAGTG = 368 reads: +388 validated
umi AGAACTTAGC = 238 reads: +388 validated
umi AGTTAACGAG = 384 reads: +388 validated
umi ATAGGCGTTA = 310 reads: +388 validated
umi ATTGTAGCCT = 327 reads: +388 validated
umi ATTTGCTCTG = 170 reads: -361X +1 -1XX +1 -1XX +1 -1XX +1 -5XX +2 -1XX +2 -10XX invalidated
umi CAATTCCCTG = 231 reads: +388 validated
umi CAGATGCCAT = 361 reads: +388 validated
umi CCCTGATATC = 185 reads: +388 validated
umi CCGCTCATAT = 321 reads: +388 validated
umi CCTACGTCGG = 287 reads: +388 validated
umi CCTGTTCTAA = 311 reads: -41X +347 invalidated
umi CGTGTTCATA = 357 reads: +388 validated
umi CTCGATACGG = 390 reads: +388 validated
umi CTGTTCCTCA = 159 reads: +388 validated
umi GATGCCCGAG = 267 reads: +388 validated
umi GGCTCACACT = 358 reads: +388 validated
umi GTATCTATTG = 279 reads: +388 validated
umi TAACGCCGTG = 277 reads: +388 validated
umi TACGCACACC = 279 reads: +388 validated
umi TTCTCATGCT = 275 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=567]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=1)
409-440 ==> 0-31 on |14|IGHD2-2|D-REGION| [len=31] (mis=2)
445-496 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
496-567 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 143 reads
cdr3 = CARDQDIVVVPAAMRGEGWFDPW at 396, score = 8 + 7
umis assigned: [11, 165, 172, 283, 327, 401, 724, 936, 1176]
of which 9 are surviving nonsolos
reads assigned: 2156
start codons at 54, 205, 252, 257, 274, 289, 318, 351, 435
confident = true

TIG 2[bases=554]
30-383 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 23 umis using 1138 reads
cdr3 = CQQSYSTLRTF at 357, score = 9 + 8
umis assigned: [34, 85, 113, 138, 149, 207, 230, 294, 302, 332] and 14 others
of which 24 are surviving nonsolos
reads assigned: 6756
start codons at 30, 36, 92, 105, 241, 460
confident = true

REJECT CONTIGS

TIG 1[bases=425]
2-266 ==> 846-1110 on rc of segment before IGHD3-16 exon 1 [len=1110] (mis=1)
274-323 ==> 0-49 on |56|IGHJ5|J-REGION| [len=49] (mis=5)
323-425 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [988]
of which 1 are surviving nonsolos
reads assigned: 517
start codons at 117, 133, 176, 341, 402
confident = false
did not find CDR3
now this is a cell
paired!

TGTGCGAGAGATCAGGATATTGTAGTAGTACCAGCTGCTATGAGAGGGGAGGGGTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCTCCGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.769 = AAGTCTGTCACATACG-1

using 19342 reads

====================================================================================

graph has 6516 edges initially, 70 edges after simplification

total ucounts = 644
nonsolo ucounts = 330[2^93, 3^67, 4^39, 5^28, 6^19, 7^9, 8^6, 9^2, 10^2, 11^4, 12, 15, 28, 51, 86, 89, 111, 117, 147, 166, 171, 172, 199, 201, 204, 215, 233, 234, 256, 259, 263, 265, 274, 287, 292, 296, 297, 304^3, 308, 311, 316, 324, 331, 332, 338, 339, 341, 344, 351, 354^2, 356, 362, 363, 366, 367, 380, 382, 390, 394, 419, 429, 439, 442, 449, 473, 589, 597, 646]
surviving nonsolo ucounts = 56[51, 89, 111, 117, 147, 166, 171, 172, 199, 201, 204, 215, 233, 256, 259, 263, 265, 274, 287, 292, 296, 297, 304^3, 308, 311, 316, 324, 331, 332, 338, 339, 341, 344, 351, 354^2, 356, 362, 363, 366, 367, 380, 382, 390, 394, 419, 429, 439, 442, 449, 473, 589, 597, 646]
ids = [500, 359, 177, 75, 572, 16, 27, 391, 542, 510, ...]

====================================================================================

UMI info for barcode AAGTCTGTCACATACG-1 contig 1 = GAGGAGCCTT...
umi AAGCTGCTCT = 166 reads: +409 -9 non-validated
umi CATATTCGGG = 108 reads: +418 validated
umi GCCCCTCATC = 306 reads: +418 validated
umi GTTATTTCTC = 442 reads: +418 validated
umi TAGACTTTTC = 415 reads: -172 +246 non-validated
umi TATTAGTCGG = 290 reads: +418 validated
umi TCAGCTCCTG = 50 reads: +332 -86 non-validated
umi TCGGCTTCTT = 224 reads: +98 -1XX +260 -1XX +1 -5X +1 -4X +1 -5X +1 -40X invalidated
umi TGCTGTGGCT = 343 reads: +418 validated
umi TGCTTTGGAA = 148 reads: +418 validated

UMI info for barcode AAGTCTGTCACATACG-1 contig 2 = GGGAGAGCCC...
umi AAATAAGATG = 349 reads: +379 validated
umi AATACGTTCC = 445 reads: +379 validated
umi AATAGAGCGT = 325 reads: +379 validated
umi AATGGCCGGA = 173 reads: +49 -5XX +1 -2XX +1 -6XX +1 -4XX +1 -2X +1 -13X +1 -3XX +2 -4XX +1 -1XX +1 -3XX +277 invalidated
umi ACAGCTTGGG = 280 reads: +379 validated
umi ACTCCCCCGA = 116 reads: +379 validated
umi AGTCTCATCT = 350 reads: +379 validated
umi ATTTCATTCT = 652 reads: +379 validated
umi CAAATGTGGG = 358 reads: +379 validated
umi CAATATGATG = 34 reads: +12 -3X +12 -4XX +1 -2XX +2 -1XX +1 -5XX +1 -2XX +53 -280 invalidated
umi CACACCGCCT = 350 reads: +379 validated
umi CACCCCCACG = 347 reads: +379 validated
umi CACGGCTTTT = 393 reads: +379 validated
umi CCGATTTGGC = 204 reads: +379 validated
umi CGTTGGTAGC = 312 reads: +379 validated
umi CTCATCCCGT = 367 reads: +379 validated
umi CTCTACGCCC = 334 reads: +379 validated
umi GATGGTTCAC = 311 reads: +379 validated
umi GCACACTACC = 372 reads: +379 validated
umi GCGTGTAAGT = 363 reads: +379 validated
umi GCTATGGAAT = 91 reads: +379 validated
umi GGCTCGGTTT = 304 reads: +379 validated
umi GGCTTATTCC = 400 reads: +350 -1XX +1 -1XX +1 -2XX +4 -2X +17 invalidated
umi GGTACGGTCA = 369 reads: +379 validated
umi GGTATTGCAG = 172 reads: +379 validated
umi GGTCTCTTCT = 455 reads: +379 validated
umi GTACTGTCTC = 266 reads: +379 validated
umi GTGATGGCAA = 9 reads: -18 +31 -5XX +1 -2XX +1 -6XX +1 -4XX +1 -2XX +1 -17XX +2 -4XX +1 -1XX +1 -3XX +48 -1 +2 -226 invalidated
umi GTTTATTAGA = 347 reads: +379 validated
umi TAACGCTCGT = 382 reads: +379 validated
umi TACAAGCACA = 342 reads: +379 validated
umi TACTATGGTA = 469 reads: +379 validated
umi TATAACTCCA = 274 reads: +379 validated
umi TATTTATGTC = 257 reads: +379 validated
umi TCCAGAATCA = 202 reads: +379 validated
umi TCGACAATGT = 428 reads: +379 validated
umi TTAGTTGGGG = 313 reads: +379 validated
umi TTGCTGCAGT = 378 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=558]
0-69 ==> 10-79 on |158|IGHV3-7|5'UTR| [len=79] (mis=0)
69-422 ==> 0-353 on |159|IGHV3-7|L-REGION+V-REGION| [len=353] (mis=15)
436-487 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
487-558 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 187 reads
cdr3 = CARGRGINSIYFDPW at 411, score = 9 + 7
umis assigned: [16, 177, 349, 437, 466, 488, 500, 539, 570, 572]
of which 10 are surviving nonsolos
reads assigned: 2440
start codons at 69, 188, 225, 286, 304, 372
confident = true

TIG 2[bases=562]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-376 ==> 0-329 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=7)
387-426 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 36 umis using 1985 reads
cdr3 = CQQRRLWYTF at 368, score = 9 + 7
umis assigned: [2, 24, 25, 27, 38, 75, 102, 139, 144, 150] and 28 others
of which 36 are surviving nonsolos
reads assigned: 11685
start codons at 47, 252, 255, 468
confident = true

REJECT CONTIGS

TIG 1[bases=553]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
20-83 ==> 5678-5741 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=6)
379-417 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [363, 364, 574, 590]
of which 4 are surviving nonsolos
reads assigned: 1132
start codons at 31, 37, 93, 106, 245, 368, 408, 459
confident = false
did not find CDR3
now this is a cell
paired!

GCCGAGGACACGGCTGTTTATTACTGTGCGAGAGGACGAGGTATAAATTCAATCTACTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ACCATCAGCAGCCTAGAACCTGAAGATTTTGCAGTTTATTACTGTCAGCAACGTCGCCTCTGGTACACTTTTGGCCAGGGGGTCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.770 = AAGTCTGTCACCAGGC-1

using 203 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 200]
surviving nonsolo ucounts = 1[200]
ids = [1]

====================================================================================

UMI info for barcode AAGTCTGTCACCAGGC-1 contig 1 = TCTGGCACCA...
umi CTGGGCAACG = 195 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=592]
0-34 ==> 0-34 on |387|IGLV7-46|5'UTR| [len=34] (mis=0)
34-385 ==> 0-351 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=3)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
425-592 ==> 0-167 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CLLSYSGARGVVF at 358, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 34, 242, 341
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.775 = AAGTCTGTCAGGTTCA-1

using 207 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 197]
surviving nonsolo ucounts = 1[197]
ids = [7]

====================================================================================

UMI info for barcode AAGTCTGTCAGGTTCA-1 contig 1 = AGCTCTGAGA...
umi TTATTGGTCA = 195 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=505]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
junction support: 1 umis using 20 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.785 = AAGTCTGTCCACTGGG-1

using 210 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2^3, 4, 192]
surviving nonsolo ucounts = 3[2, 4, 192]
ids = [11, 6, 7]

====================================================================================

UMI info for barcode AAGTCTGTCCACTGGG-1 contig 1 = TGGGGAGGAA...
umi TCGTGCGTGT = 4 reads: -26 +56 -68 +2 -1 +3 -4 +1 -1 +3 -2 +3 -2 +3 -1 +14 -1X +2 -2 +2 -2 +1 -2 +1 -3 +29 -1 +77 -69 invalidated
umi TCGTGCTTGA = 176 reads: +382 validated
umi TCGTGGTTGG = 1 reads: -117 +21 -2 +3 -2 +6 -1 +4 -1 +7 -1 +7 -210 non-validated
umi TCGTGGTTGT = 2 reads: -247 +56 -53 +26 non-validated

GOOD CONTIGS

TIG 1[bases=514]
0-37 ==> 60-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
37-382 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
419-514 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CLQYSDWPRTF at 358, score = 9 + 8
umis assigned: [6, 7, 10, 11]
of which 3 are surviving nonsolos
reads assigned: 180
start codons at 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.788 = AAGTCTGTCCAGTAGT-1

using 276 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 6, 263]
surviving nonsolo ucounts = 1[263]
ids = [2]

====================================================================================

UMI info for barcode AAGTCTGTCCAGTAGT-1 contig 1 = GGGAGTCAGT...
umi CACGGCAGTT = 244 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=479]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-479 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQSYTTLLTF at 354, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.793 = AAGTCTGTCCTTGGTC-1

using 163 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 158]
surviving nonsolo ucounts = 1[158]
ids = [2]

====================================================================================

UMI info for barcode AAGTCTGTCCTTGGTC-1 contig 1 = TGGGGAGGAA...
umi GTGAGTCAAC = 156 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=497]
0-37 ==> 10-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
37-382 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=8)
384-422 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
422-497 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQHRSTWPPSTF at 358, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 156
start codons at 37, 242, 245, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.796 = AAGTCTGTCGAGAACG-1

using 259 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 3, 247]
surviving nonsolo ucounts = 1[247]
ids = [6]

====================================================================================

UMI info for barcode AAGTCTGTCGAGAACG-1 contig 1 = TGGGGGAGTC...
umi GTATCTTAGA = 234 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=494]
30-383 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-494 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQSYSTPSF at 357, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 30, 36, 92, 105, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.797 = AAGTCTGTCGATCCCT-1

using 577 reads

====================================================================================

graph has 232 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 570]
surviving nonsolo ucounts = 1[570]
ids = [0]

====================================================================================

UMI info for barcode AAGTCTGTCGATCCCT-1 contig 1 = GGGGAGGAAC...
umi CAGTTACTGT = 577 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 91 reads
cdr3 = CQQRSNWPPLTF at 357, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 563
start codons at 36, 241, 244, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.807 = AAGTCTGTCTAGAGTC-1

using 621 reads

====================================================================================

graph has 218 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 305, 312]
surviving nonsolo ucounts = 2[305, 312]
ids = [1, 2]

====================================================================================

UMI info for barcode AAGTCTGTCTAGAGTC-1 contig 1 = GAGCATCACC...
umi CGTACTGTTG = 278 reads: +424 validated

UMI info for barcode AAGTCTGTCTAGAGTC-1 contig 2 = GATCAGGACT...
umi CACACGTGTT = 298 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=509]
0-62 ==> 2-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
62-415 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=7)
438-486 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
486-509 ==> 0-23 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARSLVSYSSSWIFDYW at 404, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 62, 260, 265, 297, 326, 359
confident = false

TIG 2[bases=488]
0-30 ==> 0-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
430-488 ==> 0-58 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CMQGTHWPGVTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 292
start codons at 30, 63, 91, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.811 = AAGTCTGTCTGGAGCC-1

using 288 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 281]
surviving nonsolo ucounts = 1[281]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.814 = AAGTCTGTCTTAACCT-1

using 332 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[331]
surviving nonsolo ucounts = 1[331]
ids = [1]

====================================================================================

UMI info for barcode AAGTCTGTCTTAACCT-1 contig 1 = GGGAGCATCA...
umi TCTGGATTAC = 301 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=499]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=1)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=12)
434-485 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
junction support: 1 umis using 29 reads
cdr3 = CARDRGSGFSNWFDPW at 406, score = 9 + 6
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 64, 220, 262, 267, 299, 328, 361
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.820 = AAGTCTGTCTTTACGT-1

using 15 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.821 = AATCCAGAGAACTGTA-1

using 11 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.825 = AATCCAGAGACATAAC-1

using 605 reads

====================================================================================

graph has 264 edges initially, 48 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[4^2, 214, 383]
surviving nonsolo ucounts = 2[214, 383]
ids = [3, 0]

====================================================================================

UMI info for barcode AATCCAGAGACATAAC-1 contig 1 = AGGAGTCAGA...
umi TTGTGGCACT = 210 reads: +385 validated

UMI info for barcode AATCCAGAGACATAAC-1 contig 2 = TGGGGAGGAG...
umi AACTTGTGCC = 386 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=4)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYNSYSSF at 354, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 27, 33, 89, 102, 334, 454
confident = false

TIG 2[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 72 reads
cdr3 = CQQSYSTPYTF at 359, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 377
start codons at 32, 38, 94, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.827 = AATCCAGAGAGCAATT-1

using 296 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[292]
surviving nonsolo ucounts = 1[292]
ids = [1]

====================================================================================

UMI info for barcode AATCCAGAGAGCAATT-1 contig 1 = AGCATCATCC...
umi ACTCACCGGC = 287 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=522]
0-61 ==> 243-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
61-414 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
443-491 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
491-522 ==> 0-31 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 403, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 61, 217, 259, 325, 358, 448
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.830 = AATCCAGAGATACACA-1

using 609 reads

====================================================================================

graph has 242 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[296, 307]
surviving nonsolo ucounts = 2[296, 307]
ids = [3, 5]

====================================================================================

UMI info for barcode AATCCAGAGATACACA-1 contig 1 = CGAGCCCAGC...
umi CGGGGTTTGC = 303 reads: +448 validated

UMI info for barcode AATCCAGAGATACACA-1 contig 2 = GTGACTGATC...
umi CACGTCGCAA = 286 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=549]
0-67 ==> 0-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
67-420 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=2)
436-457 ==> 0-21 on |32|IGHD6-13|D-REGION| [len=21] (mis=1)
467-515 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
515-549 ==> 0-34 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARIYAGLRGYSSSWYTDLYRLDYW at 409, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 67, 218, 223, 281, 284, 370, 533
confident = false

TIG 2[bases=497]
36-396 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=8)
395-433 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
433-497 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CMQGTHWPWTF at 372, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 36, 69, 97, 105, 193, 355, 375, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.840 = AATCCAGAGGACTGGT-1

using 931 reads

====================================================================================

graph has 354 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[931]
surviving nonsolo ucounts = 1[931]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=376]
13-111 ==> 242-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=7)
127-165 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
165-376 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=3)
cdr3 = CCSEAGGGVPGLLF at 95, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 919
start codons at 
confident = false
not full
VJ delta = 6
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.850 = AATCCAGAGTGGAGTC-1

using 1108 reads

====================================================================================

graph has 1507 edges initially, 44 edges after simplification

total ucounts = 431
nonsolo ucounts = 218[2^75, 3^47, 4^33, 5^18, 6^13, 7^8, 8^8, 9^5, 10^2, 11^3, 12, 13^2, 14, 16, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.854 = AATCCAGAGTTCGATC-1

using 1030 reads

====================================================================================

graph has 1048 edges initially, 14 edges after simplification

total ucounts = 396
nonsolo ucounts = 196[2^75, 3^50, 4^29, 5^16, 6^4, 7^6, 8^4, 9^4, 10, 11^3, 14, 15^2, 113]
surviving nonsolo ucounts = 1[113]
ids = [195]

====================================================================================

UMI info for barcode AATCCAGAGTTCGATC-1 contig 1 = AGTGCTTTCT...
umi CTGCCTAGGT = 110 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=559]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=8)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
453-559 ==> 0-106 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 1 umis using 12 reads
cdr3 = CARAHGDYYTLLDCW at 377, score = 8 + 7
umis assigned: [195]
of which 1 are surviving nonsolos
reads assigned: 109
start codons at 17, 38, 82, 168
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.864 = AATCCAGCAAGGACTG-1

using 2137 reads

====================================================================================

graph has 2858 edges initially, 26 edges after simplification

total ucounts = 927
nonsolo ucounts = 424[2^149, 3^95, 4^65, 5^36, 6^32, 7^17, 8^7, 9^11, 10^3, 11^3, 13^4, 14, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.865 = AATCCAGCAAGTAGTA-1

using 11 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.868 = AATCCAGCAATGTTGC-1

using 151 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 4, 5, 135]
surviving nonsolo ucounts = 1[135]
ids = [8]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.871 = AATCCAGCACAGGAGT-1

using 313 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 25
nonsolo ucounts = 9[2^4, 3, 8, 12, 17, 249]
surviving nonsolo ucounts = 8[2^3, 3, 8, 12, 17, 249]
ids = [8, 15, 18, 9, 13, 20, 19, 24]

====================================================================================

UMI info for barcode AATCCAGCACAGGAGT-1 contig 1 = GCTCTGCTTC...
umi GCGAGTCCAA = 2 reads: -268 +5 -1 +5 -1 +44 -70 non-validated
umi GCGAGTCCCA = 3 reads: -49 +99 -197 +3 -1 +3 -3 +6 -1 +1 -2 +6 -1 +3 -1 +2 -2 +2 -1 +1 -1 +7 -1 +1 non-validated
umi GCGCGTCCCC = 7 reads: -69 +147 -16 +23 -1 +32 -106 non-validated
umi GGGCGCCCCC = 1 reads: -35 +5 -1 +1 -1 +48 -303 non-validated
umi GGGCGTCCCC = 2 reads: -54 +33 -1 +1 -1 +20 -119 +56 -109 non-validated
umi GGGCGTGCCA = 1 reads: +28 -1 +3 -362 non-validated
umi GGGCGTGCCC = 1 reads: -11 +56 -327 non-validated
umi GGGGGGCCCC = 2 reads: -111 +22 -1 +23 -79 +56 -102 non-validated
umi GGGGGGGCCC = 17 reads: +337 -57 non-validated
umi GGGGGGGGCC = 12 reads: +9 -10 +56 -21 +247 -51 non-validated
umi TATTTTGCGA = 253 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=589]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=3)
407-445 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
445-589 ==> 0-144 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQSYDSSLSAPWVF at 375, score = 8 + 8
umis assigned: [8, 9, 13, 14, 15, 16, 17, 18, 19, 20] and 1 others
of which 8 are surviving nonsolos
reads assigned: 294
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.872 = AATCCAGCACCAGGCT-1

using 141 reads

====================================================================================

graph has 122 edges initially, 10 edges after simplification

total ucounts = 32
nonsolo ucounts = 22[2^3, 3^3, 4^2, 5^4, 6^3, 7^2, 8, 10, 12^2, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.882 = AATCCAGCACGGTGTC-1

using 411 reads

====================================================================================

graph has 192 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[73, 334]
surviving nonsolo ucounts = 1[334]
ids = [4]

====================================================================================

UMI info for barcode AATCCAGCACGGTGTC-1 contig 1 = GGGGAGGAGT...
umi GGGAATTCCT = 299 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=508]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
416-508 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYDNLPTF at 358, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 292
start codons at 31, 37, 93, 106, 245, 368, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.884 = AATCCAGCACTTGGAT-1

using 243 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 237]
surviving nonsolo ucounts = 1[237]
ids = [2]

====================================================================================

UMI info for barcode AATCCAGCACTTGGAT-1 contig 1 = GAGAGAGGAG...
umi CTCTCCGGCT = 230 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=534]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-534 ==> 0-37 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.897 = AATCCAGCATCCCATC-1

using 61 reads

====================================================================================

graph has 74 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 7[2, 5^2, 6, 11, 14, 16]
surviving nonsolo ucounts = 1[14]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.901 = AATCCAGCATTCACTT-1

using 98 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 25
nonsolo ucounts = 13[2^2, 3^4, 5, 6, 8^2, 12^2, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.912 = AATCCAGTCAACACTG-1

using 17 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.914 = AATCCAGTCAATACCG-1

using 143 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[141]
surviving nonsolo ucounts = 1[141]
ids = [0]

====================================================================================

UMI info for barcode AATCCAGTCAATACCG-1 contig 1 = ACAAGAGGCA...
umi CCCTTCTCGC = 138 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=528]
0-31 ==> 20-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
31-371 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
422-528 ==> 0-106 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQSYDKSLRGAVF at 355, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 137
start codons at 31, 115, 188, 338, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.919 = AATCCAGTCACTCCTG-1

using 821 reads

====================================================================================

graph has 334 edges initially, 46 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[3^2, 177, 303, 333]
surviving nonsolo ucounts = 3[177, 303, 333]
ids = [0, 5, 6]

====================================================================================

UMI info for barcode AATCCAGTCACTCCTG-1 contig 1 = AGACCCAGTC...
umi AATTCTTGGG = 173 reads: +388 validated

UMI info for barcode AATCCAGTCACTCCTG-1 contig 2 = GGAGGAACTG...
umi CGCACGATGC = 305 reads: +382 validated

UMI info for barcode AATCCAGTCACTCCTG-1 contig 3 = GGGGATCAGT...
umi TTCATTACTA = 366 reads: +22 -1XX +235 -2XX +128 invalidated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 161-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
20-371 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=4)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CQQYNSYPISF at 347, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 172
start codons at 20, 26, 82, 95, 327, 450
confident = false

TIG 2[bases=552]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQRSNWPLTF at 355, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 301
start codons at 34, 242, 458
confident = false

TIG 3[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=17)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQYSSSPWTF at 354, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 329
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.937 = AATCCAGTCCTCGCAT-1

using 170 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 165]
surviving nonsolo ucounts = 1[165]
ids = [1]

====================================================================================

UMI info for barcode AATCCAGTCCTCGCAT-1 contig 1 = ACTGATCAGG...
umi GTGTAGGGGA = 162 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=490]
0-33 ==> 3-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
33-393 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
395-433 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
433-490 ==> 0-57 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CMQALQTPLFTF at 369, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 161
start codons at 33, 66, 102, 190, 352, 372, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.941 = AATCCAGTCCTTGCCA-1

using 52929 reads

====================================================================================

graph has 15423 edges initially, 94 edges after simplification

total ucounts = 2347
nonsolo ucounts = 1096[2^377, 3^215, 4^116, 5^71, 6^36, 7^29, 8^18, 9^8, 10^8, 11^2, 12^6, 13^5, 14^3, 16^5, 17^3, 18, 19, 20, 21^2, 23, 24, 25^2, 30, 35, 39, 44, 48, 50, 56, 66, 71, 73, 87, 89^2, 90, 91, 92, 93^2, 106^2, 109, 111, 115, 116, 119, 121, 123^2, 126, 127, 131, 132, 134, 137, 139, 143, 146, 150^3, 151, 153, 154, 161, 162, 163, 165, 166^3, 168, 169, 176, 182, 184, 185, 186, 191, 200, 201^2, 202, 205, 208, 212, 214, 215, 217, 219, 221, 222, 223, 224, 227, 229^2, 231^2, 234, 235, 236, 240, 245, 246, 253, 256^3, 259, 262^2, 263, 266^2, 273, 276^2, 277, 278, 279, 284^2, 286, 288^3, 290, 291^2, 292, 293, 298^3, 301, 304, 305, 307, 308, 310^2, 317, 318, 319, 320, 321, 322, 323, 325, 327, 328^3, 330, 331, 332^2, 333, 334^4, 340, 344^2, 346, 349, 355, 357, 358, 359^2, 361, 366, 368, 369^2, 370, 373, 378, 380, 383^2, 387, 391, 395^2, 399, 400, 401, 403, 408^2, 409, 419, 423^2, 439, 456, 520, 556, 619, 665, 715, 767]
surviving nonsolo ucounts = 178[2, 3, 23, 25, 35, 44, 48, 56, 66, 71, 73, 87, 89, 91, 92, 93^2, 106, 109, 111, 115, 121, 123^2, 127, 132, 134, 137, 139, 143, 146, 150^3, 151, 153, 154, 161, 162, 163, 165, 166^3, 168, 169, 176, 182, 184, 185, 186, 191, 200, 201^2, 202, 205, 208, 212, 214, 215, 217, 219, 221, 222, 223, 224, 227, 229^2, 231^2, 234, 235, 236, 240, 245, 246, 253, 256^3, 259, 262^2, 263, 266^2, 273, 276^2, 277, 278, 279, 284^2, 286, 288^3, 290, 291^2, 292, 293, 298^3, 301, 304, 305, 307, 308, 310^2, 317, 318, 319, 320, 321, 322, 323, 325, 327, 328^3, 330, 331, 332, 333, 334^4, 340, 344^2, 346, 349, 355, 357, 358, 359^2, 361, 366, 368, 369^2, 370, 373, 378, 380, 383^2, 387, 391, 395^2, 399, 400, 401, 403, 408^2, 409, 419, 423^2, 439, 456, 520, 556, 619, 665, 715, 767]
ids = [424, 2180, 2112, 516, 9, 1829, 1113, 916, 1763, 1341, ...]

====================================================================================

UMI info for barcode AATCCAGTCCTTGCCA-1 contig 1 = GGAGTCTCCC...
umi AAAACGGCTC = 94 reads: +424 validated
umi AAAATTATTG = 33 reads: +424 validated
umi AAATTGCGAA = 216 reads: +424 validated
umi AAGGAATCGG = 90 reads: +412 -2 +10 non-validated
umi AATTTACCAT = 140 reads: +424 validated
umi ACATTATCTT = 128 reads: +424 validated
umi ACGGCGCATA = 262 reads: +424 validated
umi ACGTTTCCTG = 170 reads: +424 validated
umi ACTATACACT = 147 reads: +424 validated
umi AGAACAATCG = 115 reads: +420 -4 non-validated
umi AGTTACTCTC = 137 reads: +422 -1 +1 non-validated
umi ATATCCGGTC = 211 reads: +424 validated
umi ATCATTAATG = 150 reads: +424 validated
umi ATGAGCCTTT = 25 reads: +344 -1 +79 non-validated
umi ATGCCTTGCT = 160 reads: +424 validated
umi ATTCATCCAA = 85 reads: +422 -1 +1 non-validated
umi ATTCCCTTAC = 279 reads: +424 validated
umi ATTTCTTACA = 275 reads: +424 validated
umi CAAATGCGGT = 135 reads: +419 -1 +4 non-validated
umi CAAGTGGGGG = 74 reads: +424 validated
umi CACGTCCCCT = 109 reads: +424 validated
umi CACTCCACCT = 165 reads: +424 validated
umi CATCAACAAG = 162 reads: +424 validated
umi CCCGCTTGCT = 267 reads: +424 validated
umi CCCTCGACGC = 224 reads: +424 validated
umi CCGTTACTCA = 57 reads: +377 -47 non-validated
umi CGCTGCTCAA = 193 reads: +424 validated
umi CGGCGACCCG = 85 reads: +378 -2 +44 non-validated
umi CGGTCATGAT = 92 reads: +424 validated
umi CGTTCATGTG = 174 reads: +424 validated
umi CTAACCTAAT = 49 reads: +371 -36X +17 invalidated
umi CTATAGTAGT = 254 reads: +424 validated
umi CTCGTGGACG = 185 reads: +409 -1 +14 non-validated
umi CTGGAACAGG = 226 reads: +424 validated
umi CTGGTCTGTT = 292 reads: +424 validated
umi GAACGAATAA = 210 reads: +424 validated
umi GACTAAGCAG = 122 reads: +424 validated
umi GACTATACTG = 71 reads: +424 validated
umi GATACAATGC = 204 reads: +424 validated
umi GATCTAGTAG = 200 reads: +424 validated
umi GCATAAGCCC = 210 reads: +424 validated
umi GCCATCTGCG = 124 reads: +374 -6 +44 non-validated
umi GGCATAACGC = 168 reads: +424 validated
umi GGTGGGCTTC = 165 reads: +424 validated
umi GTGACCTCTC = 199 reads: +424 validated
umi GTTACGGATT = 260 reads: +424 validated
umi GTTATATCCT = 222 reads: +424 validated
umi TAAAGGCGGT = 94 reads: +420 -1X +3 invalidated
umi TAACGTAATC = 172 reads: +424 validated
umi TAATCGTTGA = 67 reads: +424 validated
umi TACACGGGCA = 182 reads: +424 validated
umi TACTAACCGA = 116 reads: +424 validated
umi TAGTTTCTCT = 44 reads: +392 -32 non-validated
umi TATTTCACCA = 154 reads: +424 validated
umi TCAACGATTT = 135 reads: +424 validated
umi TCGACTCTCT = 247 reads: +424 validated
umi TCGGGTTTAG = 199 reads: +424 validated
umi TCTCCACTTT = 182 reads: +424 validated
umi TGCCTTTGTT = 105 reads: +424 validated
umi TGCGCATTGG = 136 reads: +424 validated
umi TGGATTCCGT = 235 reads: +424 validated
umi TGGGGACTAT = 23 reads: +13 -12X +1 -2 +1 -2X +266 -1 +2 -1 +3 -1 +13 -30 +56 -1 +1 -2 +1 -2 +4 -1 +1 -1 +6 invalidated
umi TGTGACCATT = 211 reads: +424 validated
umi TTAATTTGGT = 122 reads: +325 -6 +86 -7 non-validated
umi TTCGGGGTCT = 242 reads: +424 validated
umi TTTTAGCTCG = 229 reads: +424 validated

UMI info for barcode AATCCAGTCCTTGCCA-1 contig 2 = GGAGAAGAGC...
umi AAAACATCTT = 348 reads: +382 validated
umi AAACTCCTCG = 275 reads: +382 validated
umi AAATCCTCAG = 329 reads: +382 validated
umi AACCCATACA = 384 reads: +382 validated
umi AACTGATCTC = 612 reads: -187X +195 invalidated
umi AACTGCAGGA = 423 reads: +382 validated
umi AATGTAAGCA = 147 reads: +382 validated
umi AATGTTGCTT = 357 reads: +382 validated
umi ACAAAATCTG = 440 reads: +382 validated
umi ACACTGCCTG = 334 reads: +382 validated
umi ACAGTTTCAA = 285 reads: +382 validated
umi ACATTGTCAG = 330 reads: +382 validated
umi ACCATTCATC = 308 reads: +382 validated
umi ACCTCTCTTG = 237 reads: +382 validated
umi ACCTTGATCC = 346 reads: +382 validated
umi ACCTTTACCT = 331 reads: +382 validated
umi ACGACAGCAG = 337 reads: +382 validated
umi ACGCGGGGAG = 252 reads: +382 validated
umi ACTGATGATT = 378 reads: +382 validated
umi ACTGCCCGGG = 221 reads: +382 validated
umi ACTTACTTGC = 225 reads: +382 validated
umi ACTTGGTAAT = 170 reads: +382 validated
umi AGACGCAGAA = 284 reads: +382 validated
umi AGCAGTTGCT = 410 reads: +382 validated
umi AGCCTGGTAC = 346 reads: +382 validated
umi AGGACATGTC = 274 reads: +382 validated
umi AGGTATACGG = 408 reads: +382 validated
umi AGGTGTATTA = 285 reads: +382 validated
umi AGTACTACTG = 226 reads: +382 validated
umi AGTATAACAT = 338 reads: +382 validated
umi ATAGTATTCA = 255 reads: +382 validated
umi ATCATGGTGC = 716 reads: -92X +290 invalidated
umi ATGCGATCGC = 298 reads: +382 validated
umi ATTAAGGCCT = 372 reads: +382 validated
umi ATTGCACTCT = 323 reads: +382 validated
umi ATTGTGATCT = 324 reads: +382 validated
umi CAACGCATGT = 281 reads: +382 validated
umi CAATTCGGGC = 441 reads: -310 +3 -4XX +1 -1XX +1 -2XX +2 -2XX +1 -4XX +2 -8XX +2 -1XX +38 invalidated
umi CACATAGCAG = 383 reads: +382 validated
umi CACATTAGCA = 308 reads: +382 validated
umi CACCGACCAT = 292 reads: +382 validated
umi CACTCGTCTG = 424 reads: +382 validated
umi CATTGCAGTC = 331 reads: +382 validated
umi CCAAGAGCGG = 368 reads: +382 validated
umi CCAAGATTAG = 367 reads: +382 validated
umi CCATATATCC = 152 reads: +382 validated
umi CCCGATACAA = 394 reads: +382 validated
umi CCTAAACTGG = 155 reads: +382 validated
umi CCTAGCAGCC = 366 reads: +382 validated
umi CCTCCCCTGT = 168 reads: +382 validated
umi CCTTCAGTCT = 259 reads: +382 validated
umi CGAATACCCT = 406 reads: +382 validated
umi CGACGCGTAT = 323 reads: +382 validated
umi CGACTCTTCG = 225 reads: +382 validated
umi CGCACATATA = 369 reads: +382 validated
umi CGCCACGCGT = 383 reads: +382 validated
umi CGCCATTGGT = 407 reads: +382 validated
umi CGCGTGCTAA = 395 reads: +382 validated
umi CGGACGAGTT = 270 reads: +382 validated
umi CGGCACCGAT = 285 reads: +382 validated
umi CGGCGCGCTC = 380 reads: +382 validated
umi CGTCGACCTT = 352 reads: +382 validated
umi CGTGAATCTA = 324 reads: +382 validated
umi CTAGACTCCG = 364 reads: +382 validated
umi CTATAATGCA = 307 reads: +382 validated
umi CTATACTCTA = 426 reads: +382 validated
umi CTCCAGGTTC = 401 reads: +382 validated
umi CTCGCTTGGC = 266 reads: +382 validated
umi CTGCTCTCCG = 294 reads: +382 validated
umi CTTCATGGTC = 329 reads: +382 validated
umi CTTTCCTCCA = 368 reads: +382 validated
umi CTTTTGACAG = 332 reads: +382 validated
umi GAATTACCAT = 316 reads: +382 validated
umi GACCATTGGG = 405 reads: +382 validated
umi GACGCATACC = 306 reads: +382 validated
umi GCAACACTTA = 320 reads: +382 validated
umi GCAGATTTGG = 388 reads: +382 validated
umi GCCCGCATGT = 674 reads: -231X +151 invalidated
umi GCTGACCCAA = 284 reads: +382 validated
umi GCTGCCCTGC = 322 reads: +382 validated
umi GGCACGCCGC = 147 reads: +382 validated
umi GGCGAAGTGC = 294 reads: +382 validated
umi GGGATCTGTG = 763 reads: +382 validated
umi GGTACACACG = 334 reads: +382 validated
umi GGTGCAATAT = 292 reads: +382 validated
umi GTATTTTGGG = 195 reads: +382 validated
umi GTCAGCCTCA = 366 reads: +382 validated
umi GTCGTACCGT = 358 reads: +382 validated
umi GTTGCACCTA = 368 reads: +382 validated
umi TAAGTGACCA = 351 reads: +382 validated
umi TAGGGCTCCA = 247 reads: +382 validated
umi TATCCCTGGC = 272 reads: +382 validated
umi TATTGCATAG = 264 reads: +382 validated
umi TCATCGCACG = 319 reads: +382 validated
umi TCCATCGCGG = 209 reads: +20 -1XX +361 invalidated
umi TCCTTGTGAA = 310 reads: +382 validated
umi TCGGTCGGAA = 404 reads: +382 validated
umi TCGGTCGGCA = 300 reads: +382 validated
umi TCTATTTGTG = 293 reads: +382 validated
umi TCTTAACGGG = 300 reads: +382 validated
umi TGAGGAGACA = 215 reads: +382 validated
umi TGGTCGCTTA = 323 reads: +382 validated
umi TGTGGCCCGG = 309 reads: +382 validated
umi TTGGCTTTTC = 338 reads: +382 validated
umi TTTCACGGCG = 333 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=665]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=23)
435-483 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
483-665 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 56 umis using 934 reads
cdr3 = CARILSFRDSSGYFDNW at 401, score = 9 + 7
umis assigned: [3, 9, 46, 101, 147, 190, 249, 264, 271, 315] and 56 others
of which 66 are surviving nonsolos
reads assigned: 10361
start codons at 59, 233, 257
confident = true

TIG 2[bases=554]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-373 ==> 0-337 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=10)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 104 umis using 5535 reads
cdr3 = CQQYDRSWTF at 360, score = 9 + 8
umis assigned: [0, 20, 38, 58, 72, 73, 137, 141, 148, 166] and 95 others
of which 105 are surviving nonsolos
reads assigned: 34236
start codons at 36, 370, 460
confident = true
now this is a cell
paired!

GACACCGCCATTTATTACTGTGCGAGAATCTTGTCGTTCCGTGATAGTAGTGGTTATTTTGACAACTGGGGTCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ACCATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGATAGGTCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.950 = AATCCAGTCGTCCAGG-1

using 280 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^3, 272]
surviving nonsolo ucounts = 1[272]
ids = [2]

====================================================================================

UMI info for barcode AATCCAGTCGTCCAGG-1 contig 1 = AGGAGTCAGT...
umi CTCAGTCTGT = 260 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=486]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-486 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYDNLPLTF at 354, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 27, 33, 89, 102, 241, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.954 = AATCCAGTCTAGAGTC-1

using 30 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[29]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.962 = AATCGGTAGAAACCAT-1

using 262 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[2, 3^3, 4, 246]
surviving nonsolo ucounts = 1[246]
ids = [5]

====================================================================================

UMI info for barcode AATCGGTAGAAACCAT-1 contig 1 = TGGGGCTGGG...
umi TATTCATGTC = 240 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=531]
45-383 ==> 0-338 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=16)
398-436 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=5)
436-531 ==> 0-95 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CSSYTNSTTPGVF at 369, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 45, 181, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.966 = AATCGGTAGAGACGAA-1

using 467 reads

====================================================================================

graph has 180 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[4, 6, 14, 441]
surviving nonsolo ucounts = 1[441]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=497]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-34 ==> 5703-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
33-78 ==> 0-45 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
78-324 ==> 102-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=5)
324-361 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
361-497 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQHATSPFTF at 300, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 438
start codons at 33, 184, 310, 403
confident = false
not full
full length transcript of length 497
VJ delta = 70
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.967 = AATCGGTAGATCCGAG-1

using 11152 reads

====================================================================================

graph has 6724 edges initially, 138 edges after simplification

total ucounts = 1126
nonsolo ucounts = 599[2^175, 3^99, 4^77, 5^33, 6^33, 7^32, 8^18, 9^18, 10^5, 11^14, 12^15, 13^11, 14^14, 15^4, 16, 17^5, 18^2, 19^5, 21^4, 24, 27, 30, 41, 54, 77, 102, 103, 123, 138, 184, 191, 197, 216, 217, 223, 225, 234, 235, 238, 245, 248, 259^2, 279, 290, 293, 307, 321, 340, 368, 377, 444, 769]
surviving nonsolo ucounts = 30[54, 77, 102, 103, 123, 138, 184, 191, 197, 216, 217, 223, 225, 234, 235, 238, 245, 248, 259^2, 279, 290, 293, 307, 321, 340, 368, 377, 444, 769]
ids = [294, 217, 482, 669, 831, 479, 332, 32, 91, 1096, ...]

====================================================================================

UMI info for barcode AATCGGTAGATCCGAG-1 contig 1 = GGGAGAGGAG...
umi ACATGTTTCG = 176 reads: +424 validated
umi AGCCGCTTCA = 238 reads: +424 validated
umi CAGAAATGCA = 55 reads: +6 -1 +382 -35 non-validated
umi CCCATACAGT = 236 reads: +424 validated
umi CGTACCTTAC = 136 reads: +424 validated
umi CGTATCACGT = 100 reads: +372 -52 non-validated
umi CTTCAACTTG = 253 reads: +424 validated
umi CTTCAGGCTT = 326 reads: +424 validated
umi GAGTTCGCTG = 339 reads: +424 validated
umi TAAAGTTCGA = 288 reads: +424 validated
umi TAATCTTCCT = 221 reads: +424 validated
umi TATTGATCTT = 122 reads: +424 validated
umi TCAATGTTGC = 360 reads: +424 validated
umi TGTAACATTG = 301 reads: +424 validated
umi TTCGAGCCGT = 262 reads: +424 validated

UMI info for barcode AATCGGTAGATCCGAG-1 contig 2 = AGGGCTGGTG...
umi AAGCCAGAGT = 192 reads: +388 validated
umi AGACGATGCC = 307 reads: +388 validated
umi ATCAATTCAC = 76 reads: +388 validated
umi CAATGCACAT = 246 reads: +388 validated
umi CATTCCTGGC = 161 reads: -10 +4 -18XX +1 -1XX +3 -6XX +345 invalidated
umi CCTTTGTTCG = 222 reads: +388 validated
umi GAAAAACAGC = 292 reads: +388 validated
umi GAAAGTCTAT = 259 reads: +388 validated
umi GGCTATCTGT = 99 reads: +388 validated
umi GTCTAAAGCG = 781 reads: -349X +2 -2XX +3 -1XX +31 invalidated
umi TAAATCAAAG = 454 reads: -141X +247 invalidated
umi TATAAAGGCT = 240 reads: +388 validated
umi TGTATGGGAT = 288 reads: -141X +247 invalidated
umi TGTGTATGAT = 217 reads: +388 validated
umi TTGTCAGGTG = 218 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=568]
0-73 ==> 7-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
73-424 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=0)
444-497 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=1)
497-568 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 13 umis using 253 reads
cdr3 = CARDRVAAAGYWYFDLW at 415, score = 9 + 7
umis assigned: [91, 164, 294, 370, 479, 482, 559, 561, 594, 751] and 5 others
of which 15 are surviving nonsolos
reads assigned: 3353
start codons at 73, 224, 229, 282, 287, 290, 308, 376
confident = true

TIG 2[bases=659]
0-60 ==> 26-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
60-413 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=5)
410-448 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
448-659 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 14 umis using 621 reads
cdr3 = CQSYDSSSVVF at 387, score = 6 + 8
umis assigned: [32, 147, 217, 277, 332, 435, 572, 573, 669, 722] and 5 others
of which 15 are surviving nonsolos
reads assigned: 3965
start codons at 60, 123, 214, 265, 397
confident = true
now this is a cell
paired!

GACACGGCTGTGTATTACTGTGCGAGAGATCGGGTAGCAGCAGCTGGTTACTGGTACTTCGATCTCTGGGGCCGTGGCACCCTGGTCACTGTCTCCTCAG <==> ATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATAGCAGCAGTGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.969 = AATCGGTAGCACCGTC-1

using 315 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 7[2^2, 3, 4^2, 5, 294]
surviving nonsolo ucounts = 1[294]
ids = [1]

====================================================================================

UMI info for barcode AATCGGTAGCACCGTC-1 contig 1 = AGGAGTCAGA...
umi CATGTTTCCT = 295 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=548]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=9)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQHNSYPAF at 354, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 27, 33, 89, 102, 334, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.971 = AATCGGTAGCCACCTG-1

using 72 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 10[2^2, 3, 4^2, 7, 9, 12^2, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.977 = AATCGGTAGCGCTTAT-1

using 1855 reads

====================================================================================

graph has 2250 edges initially, 50 edges after simplification

total ucounts = 543
nonsolo ucounts = 280[2^79, 3^48, 4^31, 5^19, 6^24, 7^10, 8^9, 9^4, 10^17, 11^8, 12^5, 13^4, 14^3, 15^7, 16^2, 17^3, 18, 19, 20^2, 22, 23, 27]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.978 = AATCGGTAGCTCAACT-1

using 350 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 7, 337]
surviving nonsolo ucounts = 1[337]
ids = [4]

====================================================================================

UMI info for barcode AATCGGTAGCTCAACT-1 contig 1 = GGGAGGAACT...
umi GCAGGCCGGC = 339 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=553]
0-35 ==> 62-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
35-380 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=10)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQHYNNWPYTF at 356, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 333
start codons at 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.984 = AATCGGTAGGGCACTA-1

using 11901 reads

====================================================================================

graph has 4303 edges initially, 58 edges after simplification

total ucounts = 377
nonsolo ucounts = 194[2^50, 3^27, 4^17, 5^13, 6^14, 7^9, 8^6, 9^5, 10^3, 11^3, 12^2, 13, 14^2, 15^2, 16, 17^2, 19, 21, 129, 130^2, 162, 164, 202, 219, 229, 234, 253, 257, 267, 276, 279, 294^2, 297, 298, 301, 304, 318, 330, 331, 334, 340, 352, 393, 398, 413, 422, 430, 441, 454, 535, 706]
surviving nonsolo ucounts = 33[129, 130, 164, 202, 219, 229, 234, 253, 257, 267, 276, 279, 294^2, 297, 298, 301, 304, 318, 330, 331, 334, 340, 352, 393, 398, 413, 422, 430, 441, 454, 535, 706]
ids = [19, 341, 256, 227, 342, 213, 82, 59, 313, 328, ...]

====================================================================================

UMI info for barcode AATCGGTAGGGCACTA-1 contig 1 = GGGAGAGGAG...
umi TGTCAGGCCT = 199 reads: +427 validated

UMI info for barcode AATCGGTAGGGCACTA-1 contig 2 = TGGGGAGAGC...
umi ACCCTGATTA = 131 reads: +388 validated
umi AGCTTTCCGT = 396 reads: +388 validated
umi ATACCACCAA = 253 reads: +388 validated
umi ATACGCGCTT = 706 reads: -172X +216 invalidated
umi ATCTGAGCGG = 277 reads: +388 validated
umi ATTACACAAC = 335 reads: +388 validated
umi ATTTTTTGTC = 233 reads: +388 validated
umi CAGCTTAGAA = 436 reads: +388 validated
umi CAGGACGGAC = 320 reads: +388 validated
umi CCGCTGGAGG = 419 reads: +388 validated
umi CGCACACGGT = 296 reads: +388 validated
umi CTGTTGAGGA = 409 reads: +388 validated
umi GACTCGCGGG = 295 reads: +388 validated
umi GACTGTCTCG = 300 reads: +388 validated
umi GAGCGCGGGT = 231 reads: +388 validated
umi GCCCTGCAAT = 203 reads: +388 validated
umi GGCTGTTGAG = 276 reads: +388 validated
umi GGTCTATATA = 164 reads: +388 validated
umi GTGCTATCCA = 351 reads: +388 validated
umi TAATCATGTA = 291 reads: +388 validated
umi TACTCTCAGA = 304 reads: +388 validated
umi TAGCTCTAAT = 398 reads: +388 validated
umi TCCTCTTGTT = 259 reads: +388 validated
umi TCGAGCGACG = 344 reads: +388 validated
umi TCTAGCAACT = 329 reads: +388 validated
umi TGAATCACTT = 266 reads: +388 validated
umi TGTAGCGGGC = 304 reads: +388 validated
umi TTGTCCATGT = 331 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=528]
0-73 ==> 7-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
73-424 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=25)
452-500 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
500-528 ==> 0-28 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CVKDRVSTGMYKGFFDYW at 415, score = 9 + 6
umis assigned: [342]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 73, 224, 267, 282, 287, 290, 376, 442
confident = true

TIG 2[bases=573]
0-49 ==> 0-49 on |289|IGKV3D-15|5'UTR| [len=49] (mis=3)
49-220 ==> 0-171 on |290|IGKV3D-15|L-REGION+V-REGION| [len=347] (mis=12)
223-399 ==> 171-347 on |290|IGKV3D-15|L-REGION+V-REGION| [len=347] (mis=11)
399-437 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
437-573 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 28 umis using 1447 reads
cdr3 = CQQYNTWPPITF at 373, score = 9 + 8
umis assigned: [19, 47, 59, 60, 69, 73, 82, 105, 107, 149] and 18 others
of which 28 are surviving nonsolos
reads assigned: 8735
start codons at 49, 118, 230, 479
confident = true
see insertion of CAA at pos 171 on |290|IGKV3D-15|L-REGION+V-REGION|
now this is a cell
paired!

ACGGCTGTGTATTTCTGTGTGAAGGATCGGGTGTCTACTGGGATGTACAAGGGCTTCTTTGACTACTGGGGCCAGGGAACCCTGGTCATCGTCTCCTCAG <==> AGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATACCTGGCCTCCGATCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.990 = AATCGGTAGTGTTAGA-1

using 1042 reads

====================================================================================

graph has 372 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3, 99, 368, 570]
surviving nonsolo ucounts = 3[99, 368, 570]
ids = [4, 3, 1]

====================================================================================

UMI info for barcode AATCGGTAGTGTTAGA-1 contig 1 = GGAGTCTCCC...
umi TATTATCCGT = 369 reads: +424 validated
umi TCTTGTGGGA = 95 reads: +321 -1 +101 -1 non-validated

UMI info for barcode AATCGGTAGTGTTAGA-1 contig 2 = TGGGGGGAGT...
umi GCATCTAGGA = 548 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=542]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=7)
437-483 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
483-542 ==> 0-59 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CARQSPLWAPGSPGDYW at 401, score = 8 + 7
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 454
start codons at 59, 233, 257, 392, 537
confident = false

TIG 2[bases=504]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=4)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=3)
381-419 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
419-504 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 80 reads
cdr3 = CQQYDNPLFTF at 358, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 536
start codons at 31, 37, 93, 106, 245, 368, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1001 = AATCGGTCACAGGAGT-1

using 256 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 3^2, 4, 242]
surviving nonsolo ucounts = 1[242]
ids = [4]

====================================================================================

UMI info for barcode AATCGGTCACAGGAGT-1 contig 1 = GGGGGGTCTC...
umi CTCCTTTTTA = 236 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=563]
40-392 ==> 0-352 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
393-431 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
431-563 ==> 0-132 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CSSYTSSSTPVVF at 364, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 40, 197, 241, 248, 251
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1003 = AATCGGTCACATCCGG-1

using 447 reads

====================================================================================

graph has 212 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 220, 224]
surviving nonsolo ucounts = 2[220, 224]
ids = [1, 2]

====================================================================================

UMI info for barcode AATCGGTCACATCCGG-1 contig 1 = ATCATCCAAC...
umi CCGGGTCCCG = 221 reads: +436 validated
umi GAAAAGTACA = 224 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=575]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=26)
443-494 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
494-575 ==> 0-81 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 2 umis using 53 reads
cdr3 = CARDSLLRDFDWTALRWFDPW at 400, score = 8 + 7
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 431
start codons at 58, 256, 293, 322, 355, 391, 447
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1020 = AATCGGTCAGGCGATA-1

using 303 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[303]
surviving nonsolo ucounts = 1[303]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=500]
0-307 ==> 27-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
311-349 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
349-500 ==> 0-151 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CQAWDSTEVVF at 288, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 267, 271
confident = false
not full
VJ delta = 21
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1024 = AATCGGTCAGTCCTTC-1

using 472 reads

====================================================================================

graph has 218 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 4, 5, 111, 345]
surviving nonsolo ucounts = 2[111, 345]
ids = [7, 1]

====================================================================================

UMI info for barcode AATCGGTCAGTCCTTC-1 contig 1 = ATACTTTCTG...
umi TCTCTATTCG = 113 reads: +427 validated

UMI info for barcode AATCGGTCAGTCCTTC-1 contig 2 = GGGGTCTCAG...
umi AAGCGATTTG = 341 reads: +385 validated
umi TGTATTCTGT = 2 reads: -85 +18 -1 +37 -2X +4 -2X +4 -1X +7 -1X +1 -2X +2 -218 invalidated

GOOD CONTIGS

TIG 1[bases=535]
0-37 ==> 64-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
37-393 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=13)
394-415 ==> 0-21 on |32|IGHD6-13|D-REGION| [len=21] (mis=1)
412-464 ==> 0-52 on |49|IGHJ1|J-REGION| [len=52] (mis=4)
464-535 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CARGGYSSSWSQYFQHW at 382, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 111
start codons at 37, 81
confident = false

TIG 2[bases=532]
0-38 ==> 4-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
38-379 ==> 0-341 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=15)
385-423 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
423-532 ==> 0-109 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CSSYAGASWVF at 362, score = 7 + 8
umis assigned: [1, 8]
of which 1 are surviving nonsolos
reads assigned: 336
start codons at 38, 189, 195, 246, 249, 345, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1027 = AATCGGTCATAGAAAC-1

using 51 reads

====================================================================================

graph has 52 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2, 4, 7, 11, 12^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1028 = AATCGGTCATCACAAC-1

using 228 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 221]
surviving nonsolo ucounts = 1[221]
ids = [3]

====================================================================================

UMI info for barcode AATCGGTCATCACAAC-1 contig 1 = AGGAGTCAGA...
umi CATGCATCTT = 221 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYNSYPWTF at 354, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 27, 33, 89, 102, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1029 = AATCGGTCATCCGTGG-1

using 122 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[122]
surviving nonsolo ucounts = 1[122]
ids = [0]

====================================================================================

UMI info for barcode AATCGGTCATCCGTGG-1 contig 1 = GAGCTGCTCA...
umi TAATCATCGG = 115 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=507]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-362 ==> 0-332 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=15)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-507 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQQYDVSPCSF at 354, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 115
start codons at 30, 126, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1031 = AATCGGTCATCGGGTC-1

using 385 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[8, 9, 366]
surviving nonsolo ucounts = 1[366]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=547]
0-24 ==> 7-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
0-24 ==> 6798-6822 on rc of segment before IGKV3-34 exon 2 [len=6822] (mis=0)
13-76 ==> 5678-5741 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
24-375 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=3)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 361
start codons at 24, 30, 86, 99, 238, 361, 453
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1036 = AATCGGTGTCAAAGCG-1

using 246 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 241]
surviving nonsolo ucounts = 1[241]
ids = [4]

====================================================================================

UMI info for barcode AATCGGTGTCAAAGCG-1 contig 1 = GAGTCAGTCC...
umi TCCAAGCTAG = 243 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 47 reads
cdr3 = CQQYDNLPLTF at 352, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 25, 31, 87, 100, 239, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1039 = AATCGGTGTCTAAACC-1

using 215 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 8[2^2, 3^3, 4, 6, 187]
surviving nonsolo ucounts = 1[187]
ids = [5]

====================================================================================

UMI info for barcode AATCGGTGTCTAAACC-1 contig 1 = GAGTCAGTCC...
umi GCGTTATTTG = 174 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=510]
31-279 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=39)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=4)
413-510 ==> 0-97 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CLHYDNRRRTF at 352, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 31, 87, 100, 239, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1044 = AATCGGTGTGCCTTGG-1

using 439 reads

====================================================================================

graph has 176 edges initially, 12 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 44, 133, 257]
surviving nonsolo ucounts = 3[44, 133, 257]
ids = [5, 6, 3]

====================================================================================

UMI info for barcode AATCGGTGTGCCTTGG-1 contig 1 = AAAACCACAC...
umi GTTGCGACGG = 246 reads: +436 validated

UMI info for barcode AATCGGTGTGCCTTGG-1 contig 2 = TCTGAGAGTC...
umi TTCGGTCGTC = 132 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=532]
0-49 ==> 10-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
49-402 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
451-485 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
485-532 ==> 0-47 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 391, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 49, 247, 252, 269, 313, 346
confident = false

TIG 2[bases=545]
10-381 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
395-443 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
443-545 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARGLNPLRKFDYW at 370, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 130
start codons at 10, 31, 75, 161, 461, 522
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1051 = AATCGGTGTTTCGCTC-1

using 552 reads

====================================================================================

graph has 194 edges initially, 48 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[250, 300]
surviving nonsolo ucounts = 2[250, 300]
ids = [2, 1]

====================================================================================

UMI info for barcode AATCGGTGTTTCGCTC-1 contig 1 = GGAGTCAGAC...
umi GATTTTCACA = 248 reads: +388 validated

UMI info for barcode AATCGGTGTTTCGCTC-1 contig 2 = GGGAATCAGT...
umi CCCACTTCGG = 301 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
376-414 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYNSYLFTF at 353, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 26, 32, 88, 101, 333, 456
confident = false

TIG 2[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=7)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CLQHKNYPWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 27, 33, 102, 184, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1052 = AATCGGTTCAAACAAG-1

using 284 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 5[2^2, 3, 5, 272]
surviving nonsolo ucounts = 1[272]
ids = [1]

====================================================================================

UMI info for barcode AATCGGTTCAAACAAG-1 contig 1 = AGTCTGGGCC...
umi ACTTTTGCAT = 263 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=513]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-373 ==> 0-333 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=9)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
422-513 ==> 0-91 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQVWDSGIYWGLF at 355, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 40, 101, 239, 242, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1054 = AATCGGTTCAGTTAGC-1

using 264 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 257]
surviving nonsolo ucounts = 1[257]
ids = [6]

====================================================================================

UMI info for barcode AATCGGTTCAGTTAGC-1 contig 1 = TGGGGACCCA...
umi TTAATTGGGC = 252 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=583]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=6)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
461-495 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
495-583 ==> 0-88 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 401, score = 7 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 59, 257, 262, 279, 323, 356, 549
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1071 = AATCGGTTCGTGGTCG-1

using 308 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2, 3, 4, 16, 282]
surviving nonsolo ucounts = 1[282]
ids = [5]

====================================================================================

UMI info for barcode AATCGGTTCGTGGTCG-1 contig 1 = ATCACATAAC...
umi GTCATTAGTC = 273 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=494]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=9)
412-430 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=2)
431-494 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
junction support: 1 umis using 15 reads
cdr3 = CARVGYSSSASYYYYYAMDVW at 400, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 58, 209, 256, 355, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1072 = AATCGGTTCGTTACAG-1

using 651 reads

====================================================================================

graph has 280 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 3^2, 282, 355]
surviving nonsolo ucounts = 2[282, 355]
ids = [8, 5]

====================================================================================

UMI info for barcode AATCGGTTCGTTACAG-1 contig 1 = GTCAGTCTCA...
umi GTATCCTCAT = 285 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQSYTTLLTF at 350, score = 9 + 9
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1073 = AATCGGTTCGTTGCCT-1

using 261 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[4, 5, 6, 7, 10, 12, 214]
surviving nonsolo ucounts = 1[214]
ids = [4]

====================================================================================

UMI info for barcode AATCGGTTCGTTGCCT-1 contig 1 = TGGGGGGGTA...
umi GGTATCTTTG = 210 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
40-348 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
428-557 ==> 0-129 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CVAWDDSLYAWVF at 361, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 207
start codons at 40, 344, 374, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1091 = ACACCAAAGATCCGAG-1

using 243 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 6, 231]
surviving nonsolo ucounts = 1[231]
ids = [3]

====================================================================================

UMI info for barcode ACACCAAAGATCCGAG-1 contig 1 = AGCTTCAGCT...
umi TAAAGTGTCT = 234 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=518]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
400-438 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
438-518 ==> 0-80 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CAAWDDSLNGSVVF at 368, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1108 = ACACCAAAGGTGATTA-1

using 16 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1118 = ACACCAAAGTGTGGCA-1

using 274 reads

====================================================================================

graph has 82 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 3^2, 5, 257]
surviving nonsolo ucounts = 1[257]
ids = [4]

====================================================================================

UMI info for barcode ACACCAAAGTGTGGCA-1 contig 1 = GGAGAAGAGC...
umi AATTCATCAG = 1 reads: -119 +24 -1X +3 -1X +2 -2X +5 -8X +1 -3X +1 -1X +2 -209X invalidated
umi ATCGTCCCAC = 256 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-372 ==> 0-336 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQYRNSITF at 360, score = 9 + 8
umis assigned: [0, 4]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 36, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1120 = ACACCAAAGTTATCGC-1

using 806 reads

====================================================================================

graph has 1157 edges initially, 6 edges after simplification

total ucounts = 406
nonsolo ucounts = 180[2^78, 3^43, 4^34, 5^14, 6^3, 7^3, 8^2, 9^2, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1122 = ACACCAAAGTTGTCGT-1

using 720 reads

====================================================================================

graph has 178 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[3, 67, 259, 383]
surviving nonsolo ucounts = 3[67, 259, 383]
ids = [9, 8, 5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=473]
2-81 ==> 5529-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
36-168 ==> 0-132 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
168-300 ==> 228-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
298-337 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
337-473 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQALQTPHTF at 276, score = 9 + 8
umis assigned: [5, 8]
of which 2 are surviving nonsolos
reads assigned: 639
start codons at 36, 69, 105, 259, 279, 379
confident = false
not full
full length transcript of length 473
VJ delta = 111
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1131 = ACACCAACACAGACTT-1

using 153 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 145]
surviving nonsolo ucounts = 1[145]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1132 = ACACCAACACAGTCGC-1

using 427 reads

====================================================================================

graph has 108 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 198, 219]
surviving nonsolo ucounts = 3[3, 198, 219]
ids = [5, 8, 4]

====================================================================================

UMI info for barcode ACACCAACACAGTCGC-1 contig 1 = GGAGTCAGAC...
umi TCGCCCTACT = 199 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=451]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
414-451 ==> 0-37 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQYNSYPLTF at 353, score = 8 + 9
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 26, 32, 88, 101, 237, 240, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1141 = ACACCAACAGCCAATT-1

using 188 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 3, 4^2, 169]
surviving nonsolo ucounts = 1[169]
ids = [7]

====================================================================================

UMI info for barcode ACACCAACAGCCAATT-1 contig 1 = CTGGGCCTAA...
umi CGCGTGTTTC = 164 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=499]
0-37 ==> 214-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
37-370 ==> 0-333 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=29)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
419-499 ==> 0-80 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQVWDSDGHYVVF at 352, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 37, 98, 167, 335, 371, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1144 = ACACCAACAGCTTAAC-1

using 190 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[188]
surviving nonsolo ucounts = 1[188]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=482]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=0)
390-428 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
428-482 ==> 0-54 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CGTWDSSLSA at 357, score = 7 + 4
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 182
start codons at 36, 190, 241, 365
confident = false
not full
frameshifted full length transcript of length 482
VJ delta = 9
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1148 = ACACCAACAGTCACTA-1

using 612 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2^3, 3, 595]
surviving nonsolo ucounts = 1[595]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=475]
0-341 ==> 10-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
342-381 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
381-475 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYDNLPLYTF at 317, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 574
start codons at 52, 65, 204, 327, 423
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1153 = ACACCAACATAGACTC-1

using 714 reads

====================================================================================

graph has 166 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 3^2, 187, 245, 269]
surviving nonsolo ucounts = 3[187, 245, 269]
ids = [7, 10, 5]

====================================================================================

UMI info for barcode ACACCAACATAGACTC-1 contig 1 = GGAGAAGAGC...
umi CGTCCACCCG = 265 reads: +382 validated
umi TTATACCTTG = 234 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=499]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-373 ==> 0-337 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=15)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-499 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 59 reads
cdr3 = CQQYDRSWTF at 360, score = 9 + 8
umis assigned: [5, 10]
of which 2 are surviving nonsolos
reads assigned: 496
start codons at 36, 370, 460
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1156 = ACACCAACATCACGAT-1

using 405 reads

====================================================================================

graph has 358 edges initially, 4 edges after simplification

total ucounts = 201
nonsolo ucounts = 94[2^47, 3^22, 4^11, 5^7, 6, 7, 8^2, 10^3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1171 = ACACCAAGTAGCCTCG-1

using 914 reads

====================================================================================

graph has 204 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[3, 7, 8, 890]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1181 = ACACCAAGTCACCTAA-1

using 212 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[212]
surviving nonsolo ucounts = 1[212]
ids = [0]

====================================================================================

UMI info for barcode ACACCAAGTCACCTAA-1 contig 1 = AGGAGTCAGA...
umi ACCACTGCTT = 210 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=463]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-463 ==> 0-48 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CQQYYSYSWTF at 354, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1183 = ACACCAAGTCATACTG-1

using 116 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[7, 104]
surviving nonsolo ucounts = 1[104]
ids = [2]

====================================================================================

UMI info for barcode ACACCAAGTCATACTG-1 contig 1 = GAGTGCTTTC...
umi TCCACACTTA = 102 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=500]
39-176 ==> 0-137 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=25)
176-302 ==> 140-266 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=30)
423-469 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=12)
469-500 ==> 0-31 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CARGPLVRGILGKGYYLDLW at 378, score = 8 + 6
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 102
start codons at 39, 83, 348
confident = false
see deletion of 3 bases at pos 137 on |197|IGHV4/OR15-8|L-REGION+V-REGION|
>vscore_4.1183_77.1%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGCGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1189 = ACACCAAGTGAAAGAG-1

using 1474 reads

====================================================================================

graph has 1872 edges initially, 38 edges after simplification

total ucounts = 689
nonsolo ucounts = 320[2^132, 3^81, 4^42, 5^29, 6^7, 7^14, 8^6, 9^2, 10^2, 11^3, 12, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1194 = ACACCAAGTGCACTTA-1

using 12876 reads

====================================================================================

graph has 3592 edges initially, 46 edges after simplification

total ucounts = 433
nonsolo ucounts = 235[2^84, 3^49, 4^18, 5^14, 6^3, 7^3, 8^3, 9, 10^2, 30, 32, 37, 44, 49, 70, 74, 75, 84, 115, 117, 119, 140, 150, 156, 158, 162, 164, 171, 173, 183, 184, 191, 193, 194, 195, 208, 215, 216, 217, 218, 224, 232, 233, 234, 239, 240, 244, 248, 252, 254^2, 259, 265, 266, 267, 269, 272, 275^3, 277, 289, 308, 332, 399, 470, 643]
surviving nonsolo ucounts = 53[37, 49, 70, 74, 84, 115, 117, 119, 140, 150, 156, 158, 162, 164, 171, 173, 183, 184, 193, 194, 195, 208, 215, 216, 217, 218, 224, 232, 233, 234, 239, 240, 244, 248, 252, 254^2, 259, 265, 266, 267, 269, 272, 275^3, 277, 289, 308, 332, 399, 470, 643]
ids = [68, 81, 223, 93, 413, 15, 216, 365, 60, 250, ...]

====================================================================================

UMI info for barcode ACACCAAGTGCACTTA-1 contig 1 = CCACATCCCT...
umi AAGTGATCTG = 122 reads: +26 -1XX +370 -18 invalidated
umi ACGGGTCTTC = 138 reads: +415 validated
umi ACTGATTCCC = 145 reads: +415 validated
umi ACTTGCCGTG = 35 reads: +270 -1 +68 -3 +69 -4 non-validated
umi AGATAGCCAT = 237 reads: -9X +1 -3X +3 -4XX +1 -1XX +2 -3XX +1 -5XX +1 -6XX +1 -1XX +373 invalidated
umi AGTCTACGGC = 48 reads: -5 +394 -16 non-validated
umi ATCAGGTCCG = 263 reads: +35 -1XX +1 -2XX +1 -2XX +1 -6XX +1 -15XX +1 -1XX +1 -2XX +1 -4XX +1 -2XX +1 -1XX +335 invalidated
umi ATCATAGCCG = 70 reads: +23 -1XX +308 -15 +68 invalidated
umi ATCTGCTTCT = 222 reads: +415 validated
umi CAGTGTAGGG = 189 reads: +411 -4 non-validated
umi CCCCGCTCCC = 284 reads: +165 -2XX +1 -2XX +5 -1XX +1 -3XX +1 -5XX +1 -31XX +1 -5XX +2 -1XX +1 -14XX +173 invalidated
umi CGCGGTACCA = 191 reads: +402 -1 +1 -1 +8 -1 +1 non-validated
umi CGTAGTTCTG = 306 reads: +415 validated
umi CGTTGGGTCT = 164 reads: +376 -39 non-validated
umi GTCTGCTTCA = 290 reads: +165 -2XX +1 -2XX +5 -1XX +1 -3XX +1 -5XX +1 -31XX +1 -5XX +2 -1XX +1 -14XX +173 invalidated
umi GTTGCTGGGG = 207 reads: +415 validated
umi TCACTAGTTA = 248 reads: +415 validated
umi TCATTGGCGG = 194 reads: +391 -24 non-validated
umi TCCACTATGC = 308 reads: +415 validated
umi TCCTTTGCTA = 120 reads: +415 validated
umi TGCGAGGCTG = 252 reads: +415 validated
umi TTGTTTGCCC = 266 reads: +415 validated

UMI info for barcode ACACCAAGTGCACTTA-1 contig 2 = AGGAGTCAGA...
umi AAAAACAGGA = 502 reads: -354X +2 -1XX +6 -2XX +15 -1XX +5 -1XX +1 invalidated
umi ACGAGTCTGC = 275 reads: +388 validated
umi ACGCGTCCAC = 473 reads: +388 validated
umi ATCTACCGTA = 238 reads: +388 validated
umi ATGCTAGCTG = 172 reads: +388 validated
umi ATGGTGTGGT = 165 reads: +388 validated
umi CAACATCCAA = 273 reads: +388 validated
umi CAAGAGTCGT = 213 reads: +388 validated
umi CACAACGATC = 182 reads: +388 validated
umi CATCTCGTGT = 217 reads: +388 validated
umi CCCTCGGTCT = 237 reads: +388 validated
umi CCTATACTAA = 264 reads: +388 validated
umi CGGTCAGGTC = 240 reads: +388 validated
umi CTAATCACGC = 118 reads: +388 validated
umi CTAGAGTTCT = 266 reads: +388 validated
umi CTCGTAATGA = 71 reads: +307 -1 +77 -1 +2 non-validated
umi GACACTGGAC = 150 reads: +388 validated
umi GTACTCACTT = 277 reads: +388 validated
umi GTCACGGCTC = 232 reads: +388 validated
umi TACGCTATGC = 215 reads: -343X +1 -4XX +1 -1XX +36 -1XX +1 invalidated
umi TACTTTGAGT = 231 reads: +388 validated
umi TCATATCGTA = 255 reads: +388 validated
umi TCCAGCCGTT = 194 reads: +121 -1XX +266 invalidated
umi TCCAGCGCTA = 155 reads: +388 validated
umi TCTGTTTCAG = 172 reads: +388 validated
umi TGAAGGCCGG = 222 reads: +388 validated
umi TGATCTCTCA = 214 reads: +388 validated
umi TTCATACTCC = 241 reads: +388 validated
umi TTGACCGCTT = 83 reads: +388 validated
umi TTTCTTGTCT = 289 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=528]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
42-395 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=1)
411-457 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
457-528 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 15 umis using 316 reads
cdr3 = CARVGIAVAGLGYW at 384, score = 9 + 7
umis assigned: [15, 60, 66, 68, 72, 81, 92, 93, 100, 150] and 12 others
of which 22 are surviving nonsolos
reads assigned: 4221
start codons at 42, 193, 198, 240, 245, 262, 339
confident = true

TIG 2[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 28 umis using 790 reads
cdr3 = CQQYYSYSWTF at 354, score = 8 + 8
umis assigned: [0, 53, 57, 99, 103, 107, 127, 131, 137, 157] and 20 others
of which 30 are surviving nonsolos
reads assigned: 6746
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = true
now this is a cell
paired!

AGATCTGAAGACACGGCTGTGTATTACTGTGCGAGAGTGGGTATAGCAGTGGCTGGCTTGGGCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTAATGATTTTGCAACTTATTACTGCCAACAGTATTATAGTTATTCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAGC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1203 = ACACCAAGTGTCAATC-1

using 241 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 2[5, 227]
surviving nonsolo ucounts = 1[227]
ids = [7]

====================================================================================

UMI info for barcode ACACCAAGTGTCAATC-1 contig 1 = ATCATCCAAC...
umi GGTCCTTCAC = 228 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=540]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
440-488 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
488-540 ==> 0-52 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 400, score = 8 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 58, 214, 256, 322, 355, 445
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1204 = ACACCAAGTGTCCTCT-1

using 204 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 21
nonsolo ucounts = 14[2^8, 3^2, 5, 6, 9, 155]
surviving nonsolo ucounts = 1[155]
ids = [8]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1207 = ACACCAAGTGTGTGCC-1

using 145 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3, 6, 31, 102]
surviving nonsolo ucounts = 1[102]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1214 = ACACCAATCAACCATG-1

using 166 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^4, 9, 146]
surviving nonsolo ucounts = 1[146]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1218 = ACACCAATCACTGGGC-1

using 273 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 268]
surviving nonsolo ucounts = 1[268]
ids = [3]

====================================================================================

UMI info for barcode ACACCAATCACTGGGC-1 contig 1 = GAGTCAGTCT...
umi TGGAAAATTC = 266 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=499]
0-25 ==> 22-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
25-376 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=14)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
413-499 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQSHRIPITF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1222 = ACACCAATCCACTCCA-1

using 214 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2^2, 5^2, 7, 8, 181]
surviving nonsolo ucounts = 1[181]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1228 = ACACCAATCCTATGTT-1

using 306 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2^2, 4, 5, 285]
surviving nonsolo ucounts = 1[285]
ids = [0]

====================================================================================

UMI info for barcode ACACCAATCCTATGTT-1 contig 1 = GGGAGTCATG...
umi AGGGCAACAA = 275 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=475]
7-239 ==> 0-232 on |184|IGHV4-34|L-REGION+V-REGION| [len=369] (mis=19)
404-446 ==> 7-49 on |56|IGHJ5|J-REGION| [len=49] (mis=2)
446-475 ==> 0-29 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CGRGPDISSLAAVDSW at 367, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 7, 72, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1246 = ACACCAATCTTCTGGC-1

using 204 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[201]
surviving nonsolo ucounts = 1[201]
ids = [2]

====================================================================================

UMI info for barcode ACACCAATCTTCTGGC-1 contig 1 = GAGGAATCAG...
umi CAGCGACAAC = 198 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=420]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 26 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 28, 34, 103, 239
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1249 = ACACCCTAGAAGGGTA-1

using 29135 reads

====================================================================================

graph has 9404 edges initially, 102 edges after simplification

total ucounts = 1671
nonsolo ucounts = 891[2^315, 3^190, 4^112, 5^65, 6^51, 7^23, 8^23, 9^8, 10^3, 11^5, 12, 13, 14^2, 15^2, 16, 17, 30, 48, 53, 55, 73, 121, 124, 136, 139, 155, 159, 163, 199, 203, 204, 206, 211, 217, 218, 224, 227, 239, 251^2, 252, 260, 261, 262, 269, 273, 281^2, 285, 286, 288^2, 289, 290, 291, 292, 294^2, 296, 299, 302, 303^2, 304, 305, 309, 310, 312^2, 313^2, 314, 316, 322, 328, 330, 334, 335, 336, 337^3, 338^2, 341, 342, 343^3, 344, 350, 356, 361, 365, 374, 385, 390, 403, 408, 409, 417, 523, 661, 775]
surviving nonsolo ucounts = 82[53, 55, 124, 136, 139, 155, 159, 163, 199, 203, 204, 206, 217, 218, 224, 227, 239, 251^2, 252, 260, 261, 262, 269, 273, 281^2, 285, 286, 288^2, 289, 290, 291, 292, 294^2, 296, 299, 302, 303^2, 304, 305, 309, 310, 312^2, 313, 314, 316, 322, 328, 330, 334, 335, 336, 337^3, 338^2, 341, 342, 343^3, 344, 350, 356, 361, 365, 374, 385, 390, 403, 408, 409, 417, 523, 661, 775]
ids = [518, 333, 1393, 45, 1327, 363, 758, 1366, 1409, 682, ...]

====================================================================================

UMI info for barcode ACACCCTAGAAGGGTA-1 contig 1 = GGGGAGGAAC...
umi AAAACCTTGT = 306 reads: +382 validated
umi AACATTTGTA = 139 reads: +382 validated
umi AAGCATACAT = 409 reads: +382 validated
umi AAGGAAAGAC = 298 reads: +382 validated
umi ACATAGAGTT = 389 reads: +382 validated
umi ACTTGGTTCG = 352 reads: +382 validated
umi AGAAGAAATA = 314 reads: +382 validated
umi AGGTAGGGGC = 605 reads: -341X +1 -2XX +1 -3XX +2 -1XX +6 -2XX +15 -1XX +7 invalidated
umi AGTCTCTCTT = 333 reads: +382 validated
umi AGTGCAACCA = 783 reads: -205X +177 invalidated
umi AGTTGGGGAA = 344 reads: +382 validated
umi ATAACTATCA = 306 reads: +310 -1XX +71 invalidated
umi ATAAGTTTTC = 309 reads: +382 validated
umi ATATATTCAA = 338 reads: +382 validated
umi ATATCAACTC = 155 reads: +382 validated
umi ATCACCATAC = 204 reads: +382 validated
umi ATCACCGCAA = 271 reads: +382 validated
umi ATCCTTAAGG = 338 reads: +382 validated
umi ATTAAGGGGC = 251 reads: +382 validated
umi ATTATGATGA = 415 reads: +382 validated
umi ATTCACAATA = 208 reads: +382 validated
umi ATTCGGGATC = 264 reads: +382 validated
umi CACTTATTGC = 381 reads: +382 validated
umi CAGTCTGCAT = 344 reads: +382 validated
umi CATAATGGAG = 335 reads: +382 validated
umi CATAGACATG = 343 reads: +382 validated
umi CATAGAGATC = 527 reads: +382 validated
umi CCATGTTCCT = 322 reads: +382 validated
umi CCGAATGCAT = 348 reads: +382 validated
umi CCGTTAGGGT = 290 reads: +382 validated
umi CCTAGCTAAG = 305 reads: +382 validated
umi CCTTACGGGG = 200 reads: +382 validated
umi CGACAGTTTT = 257 reads: +382 validated
umi CGACTGACTT = 262 reads: +382 validated
umi CGCTTTGGAA = 326 reads: +382 validated
umi CGGGTTCGGT = 290 reads: +382 validated
umi CGTAGAATGG = 303 reads: +382 validated
umi CGTCGGGCCG = 159 reads: +382 validated
umi CTAATCACAG = 285 reads: +382 validated
umi CTAGTAGGCG = 1 reads: -371 +3 -1X +7 invalidated
umi CTGGCCACCG = 299 reads: +382 validated
umi CTGTTCCTGT = 272 reads: +382 validated
umi CTTAATGGTT = 333 reads: +382 validated
umi CTTATCGTCA = 357 reads: +382 validated
umi CTTCAACTCA = 315 reads: +382 validated
umi CTTTATTTAA = 284 reads: +382 validated
umi GAATCTCCCA = 408 reads: +382 validated
umi GACCACACTA = 345 reads: +382 validated
umi GATCCTTAGG = 305 reads: +382 validated
umi GATGCGGCGG = 287 reads: +382 validated
umi GCCCTTACAT = 394 reads: +382 validated
umi GCCTTTATTA = 310 reads: +382 validated
umi GCGCAACGTC = 285 reads: +382 validated
umi GGCAGAGTTA = 318 reads: +382 validated
umi GGCCCCCTGT = 333 reads: +382 validated
umi GTAGGACCAA = 5 reads: -344X +1 -3X +2 -1X +6 -2X +15 -1X +7 invalidated
umi GTTAAACCGT = 294 reads: +382 validated
umi GTTTTGGTAG = 280 reads: +382 validated
umi TAGGAATAGG = 355 reads: +382 validated
umi TATTCCGACA = 336 reads: +382 validated
umi TCAAGTTCTG = 139 reads: -8 +374 non-validated
umi TCATTTTGTC = 165 reads: +382 validated
umi TCCATTACTG = 227 reads: +382 validated
umi TCCGTAGCGT = 123 reads: +382 validated
umi TCGACACCGA = 375 reads: +382 validated
umi TCTGGTCCTG = 370 reads: +382 validated
umi TGAAAATCGC = 254 reads: +382 validated
umi TTAAATCTCA = 303 reads: +382 validated
umi TTAACCGAGC = 341 reads: +382 validated
umi TTAAGTTGGC = 301 reads: +382 validated
umi TTGGTGTCTG = 297 reads: +382 validated
umi TTTCTATCGT = 347 reads: +382 validated
umi TTTTTCACCT = 359 reads: +382 validated

UMI info for barcode ACACCCTAGAAGGGTA-1 contig 2 = GAGCTCTGGG...
umi AATACTCATC = 237 reads: +433 validated
umi ATAAGCCGTA = 50 reads: -433 non-validated
umi CAGTCGGCTG = 53 reads: +294 -5 +68 -1 +29 -1 +11 -1 +1 -22 non-validated
umi CGTTGCACGA = 292 reads: +433 validated
umi GAGGCAATAG = 252 reads: +433 validated
umi GATCGTGGTC = 216 reads: +433 validated
umi GCCCTCGCGC = 216 reads: +433 validated
umi GGATCTGGCC = 218 reads: +433 validated
umi GTAGCGGCGC = 285 reads: +419 -14 non-validated
umi TCGCTGTGAA = 199 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 69 umis using 3412 reads
cdr3 = CQQRSNWPLTF at 357, score = 9 + 9
umis assigned: [3, 45, 66, 68, 155, 224, 226, 288, 309, 314] and 63 others
of which 71 are surviving nonsolos
reads assigned: 21996
start codons at 36, 241, 244, 460
confident = true

TIG 2[bases=584]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=0)
438-459 ==> 0-21 on |20|IGHD3-22|D-REGION| [len=31] (mis=1)
467-513 ==> 17-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
513-584 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 86 reads
cdr3 = CARDGRITMIVVAPGGMDVW at 422, score = 9 + 7
umis assigned: [90, 333, 518, 766, 930, 953, 1006, 1057, 1126, 1409]
of which 10 are surviving nonsolos
reads assigned: 1992
start codons at 80, 231, 236, 289, 294, 297, 315, 383, 432, 446, 470
confident = true

REJECT CONTIGS

TIG 1[bases=448]
1-297 ==> 2354-2650 on rc of segment before IGHD1-14 exon 1 [len=2650] (mis=0)
317-346 ==> 17-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
346-448 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [1266]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 73, 198, 364, 425
confident = false
did not find CDR3
now this is a cell
paired!

GTGTATTACTGTGCGAGAGATGGACGAATTACTATGATAGTAGTGGCCCCGGGGGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1250 = ACACCCTAGAATCTCC-1

using 537 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 3, 529]
surviving nonsolo ucounts = 1[529]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1253 = ACACCCTAGACAGACC-1

using 275 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 3^2, 5, 11, 246]
surviving nonsolo ucounts = 1[246]
ids = [8]

====================================================================================

UMI info for barcode ACACCCTAGACAGACC-1 contig 1 = AGTCAGTCTC...
umi TAAATGTGGC = 240 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=462]
24-377 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
412-462 ==> 0-50 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQSYTTPWTF at 351, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 24, 30, 99, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1258 = ACACCCTAGAGCCTAG-1

using 371 reads

====================================================================================

graph has 120 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[3^2, 4, 177^2]
surviving nonsolo ucounts = 2[177^2]
ids = [3, 10]

====================================================================================

UMI info for barcode ACACCCTAGAGCCTAG-1 contig 1 = GAGGAATCAG...
umi TCACTACAAC = 175 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=457]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-457 ==> 0-41 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 175
start codons at 28, 34, 103, 239
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1259 = ACACCCTAGAGCTTCT-1

using 638 reads

====================================================================================

graph has 158 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[3^3, 5^2, 275, 338]
surviving nonsolo ucounts = 2[275, 338]
ids = [3, 5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=434]
6-305 ==> 52-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=1)
304-342 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
342-434 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQHNSYPWTF at 281, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 29, 111, 165, 384
confident = false
not full
VJ delta = 14
not full

TIG 2[bases=473]
0-35 ==> 66-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
0-35 ==> 4708-4743 on rc of segment before IGHVII-28-1 exon 1 [len=4743] (mis=0)
0-35 ==> 4692-4727 on rc of segment before IGHVII-30-21 exon 1 [len=4727] (mis=0)
0-35 ==> 3481-3516 on rc of segment before IGHV3-60 exon 2 [len=3516] (mis=0)
0-35 ==> 3550-3585 on rc of segment before IGHV3-62 exon 2 [len=3585] (mis=0)
35-391 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=12)
390-421 ==> 0-31 on |14|IGHD2-2|D-REGION| [len=31] (mis=7)
414-473 ==> 0-59 on |59|IGHJ6|J-REGION| [len=63] (mis=4)
cdr3 = CARDRTVVVPAAISYYYYMDVW at 380, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 35, 79, 434
confident = false
VJ delta = 23
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1260 = ACACCCTAGAGGGATA-1

using 236 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 21
nonsolo ucounts = 6[2, 3^2, 4, 5, 204]
surviving nonsolo ucounts = 1[204]
ids = [17]

====================================================================================

UMI info for barcode ACACCCTAGAGGGATA-1 contig 1 = TGAGCGCAGA...
umi TGCAGTAGGA = 199 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=467]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-361 ==> 0-325 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=10)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
430-467 ==> 0-37 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CAVWDDSLDTGRGVF at 357, score = 7 + 8
umis assigned: [17]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 36, 190, 241, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1263 = ACACCCTAGAGTAATC-1

using 257 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 21
nonsolo ucounts = 8[2^5, 3^2, 228]
surviving nonsolo ucounts = 1[228]
ids = [15]

====================================================================================

UMI info for barcode ACACCCTAGAGTAATC-1 contig 1 = GGGGTCTCAG...
umi GTCATCCCTT = 229 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=489]
0-38 ==> 3-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
38-392 ==> 0-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
429-489 ==> 0-60 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CSSYTSSSTLVVF at 362, score = 8 + 8
umis assigned: [15]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 38, 195, 239, 246
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1270 = ACACCCTAGCCTTGAT-1

using 86 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[86]
surviving nonsolo ucounts = 1[86]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1272 = ACACCCTAGCGGATCA-1

using 66 reads

====================================================================================

graph has 96 edges initially, 4 edges after simplification

total ucounts = 14
nonsolo ucounts = 7[3, 7^3, 8, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1284 = ACACCCTAGGGTATCG-1

using 416 reads

====================================================================================

graph has 208 edges initially, 10 edges after simplification

total ucounts = 21
nonsolo ucounts = 11[2^2, 3^5, 5, 16, 25, 341]
surviving nonsolo ucounts = 3[16, 25, 341]
ids = [12, 3, 1]

====================================================================================

UMI info for barcode ACACCCTAGGGTATCG-1 contig 1 = GCTCTGCTTC...
umi AAAATTGGTG = 337 reads: +391 validated
umi CCCAGGGTTA = 16 reads: +175 -45 +83 -88 non-validated

GOOD CONTIGS

TIG 1[bases=540]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=23)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
442-540 ==> 0-98 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQSYDSSLNGSVF at 375, score = 9 + 8
umis assigned: [1, 12]
of which 2 are surviving nonsolos
reads assigned: 345
start codons at 51, 135, 208, 358, 385, 400
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1289 = ACACCCTAGTCATGCT-1

using 249 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2^2, 3^3, 4, 8, 220]
surviving nonsolo ucounts = 1[220]
ids = [10]

====================================================================================

UMI info for barcode ACACCCTAGTCATGCT-1 contig 1 = AGGAGTCAGA...
umi TTAAGTAGTA = 214 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=415]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
junction support: 1 umis using 21 reads
cdr3 = CQQYDSFSWTF at 354, score = 8 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 27, 33, 89, 102, 238, 241, 334, 364
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1296 = ACACCCTAGTGTCCAT-1

using 220 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 212]
surviving nonsolo ucounts = 1[212]
ids = [0]

====================================================================================

UMI info for barcode ACACCCTAGTGTCCAT-1 contig 1 = TGAGCGCAGA...
umi AATGATCGCG = 207 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=472]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=2)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-472 ==> 0-48 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CGTWDSSLSAWVF at 357, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1318 = ACACCCTCACAGACAG-1

using 132 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 125]
surviving nonsolo ucounts = 1[125]
ids = [1]

====================================================================================

UMI info for barcode ACACCCTCACAGACAG-1 contig 1 = AGCTCTGAGA...
umi ACATAATATG = 122 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=506]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
junction support: 1 umis using 5 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 121
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1322 = ACACCCTCACCAGCAC-1

using 13 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1337 = ACACCCTCAGACTCGC-1

using 3460 reads

====================================================================================

graph has 3558 edges initially, 90 edges after simplification

total ucounts = 1775
nonsolo ucounts = 797[2^403, 3^187, 4^85, 5^48, 6^31, 7^20, 8^12, 9^5, 10^2, 11, 12^2, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1338 = ACACCCTCAGAGCCAA-1

using 18 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1350 = ACACCCTCAGTCAGAG-1

using 211 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 9[2^4, 3^3, 4, 185]
surviving nonsolo ucounts = 1[185]
ids = [13]

====================================================================================

UMI info for barcode ACACCCTCAGTCAGAG-1 contig 1 = GAAGAGCTGC...
umi TTAGCGTCCC = 185 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=470]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-373 ==> 0-340 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
371-409 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
409-470 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQQYGKTF at 357, score = 9 + 8
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 33, 241, 367, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1361 = ACACCCTCATGGTTGT-1

using 39 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[39]
surviving nonsolo ucounts = 1[39]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=411]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-31 ==> 5706-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=24)
382-411 ==> 0-29 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 39
start codons at 30, 172, 364, 381
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1362 = ACACCCTCATGTCTCC-1

using 46 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 4, 38]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1368 = ACACCCTCATTGGCGC-1

using 1342 reads

====================================================================================

graph has 226 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^3, 265, 1067]
surviving nonsolo ucounts = 2[265, 1067]
ids = [1, 6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1375 = ACACCCTGTAATAGCA-1

using 237 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[2^3, 4, 7^2, 208]
surviving nonsolo ucounts = 1[208]
ids = [9]

====================================================================================

UMI info for barcode ACACCCTGTAATAGCA-1 contig 1 = AGAGCTCTGG...
umi TGATGAGCCC = 208 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=508]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
391-429 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
429-508 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQQYNNWPPWTF at 365, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 44, 113, 249, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1378 = ACACCCTGTACCTACA-1

using 261 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 4, 249]
surviving nonsolo ucounts = 1[249]
ids = [1]

====================================================================================

UMI info for barcode ACACCCTGTACCTACA-1 contig 1 = GAGAAGAGCT...
umi AACCTGCTAT = 244 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=443]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
382-420 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
420-443 ==> 0-23 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQQYGSSPFTF at 359, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 35, 243, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1388 = ACACCCTGTCCAGTTA-1

using 264 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^4, 7, 245]
surviving nonsolo ucounts = 1[245]
ids = [5]

====================================================================================

UMI info for barcode ACACCCTGTCCAGTTA-1 contig 1 = TGAGCGCAGA...
umi CTGAAACTGC = 242 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=478]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=0)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-478 ==> 0-54 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CGTWDSSLSAGVF at 357, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1392 = ACACCCTGTCGGCACT-1

using 283 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2^3, 3, 273]
surviving nonsolo ucounts = 1[273]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1400 = ACACCCTGTCTTCGTC-1

using 77 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[77]
surviving nonsolo ucounts = 1[77]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=356]
0-180 ==> 168-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
182-220 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
220-356 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYGSSPVSTF at 156, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 74
start codons at 40, 166, 262
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1409 = ACACCCTGTGGTAACG-1

using 501 reads

====================================================================================

graph has 424 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[500]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1416 = ACACCCTGTGTTGGGA-1

using 6890 reads

====================================================================================

graph has 3474 edges initially, 58 edges after simplification

total ucounts = 985
nonsolo ucounts = 697[2^138, 3^93, 4^74, 5^77, 6^67, 7^44, 8^41, 9^37, 10^31, 11^24, 12^17, 13^12, 14^8, 15^7, 16^3, 17^6, 18^2, 19, 20, 23, 24, 55, 147, 173, 178, 209, 231, 243, 244, 245, 269, 289^2]
surviving nonsolo ucounts = 11[55, 173, 178, 209, 231, 243, 244, 245, 269, 289^2]
ids = [535, 619, 62, 206, 860, 762, 369, 600, 125, 534, ...]

====================================================================================

UMI info for barcode ACACCCTGTGTTGGGA-1 contig 1 = AGAGCTCTGG...
umi AGATAGTATA = 287 reads: +198 -1XX +183 invalidated
umi ATCGCCCTAT = 208 reads: +382 validated
umi CGATAGCGCT = 242 reads: +382 validated
umi GATTCTATCG = 297 reads: +382 validated
umi GCAAGGACGT = 55 reads: +379 -1 +2 non-validated
umi GGCATGGACT = 244 reads: +382 validated
umi GGGCTCTAGT = 172 reads: +382 validated
umi TACCTTTCAG = 298 reads: +316 -1XX +65 invalidated
umi TATCTACTTC = 244 reads: +382 validated
umi TGCAGTTCAC = 231 reads: +382 validated

UMI info for barcode ACACCCTGTGTTGGGA-1 contig 2 = ACTTTCTGAG...
umi ACATAGGCTA = 180 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=562]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=11)
388-426 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 9 umis using 273 reads
cdr3 = CQQYNDWRWAF at 365, score = 9 + 7
umis assigned: [125, 206, 369, 534, 535, 600, 619, 724, 762, 860]
of which 10 are surviving nonsolos
reads assigned: 2218
start codons at 44, 113, 249, 378, 468
confident = true

TIG 2[bases=508]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=16)
391-422 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=7)
440-459 ==> 33-52 on |49|IGHJ1|J-REGION| [len=52] (mis=0)
459-508 ==> 0-49 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARVGASDDFWSGFYEYW at 374, score = 9 + 6
umis assigned: [62]
of which 1 are surviving nonsolos
reads assigned: 177
start codons at 35, 79, 417
confident = true
now this is a cell
paired!

ACGGCCGTGTATTTCTGTGCGAGAGTTGGGGCCTCTGACGATTTTTGGAGTGGTTTTTATGAGTACTGGGGCCAGGGAGTTCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGTCTGAAGATCTTGCAGTTTATTACTGTCAGCAGTATAATGACTGGCGGTGGGCGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1419 = ACACCCTGTTAGTGGG-1

using 229 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[229]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1422 = ACACCCTGTTCCATGA-1

using 19430 reads

====================================================================================

graph has 5722 edges initially, 84 edges after simplification

total ucounts = 1455
nonsolo ucounts = 706[2^316, 3^152, 4^67, 5^37, 6^27, 7^11, 8^8, 9^5, 10^3, 20, 21, 61, 79, 82, 87, 90, 108, 109, 110, 114, 128, 133, 137, 147^2, 160^2, 161, 162^2, 173, 178, 182, 185, 186, 188, 190, 192, 193, 194, 197, 198, 203, 205, 206^3, 212^2, 214, 216, 222, 224^2, 225^2, 229, 231, 233, 234, 235^2, 236, 240, 242, 244^2, 251^2, 254, 255, 259^2, 261, 264, 265, 267, 268, 270, 277, 289, 291, 302, 304, 308, 312, 362, 450, 505]
surviving nonsolo ucounts = 73[87, 90, 108, 109, 114, 128, 133, 137, 147^2, 160^2, 161, 162, 173, 178, 182, 185, 186, 188, 190, 192, 193, 194, 197, 198, 203, 205, 206^3, 212^2, 214, 216, 222, 224^2, 225^2, 229, 231, 233, 234, 235^2, 236, 240, 242, 244^2, 251^2, 254, 255, 259^2, 261, 264, 265, 267, 268, 270, 277, 289, 291, 302, 304, 308, 312, 362, 450, 505]
ids = [106, 703, 79, 837, 884, 93, 1244, 1179, 879, 1189, ...]

====================================================================================

UMI info for barcode ACACCCTGTTCCATGA-1 contig 1 = ATCACATAAC...
umi ACACTTACAC = 195 reads: +415 validated
umi ACCACAACTC = 234 reads: +415 validated
umi ACCCTGTCTG = 164 reads: +415 validated
umi ACCGTCTTCA = 108 reads: +365 -50 non-validated
umi ACGCTTATAG = 127 reads: +415 validated
umi ATACCCCTCT = 173 reads: +415 validated
umi CTTTTGCGCC = 92 reads: +325 -5 +63 -3 +1 -18 non-validated
umi GAAACATTCC = 191 reads: +415 validated
umi GAACAATATG = 479 reads: -364X +2 -1X +3 -3XX +1 -1XX +3 -2XX +9 -1XX +2 -1XX +3 -2XX +17 invalidated
umi GGCACCCACG = 193 reads: +415 validated
umi GGGTCCACAA = 116 reads: +372 -43 non-validated

UMI info for barcode ACACCCTGTTCCATGA-1 contig 2 = AGAGCTCTGG...
umi AACTCCTCAT = 220 reads: +388 validated
umi ACCTTAGTCA = 261 reads: +388 validated
umi ACTATGTAGT = 195 reads: +388 validated
umi ACTCATGGAG = 88 reads: +388 validated
umi ACTCGTCCTC = 307 reads: +388 validated
umi ACTTTCCGTT = 214 reads: +388 validated
umi AGAAGGAGTC = 453 reads: +388 validated
umi ATAACCGTCG = 206 reads: +388 validated
umi ATATCTAACT = 185 reads: +388 validated
umi ATGCGTCCTT = 158 reads: +293 -1XX +94 invalidated
umi ATTTACCCAC = 253 reads: +388 validated
umi CAAGATACAC = 219 reads: +388 validated
umi CACCAAGATC = 193 reads: +388 validated
umi CACTCTTCAT = 290 reads: +388 validated
umi CCAACCCCAG = 215 reads: +363 -3 +2 -1 +19 non-validated
umi CCACCTGCCC = 181 reads: +388 validated
umi CCCTTAGGGC = 238 reads: +388 validated
umi CCGGGCTACT = 260 reads: +388 validated
umi CCGTAGTCTC = 206 reads: +388 validated
umi CCTGCACGCC = 268 reads: +388 validated
umi CCTGCCTTTC = 236 reads: +388 validated
umi CGAACGGGCT = 361 reads: +388 validated
umi CGAGTCTCGG = 184 reads: +388 validated
umi CGCAGTGGCC = 130 reads: +279 -6 +56 -47 non-validated
umi CTCCATCTCA = 239 reads: +388 validated
umi CTCCGTGTGA = 160 reads: +388 validated
umi CTCGGTCCGT = 254 reads: +388 validated
umi CTGATGTAGG = 221 reads: +388 validated
umi CTGGCACAGT = 320 reads: +69 -1XX +318 invalidated
umi CTTATCCTCT = 303 reads: +388 validated
umi CTTGACCACC = 270 reads: +388 validated
umi GCCCGGTTCA = 232 reads: +388 validated
umi GCCTCCATCC = 263 reads: +388 validated
umi GGAAATCCGC = 109 reads: +388 validated
umi GGGACTCTTG = 308 reads: +388 validated
umi GGGCCATATG = 209 reads: +388 validated
umi GGGGGTCCAT = 148 reads: +388 validated
umi GTCTAGCCTA = 246 reads: +388 validated
umi GTTGTCATTC = 229 reads: +388 validated
umi GTTTGGCGGG = 186 reads: +388 validated
umi TACTATGCCC = 242 reads: +388 validated
umi TAGTTATTTC = 240 reads: +388 validated
umi TATAAGAGCG = 233 reads: +388 validated
umi TATACGGGAT = 298 reads: +18 -1XX +369 invalidated
umi TCAGACCACA = 222 reads: +388 validated
umi TCCATGTCAG = 262 reads: +388 validated
umi TCCGTCACTC = 208 reads: +388 validated
umi TCCGTGGTTT = 198 reads: +388 validated
umi TCCTTTTCGT = 231 reads: +388 validated
umi TCGAACCAGG = 140 reads: +388 validated
umi TCGAGCGCGT = 263 reads: +388 validated
umi TCGATTTGTC = 146 reads: +381 -7 non-validated
umi TGACGTCTCT = 135 reads: +388 validated
umi TGCAGCTGGA = 267 reads: +388 validated
umi TGGCCTTTCC = 278 reads: +388 validated
umi TGTAGATCCT = 189 reads: +388 validated
umi TTCGACTTTA = 210 reads: +388 validated
umi TTGCCGGTCC = 232 reads: +388 validated
umi TTTGTATCTA = 206 reads: +388 validated
umi TTTTTATTGC = 252 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=575]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=3)
410-427 ==> 0-17 on |9|IGHD1-20|D-REGION| [len=17] (mis=1)
425-473 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
473-575 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 7 umis using 73 reads
cdr3 = CATQYNWNDVVDYW at 400, score = 9 + 7
umis assigned: [41, 60, 74, 79, 93, 175, 703, 706, 710, 852] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2043
start codons at 58, 209, 256, 355, 491, 552
confident = true

TIG 2[bases=568]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
394-432 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 58 umis using 1558 reads
cdr3 = CQQYGSSPVSTF at 368, score = 9 + 8
umis assigned: [16, 85, 104, 106, 109, 121, 126, 168, 184, 211] and 50 others
of which 60 are surviving nonsolos
reads assigned: 13488
start codons at 44, 252, 378, 474
confident = true
now this is a cell
paired!

AGATCTGAGGACACGGCCGTGTATTACTGTGCGACCCAGTATAACTGGAACGACGTCGTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCGGTCTCCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1424 = ACACCCTGTTCCCTTG-1

using 344 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[4, 340]
surviving nonsolo ucounts = 1[340]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1426 = ACACCCTGTTGCGTTA-1

using 397 reads

====================================================================================

graph has 112 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[3, 138, 248]
surviving nonsolo ucounts = 2[138, 248]
ids = [6, 3]

====================================================================================

UMI info for barcode ACACCCTGTTGCGTTA-1 contig 1 = GTCAGTCTCA...
umi CTACCGCCTA = 239 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=479]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-479 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQSYTTLLTF at 350, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1427 = ACACCCTGTTGTCTTT-1

using 141 reads

====================================================================================

graph has 116 edges initially, 6 edges after simplification

total ucounts = 38
nonsolo ucounts = 24[2^5, 3^4, 4^3, 5^4, 6^2, 8, 9, 10, 11^2, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1432 = ACACCCTTCACTCCTG-1

using 46 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 6[2^2, 3, 4, 5, 21]
surviving nonsolo ucounts = 1[21]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1459 = ACACCCTTCCTTCAAT-1

using 177 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[177]
surviving nonsolo ucounts = 1[177]
ids = [0]

====================================================================================

UMI info for barcode ACACCCTTCCTTCAAT-1 contig 1 = GGCTGGGGTC...
umi GCATTCAGAG = 177 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=435]
42-386 ==> 0-344 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=20)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
junction support: 1 umis using 9 reads
cdr3 = CSSYISSTTLGF at 366, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 175
start codons at 42, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1461 = ACACCCTTCGAGAGCA-1

using 655 reads

====================================================================================

graph has 258 edges initially, 6 edges after simplification

total ucounts = 23
nonsolo ucounts = 10[2^3, 4^2, 5, 7, 172, 180, 264]
surviving nonsolo ucounts = 3[172, 180, 264]
ids = [17, 13, 16]

====================================================================================

UMI info for barcode ACACCCTTCGAGAGCA-1 contig 1 = AGCTTCAGCT...
umi TCACGTCAGC = 264 reads: +388 validated

UMI info for barcode ACACCCTTCGAGAGCA-1 contig 2 = GAGAGAGGAG...
umi GGGATACCCG = 178 reads: +424 validated
umi TTGATACCCC = 2 reads: -72 +1 -1 +1 -1 +4 -1 +1 -1 +1 -2 +1 -1 +1 -2 +1 -4X +1 -2 +2 -1X +1 -1 +5 -1 +1 -2 +1 -1 +4 -1 +2 -1 +1 -1X +2 -297 invalidated

GOOD CONTIGS

TIG 1[bases=495]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-495 ==> 0-60 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [16]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=504]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
junction support: 1 umis using 10 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [13, 21]
of which 1 are surviving nonsolos
reads assigned: 174
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1470 = ACACCCTTCGTACCGG-1

using 50 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 7[2^3, 3^2, 4, 22]
surviving nonsolo ucounts = 1[22]
ids = [18]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1473 = ACACCCTTCGTCCAGG-1

using 251 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 10[2^5, 3^2, 5, 6, 216]
surviving nonsolo ucounts = 1[216]
ids = [8]

====================================================================================

UMI info for barcode ACACCCTTCGTCCAGG-1 contig 1 = GAAGAGCTGC...
umi CTTTGTCTTT = 216 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=467]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
418-467 ==> 0-49 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYGSSPTTF at 357, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1474 = ACACCCTTCGTCTGAA-1

using 65 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 30
nonsolo ucounts = 17[2^7, 3^5, 4^2, 5^3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1480 = ACACCCTTCTCAACTT-1

using 54 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[54]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1493 = ACACCCTTCTTGTATC-1

using 216 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^3, 3, 4, 197]
surviving nonsolo ucounts = 1[197]
ids = [9]

====================================================================================

REJECT CONTIGS

TIG 1[bases=398]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-34 ==> 5703-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 33, 241, 367
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1495 = ACACCCTTCTTTAGGG-1

using 194 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2^3, 5, 176]
surviving nonsolo ucounts = 1[176]
ids = [2]

====================================================================================

UMI info for barcode ACACCCTTCTTTAGGG-1 contig 1 = AGCTTCAGCT...
umi AGCTGGGCTT = 173 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=446]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
junction support: 1 umis using 11 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 171
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1499 = ACACCGGAGAAGGACA-1

using 198 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[197]
surviving nonsolo ucounts = 1[197]
ids = [1]

====================================================================================

UMI info for barcode ACACCGGAGAAGGACA-1 contig 1 = CTGGGCCTCA...
umi ATAAACGCAA = 199 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=489]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-371 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
413-489 ==> 0-76 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQAWDSTEVVF at 352, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 37, 42, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1501 = ACACCGGAGACGACGT-1

using 242 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 236]
surviving nonsolo ucounts = 1[236]
ids = [5]

====================================================================================

UMI info for barcode ACACCGGAGACGACGT-1 contig 1 = GAGGAATCAG...
umi GTAATATTCA = 228 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=458]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-458 ==> 0-42 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 28, 34, 103, 239
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1512 = ACACCGGAGCCAGAAC-1

using 197 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2^3, 6, 178]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1525 = ACACCGGAGGAGTCTG-1

using 217 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 212]
surviving nonsolo ucounts = 1[212]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1529 = ACACCGGAGGCGATAC-1

using 443 reads

====================================================================================

graph has 134 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[3, 4, 180, 249]
surviving nonsolo ucounts = 2[180, 249]
ids = [6, 3]

====================================================================================

UMI info for barcode ACACCGGAGGCGATAC-1 contig 1 = TCTGGCACCA...
umi GAACTACGCT = 246 reads: +391 validated

UMI info for barcode ACACCGGAGGCGATAC-1 contig 2 = TGGGGAGGAA...
umi GCACAACAAA = 1 reads: -37 +1 -2 +1 -2X +3 -3X +1 -1 +1 -1 +1 -1 +2 -1 +1 -3 +9 -2 +4 -2X +1 -2 +1 -2 +2 -1 +3 -1X +1 -295 invalidated
umi GCACCACTAA = 179 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=523]
0-34 ==> 0-34 on |387|IGLV7-46|5'UTR| [len=34] (mis=0)
34-385 ==> 0-351 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=2)
387-425 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
425-523 ==> 0-98 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLLSYSGARPRVF at 358, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 34, 242, 341
confident = false

TIG 2[bases=497]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-497 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [5, 6]
of which 1 are surviving nonsolos
reads assigned: 175
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1535 = ACACCGGAGTGAACGC-1

using 214 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2, 3, 4^2, 6, 193]
surviving nonsolo ucounts = 1[193]
ids = [7]

====================================================================================

UMI info for barcode ACACCGGAGTGAACGC-1 contig 1 = GTCAGTCCCA...
umi TTTCTAATTG = 186 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=478]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
408-478 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQYDNLPTF at 350, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 23, 29, 85, 98, 237, 360, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1542 = ACACCGGAGTTGCAGG-1

using 9 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1543 = ACACCGGAGTTGTCGT-1

using 275 reads

====================================================================================

graph has 70 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 50, 221]
surviving nonsolo ucounts = 2[50, 221]
ids = [0, 1]

====================================================================================

UMI info for barcode ACACCGGAGTTGTCGT-1 contig 1 = GGGAATCAGT...
umi CGATGCCACC = 221 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=479]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-479 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1547 = ACACCGGCAAGCTGAG-1

using 126 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3, 4, 5, 112]
surviving nonsolo ucounts = 1[112]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1556 = ACACCGGCACATCCGG-1

using 309 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2^3, 3^2, 6, 288]
surviving nonsolo ucounts = 1[288]
ids = [8]

====================================================================================

UMI info for barcode ACACCGGCACATCCGG-1 contig 1 = GGGGAGGAAT...
umi TCGCTGCGGT = 279 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=500]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-500 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1561 = ACACCGGCACCATGTA-1

using 71 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 12[2, 3^2, 4^2, 5, 6^3, 7, 9, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1563 = ACACCGGCACCGGAAA-1

using 61 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 8, 50]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1568 = ACACCGGCAGACAGGT-1

using 200 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 7[2^5, 3, 175]
surviving nonsolo ucounts = 1[175]
ids = [1]

====================================================================================

UMI info for barcode ACACCGGCAGACAGGT-1 contig 1 = GCTGGGGTCT...
umi ATACCACCTT = 176 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-392 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
429-490 ==> 0-61 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CSSYTSSSTMVF at 365, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 174
start codons at 41, 198, 242, 249, 392
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1576 = ACACCGGCAGCTGTGC-1

using 1675 reads

====================================================================================

graph has 1394 edges initially, 16 edges after simplification

total ucounts = 486
nonsolo ucounts = 199[2^86, 3^52, 4^31, 5^14, 6^7, 7^3, 8^2, 9, 12, 239, 526]
surviving nonsolo ucounts = 2[239, 526]
ids = [138, 87]

====================================================================================

UMI info for barcode ACACCGGCAGCTGTGC-1 contig 1 = AGTCTCAGTC...
umi ATTCTGAATT = 234 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=422]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=10)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
junction support: 1 umis using 32 reads
cdr3 = CQQSYTTLLTF at 347, score = 9 + 9
umis assigned: [138]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 20, 26, 82, 95, 231
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1579 = ACACCGGCAGGCTGAA-1

using 92 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 29
nonsolo ucounts = 14[2^2, 3^3, 4, 5^3, 6, 7, 9, 10, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1581 = ACACCGGCAGGGTTAG-1

using 5359 reads

====================================================================================

graph has 5114 edges initially, 72 edges after simplification

total ucounts = 1175
nonsolo ucounts = 863[2^160, 3^128, 4^109, 5^94, 6^62, 7^76, 8^57, 9^45, 10^33, 11^30, 12^14, 13^20, 14^9, 15^13, 16, 17^6, 19^2, 20, 22, 24, 41]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1583 = ACACCGGCAGTAAGAT-1

using 6979 reads

====================================================================================

graph has 6346 edges initially, 154 edges after simplification

total ucounts = 1664
nonsolo ucounts = 1191[2^264, 3^163, 4^157, 5^135, 6^90, 7^102, 8^76, 9^55, 10^43, 11^29, 12^29, 13^16, 14^8, 15^6, 16^6, 17^3, 18^4, 19^3, 20, 25]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1591 = ACACCGGCATCAGTAC-1

using 174 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 8[3^3, 5, 6, 7, 8, 133]
surviving nonsolo ucounts = 1[133]
ids = [7]

====================================================================================

UMI info for barcode ACACCGGCATCAGTAC-1 contig 1 = GCTCTGCTTC...
umi GAAGCACTTG = 128 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=483]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=20)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-483 ==> 0-41 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CQCYDNSLTGWGF at 375, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 128
start codons at 51, 205, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1592 = ACACCGGCATCCGTGG-1

using 299 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[299]
surviving nonsolo ucounts = 1[299]
ids = [0]

====================================================================================

UMI info for barcode ACACCGGCATCCGTGG-1 contig 1 = GCTGCTCAGT...
umi TGATAATCTA = 292 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=505]
0-28 ==> 24-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
28-360 ==> 0-332 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=15)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
413-505 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYDVSPCSF at 352, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 28, 124, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1594 = ACACCGGCATCGGTTA-1

using 45 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[45]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1599 = ACACCGGCATTCCTGC-1

using 58 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 3, 49]
surviving nonsolo ucounts = 1[49]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=447]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=16)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 46
start codons at 47, 201, 351, 376, 381
confident = false
not full
full length stopped transcript of length 447
frameshifted full length stopped transcript of length 447
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1612 = ACACCGGGTCAGTGGA-1

using 363 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[5, 6, 351]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1613 = ACACCGGGTCCGAACC-1

using 103 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 100]
surviving nonsolo ucounts = 1[100]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1623 = ACACCGGGTCTGCCAG-1

using 158 reads

====================================================================================

graph has 77 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 3, 145]
surviving nonsolo ucounts = 1[145]
ids = [9]

====================================================================================

UMI info for barcode ACACCGGGTCTGCCAG-1 contig 1 = GCTGGGGTCT...
umi TAGCCATGGG = 145 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=468]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-389 ==> 0-348 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
394-432 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
432-468 ==> 0-36 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CSSYTSSSSHYVF at 365, score = 8 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 144
start codons at 41, 198, 242, 249, 396
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1626 = ACACCGGGTGACTACT-1

using 120 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2^2, 3, 4, 102]
surviving nonsolo ucounts = 1[102]
ids = [9]

====================================================================================

REJECT CONTIGS

TIG 1[bases=475]
0-30 ==> 71-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
0-30 ==> 4713-4743 on rc of segment before IGHVII-28-1 exon 1 [len=4743] (mis=0)
0-30 ==> 4697-4727 on rc of segment before IGHVII-30-21 exon 1 [len=4727] (mis=0)
0-30 ==> 3486-3516 on rc of segment before IGHV3-60 exon 2 [len=3516] (mis=0)
0-30 ==> 3555-3585 on rc of segment before IGHV3-62 exon 2 [len=3585] (mis=0)
30-386 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=23)
398-425 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=2)
431-475 ==> 14-58 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
cdr3 = CARDLESSYYYGSGTYYNSYMDVW at 375, score = 9 + 7
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 98
start codons at 30, 74, 406, 435, 451
confident = false
VJ delta = 21
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1627 = ACACCGGGTGCACGAA-1

using 7 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[7]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1628 = ACACCGGGTGCAGACA-1

using 19 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1629 = ACACCGGGTGCGATAG-1

using 490 reads

====================================================================================

graph has 605 edges initially, 51 edges after simplification

total ucounts = 280
nonsolo ucounts = 104[2^56, 3^22, 4^9, 5^11, 6, 7^2, 8^2, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1630 = ACACCGGGTGGAAAGA-1

using 257 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[5^2, 245]
surviving nonsolo ucounts = 1[245]
ids = [3]

====================================================================================

UMI info for barcode ACACCGGGTGGAAAGA-1 contig 1 = GAGAAGAGCT...
umi TGGAATACTG = 248 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
382-420 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQYGSSLITF at 359, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 35, 243, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1634 = ACACCGGGTTACCAGT-1

using 708 reads

====================================================================================

graph has 208 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 3[2, 5, 691]
surviving nonsolo ucounts = 1[691]
ids = [7]

====================================================================================

UMI info for barcode ACACCGGGTTACCAGT-1 contig 1 = CTCAGGACAC...
umi GTTTATGCTC = 674 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=482]
13-364 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
362-401 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
401-482 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 108 reads
cdr3 = CLQDYTYPFSF at 340, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 670
start codons at 13, 19, 75, 88, 170, 173, 443
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1639 = ACACCGGGTTGACGTT-1

using 285 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 4, 274]
surviving nonsolo ucounts = 1[274]
ids = [4]

====================================================================================

UMI info for barcode ACACCGGGTTGACGTT-1 contig 1 = AGTCAGTCCC...
umi GTTTGCACAC = 271 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=489]
0-24 ==> 7-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
24-375 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=27)
373-412 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
412-489 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQSFDNLPYIF at 351, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 24, 30, 405, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1640 = ACACCGGGTTGTGGAG-1

using 325 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^3, 315]
surviving nonsolo ucounts = 1[315]
ids = [3]

====================================================================================

UMI info for barcode ACACCGGGTTGTGGAG-1 contig 1 = GGAACTGCTC...
umi CCAGTCTTAT = 310 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=501]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=39)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
413-501 ==> 0-88 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYYNYPRTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1647 = ACACCGGTCACGACTA-1

using 15 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1650 = ACACCGGTCAGCACAT-1

using 11373 reads

====================================================================================

graph has 4031 edges initially, 136 edges after simplification

total ucounts = 684
nonsolo ucounts = 306[2^129, 3^55, 4^37, 5^17, 6^13, 7^2, 8^3, 10, 13^2, 14, 35, 71, 77, 91, 103, 111, 128, 138, 149, 159, 162, 168^2, 171, 174, 180, 183, 188, 189^2, 192^2, 193, 202, 206^2, 213, 219, 222, 231^2, 233, 235, 239, 246^2, 260, 261^2, 263, 269, 318, 321, 467, 697, 716]
surviving nonsolo ucounts = 44[71, 77, 91, 103, 111, 128, 138, 149, 159, 162, 168, 171, 174, 180, 183, 188, 189^2, 192^2, 193, 202, 206^2, 213, 219, 222, 231^2, 233, 235, 239, 246^2, 260, 261^2, 263, 269, 318, 321, 467, 697, 716]
ids = [281, 631, 608, 61, 74, 290, 288, 296, 542, 602, ...]

====================================================================================

UMI info for barcode ACACCGGTCAGCACAT-1 contig 1 = GAGCTCTGGG...
umi ACATGTCATC = 103 reads: +387 -1 +1 -1 +28 non-validated
umi ACTACCCTTC = 173 reads: +362 -1 +13 -1 +9 -1 +6 -1 +1 -1 +2 -2 +7 -1 +7 -1 +2 non-validated
umi CCATCGGGGC = 208 reads: +389 -29 non-validated
umi CGATTTTCCG = 193 reads: +198 -2XX +1 -1XX +1 -1X +119 -1 +13 -81 invalidated
umi CGCACACTCT = 217 reads: +382 -36 non-validated
umi CGGACGCTAC = 70 reads: +402 -16 non-validated
umi CTGCCGCCAT = 189 reads: +418 validated
umi GTTTTACTCC = 167 reads: +418 validated
umi TGCGTTGCAC = 224 reads: +403 -15 non-validated
umi TGTCGGTCAT = 70 reads: -6 +403 -9 non-validated

UMI info for barcode ACACCGGTCAGCACAT-1 contig 2 = GGGGAGGAGT...
umi AAGGCGGCCC = 191 reads: +388 validated
umi ACAAGTATCC = 266 reads: +388 validated
umi ACATGTTCCT = 242 reads: +388 validated
umi ACGAAACCGT = 112 reads: +388 validated
umi ACGACTCAGT = 260 reads: +388 validated
umi AGGCTTTATG = 234 reads: +388 validated
umi ATGCGCATGC = 97 reads: +17 -1XX +23 -1XX +9 -2XX +14 -1XX +21 -1XX +14 -1XX +5 -1XX +20 -1XX +2 -1XX +1 -1XX +3 -1XX +6 -2XX +8 -1XX +21 -1XX +18 -1XX +4 -1XX +2 -1XX +5 -1XX +1 -11XX +3 -3XX +1 -2XX +8 -1XX +14 -1XX +20 -1XX +3 -1XX +13 -1XX +2 -1XX +2 -1XX +2 -37X +1 -1X +1 -2X +3 -1X +1 -3X +8 -2XX +8 -1XX +14 invalidated
umi CACAAAAGGC = 197 reads: +388 validated
umi CCACCCATCC = 192 reads: +388 validated
umi CCCATGACTC = 194 reads: +383 -5 non-validated
umi CCTATCGGTA = 188 reads: +388 validated
umi CGCTATTCCT = 244 reads: +388 validated
umi CGTCTAGGGC = 136 reads: +388 validated
umi CGTGAGTGGT = 127 reads: +388 validated
umi GACTGAACTT = 259 reads: +388 validated
umi GAGTTCCCTA = 320 reads: +388 validated
umi GTGTTGAACT = 204 reads: +388 validated
umi TACATTCGGG = 225 reads: +388 validated
umi TCTCGACTAT = 246 reads: +388 validated
umi TGCGGTCAAG = 91 reads: +388 validated
umi TGGCATTTTA = 317 reads: +388 validated
umi TGGTAACCAC = 247 reads: +388 validated
umi TGGTATTTCC = 233 reads: +388 validated
umi TGTGTAGCTC = 172 reads: +388 validated
umi TTATTAATAG = 261 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=569]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=0)
450-498 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
498-569 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 3 umis using 20 reads
cdr3 = CARDQDTAMTYFDYW at 422, score = 9 + 7
umis assigned: [61, 85, 227, 268, 270, 281, 326, 495, 610, 631]
of which 10 are surviving nonsolos
reads assigned: 1579
start codons at 80, 231, 236, 289, 294, 297, 315, 383, 446
confident = true

TIG 2[bases=555]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 23 umis using 592 reads
cdr3 = CQQYDNLPLTF at 358, score = 9 + 9
umis assigned: [33, 53, 62, 74, 75, 108, 140, 175, 220, 231] and 15 others
of which 24 are surviving nonsolos
reads assigned: 5199
start codons at 31, 37, 93, 106, 245, 368, 461
confident = true

REJECT CONTIGS

TIG 1[bases=646]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
397-435 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
435-646 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=2)
umis assigned: [132, 331, 368, 519, 542, 634]
of which 6 are surviving nonsolos
reads assigned: 2108
start codons at 46, 200, 350, 375, 380
confident = false
did not find CDR3

TIG 2[bases=568]
0-72 ==> 7074-7146 on rc of segment before IGHVII-30-1 exon 1 [len=7146] (mis=2)
0-72 ==> 7068-7140 on rc of segment before IGHVII-33-1 exon 1 [len=7140] (mis=2)
0-72 ==> 6893-6965 on rc of segment before IGHVII-62-1 exon 1 [len=6965] (mis=2)
41-108 ==> 6507-6574 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=2)
72-425 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=8)
422-443 ==> 0-21 on |13|IGHD2-15|D-REGION| [len=31] (mis=2)
449-497 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
497-568 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CITVLWGIVVVVDSYYFDYW at 406, score = 4 + 7
umis assigned: [292, 296, 530, 602]
of which 4 are surviving nonsolos
reads assigned: 994
start codons at 72, 223, 228, 286, 289, 307, 375
confident = false
frameshifted full length stopped transcript of length 568
VJ delta = 16
not full
not full
now this is a cell
paired!

GCCGAGGACACGGCTGTGTATTACTGTGCGAGAGATCAGGATACAGCTATGACGTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1651 = ACACCGGTCAGCATGT-1

using 131 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[127]
surviving nonsolo ucounts = 1[127]
ids = [1]

====================================================================================

UMI info for barcode ACACCGGTCAGCATGT-1 contig 1 = ATACTTTCTG...
umi GAGAGACCTA = 123 reads: +411 -1 +3 non-validated

GOOD CONTIGS

TIG 1[bases=453]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
37-387 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=17)
402-452 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
junction support: 1 umis using 11 reads
cdr3 = CARDFPGNYFTFDIW at 376, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 123
start codons at 37, 81, 161, 231, 433
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1654 = ACACCGGTCAGGTTCA-1

using 180 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 5, 169]
surviving nonsolo ucounts = 1[169]
ids = [6]

====================================================================================

UMI info for barcode ACACCGGTCAGGTTCA-1 contig 1 = GGAAGCTCAG...
umi GATACTCCAC = 1 reads: -21 +17 -5X +21 -2X +11 -314 invalidated
umi TCACAGTATT = 170 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=473]
0-54 ==> 2-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
54-405 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=3)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
445-473 ==> 0-28 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CAAWDDSLSARYVF at 375, score = 7 + 8
umis assigned: [4, 6]
of which 1 are surviving nonsolos
reads assigned: 169
start codons at 54, 208, 358, 383, 388, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1666 = ACACCGGTCCGGCACA-1

using 21 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1667 = ACACCGGTCCTACAGA-1

using 31 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[7, 19]
surviving nonsolo ucounts = 1[19]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1674 = ACACCGGTCGCATGAT-1

using 56 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 6[2, 3^2, 4, 7, 37]
surviving nonsolo ucounts = 1[37]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1675 = ACACCGGTCGGATGTT-1

using 488 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 188, 293]
surviving nonsolo ucounts = 2[188, 293]
ids = [3, 7]

====================================================================================

UMI info for barcode ACACCGGTCGGATGTT-1 contig 1 = GGGAGGAACT...
umi CGCTTGCCAG = 186 reads: +382 validated
umi TTTAGTAAAC = 287 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=477]
0-35 ==> 12-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
35-380 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
379-417 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
417-477 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 78 reads
cdr3 = CQQRSNWPFTF at 356, score = 9 + 8
umis assigned: [3, 7]
of which 2 are surviving nonsolos
reads assigned: 469
start codons at 35, 240, 243, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1677 = ACACCGGTCGGCGGTT-1

using 224 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 217]
surviving nonsolo ucounts = 1[217]
ids = [0]

====================================================================================

UMI info for barcode ACACCGGTCGGCGGTT-1 contig 1 = TCTGGCACCA...
umi ACCTGCACTC = 219 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=556]
0-34 ==> 0-34 on |387|IGLV7-46|5'UTR| [len=34] (mis=0)
34-385 ==> 0-351 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=3)
390-428 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
428-556 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLLSYSGARSYVVF at 358, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 34, 242, 341, 389
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1682 = ACACCGGTCTCGTATT-1

using 495 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 223, 266]
surviving nonsolo ucounts = 2[223, 266]
ids = [5, 4]

====================================================================================

UMI info for barcode ACACCGGTCTCGTATT-1 contig 1 = CAGCTTCAGC...
umi TGCTATTCCA = 267 reads: +388 validated
umi TGCTATTTCA = 223 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=493]
0-48 ==> 66-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
48-401 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=8)
398-436 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
436-493 ==> 0-57 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 59 reads
cdr3 = CAVWDDSLKGPVF at 369, score = 8 + 7
umis assigned: [4, 5]
of which 2 are surviving nonsolos
reads assigned: 485
start codons at 48, 352, 377, 382, 423
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1686 = ACACCGGTCTGTCTAT-1

using 328 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 323]
surviving nonsolo ucounts = 1[323]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1691 = ACACTGAAGAACAATC-1

using 234 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2^3, 3^2, 4^2, 210]
surviving nonsolo ucounts = 1[210]
ids = [8]

====================================================================================

UMI info for barcode ACACTGAAGAACAATC-1 contig 1 = AGCTCAGGAA...
umi GGCTCTCTTC = 208 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=535]
0-33 ==> 53-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
33-386 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=10)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
424-535 ==> 0-111 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 32 reads
cdr3 = CQSYDSSNQAVF at 360, score = 6 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 207
start codons at 33, 96, 187, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1696 = ACACTGAAGAGCAATT-1

using 33 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 6, 7, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1700 = ACACTGAAGATAGCAT-1

using 103 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^3, 3, 5, 83]
surviving nonsolo ucounts = 1[83]
ids = [9]

====================================================================================

UMI info for barcode ACACTGAAGATAGCAT-1 contig 1 = GGCAGGGGCA...
umi TAGACCTTGG = 76 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=431]
15-378 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=5)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
junction support: 1 umis using 15 reads
cdr3 = CQQYYSTPQTF at 354, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 76
start codons at 15, 84, 157, 337
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1709 = ACACTGAAGCGTCTAT-1

using 381 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 5[2, 3, 7, 167, 193]
surviving nonsolo ucounts = 2[167, 193]
ids = [2, 11]

====================================================================================

UMI info for barcode ACACTGAAGCGTCTAT-1 contig 1 = GGAGGAACTG...
umi ATCGCCGGCC = 171 reads: +379 validated
umi TCTGAAACTT = 195 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=549]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=7)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 52 reads
cdr3 = CQQYNDWPVF at 355, score = 9 + 6
umis assigned: [2, 11]
of which 2 are surviving nonsolos
reads assigned: 357
start codons at 34, 103, 239, 368, 406, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1710 = ACACTGAAGCTAAACA-1

using 216 reads

====================================================================================

graph has 76 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[4, 5, 11, 13, 177]
surviving nonsolo ucounts = 2[11, 177]
ids = [10, 2]

====================================================================================

UMI info for barcode ACACTGAAGCTAAACA-1 contig 1 = TGAGCGCAGA...
umi CAGGCTATAT = 164 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=436]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=13)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 21 reads
cdr3 = CGAWDTSLSAWVF at 357, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1712 = ACACTGAAGGACCACA-1

using 211 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[211]
surviving nonsolo ucounts = 1[211]
ids = [0]

====================================================================================

UMI info for barcode ACACTGAAGGACCACA-1 contig 1 = GGAAGCTCAG...
umi CACTAGGCCT = 209 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=567]
0-54 ==> 2-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
54-405 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
442-567 ==> 0-125 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CAAWDDSLSGWVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 54, 208, 358, 383, 388
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1713 = ACACTGAAGGACGAAA-1

using 87 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 8[4, 5, 7, 8, 9, 10, 12, 30]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1714 = ACACTGAAGGAGTAGA-1

using 191 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2^2, 3, 4, 5, 14, 158]
surviving nonsolo ucounts = 1[158]
ids = [8]

====================================================================================

UMI info for barcode ACACTGAAGGAGTAGA-1 contig 1 = GCTGGGGTCT...
umi GGAAGGTCTG = 1 reads: -226 +39 -1X +16 -106 invalidated
umi TAGCTTTTTA = 154 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=527]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
429-527 ==> 0-98 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CSSHAGSTRVLF at 365, score = 8 + 8
umis assigned: [6, 8]
of which 1 are surviving nonsolos
reads assigned: 154
start codons at 41, 198, 249, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1720 = ACACTGAAGGGCTTCC-1

using 301 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 7[2^2, 4, 5, 6, 7, 267]
surviving nonsolo ucounts = 1[267]
ids = [7]

====================================================================================

UMI info for barcode ACACTGAAGGGCTTCC-1 contig 1 = ATCAGTCCCA...
umi GTTCGTGGCA = 264 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=440]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-440 ==> 0-29 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 23, 29, 98, 234
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1721 = ACACTGAAGGGTCGAT-1

using 46 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[4^2, 5^2, 7, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1722 = ACACTGAAGTACCGGA-1

using 98 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 10[2^2, 3^3, 4, 5, 7, 10, 51]
surviving nonsolo ucounts = 1[51]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1723 = ACACTGAAGTACGCGA-1

using 102 reads

====================================================================================

graph has 39 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[9, 91]
surviving nonsolo ucounts = 1[91]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1725 = ACACTGAAGTAGTGCG-1

using 200 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[3^2, 4^3, 177]
surviving nonsolo ucounts = 1[177]
ids = [4]

====================================================================================

UMI info for barcode ACACTGAAGTAGTGCG-1 contig 1 = GCTCTGCTTC...
umi CTGGATCCTT = 171 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=559]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-364 ==> 0-313 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=27)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=8)
442-559 ==> 0-117 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQTYDNGRGSVVF at 375, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 171
start codons at 51, 205, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1726 = ACACTGAAGTCATCCA-1

using 399 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 4, 14, 373]
surviving nonsolo ucounts = 1[373]
ids = [4]

====================================================================================

UMI info for barcode ACACTGAAGTCATCCA-1 contig 1 = GGGGGGGTCT...
umi CCCATACTTG = 370 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=541]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=2)
41-394 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
429-541 ==> 0-112 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CSSYTSSSTLVF at 365, score = 8 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 369
start codons at 41, 198, 242, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1727 = ACACTGAAGTGAACAT-1

using 110 reads

====================================================================================

graph has 169 edges initially, 2 edges after simplification

total ucounts = 31
nonsolo ucounts = 16[2^3, 3^2, 5, 6^5, 7, 9, 10, 11^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1731 = ACACTGAAGTGTACTC-1

using 46 reads

====================================================================================

graph has 51 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[2^2, 4, 5, 7, 10, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1739 = ACACTGAAGTTGTAGA-1

using 229 reads

====================================================================================

graph has 89 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[2^2, 3^3, 4, 207]
surviving nonsolo ucounts = 1[207]
ids = [8]

====================================================================================

UMI info for barcode ACACTGAAGTTGTAGA-1 contig 1 = ACAAGAGGCA...
umi TCCGTCTTCA = 196 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=543]
0-31 ==> 20-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
31-387 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=2)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
422-543 ==> 0-121 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQSYDSSLSGGVF at 355, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 31, 185, 188, 239, 338, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1743 = ACACTGACAAGCCTAT-1

using 540 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 4, 528]
surviving nonsolo ucounts = 1[528]
ids = [6]

====================================================================================

REJECT CONTIGS

TIG 1[bases=437]
16-191 ==> 178-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=8)
188-226 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
226-437 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CGTWDNSLSAGVF at 159, score = 7 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 521
start codons at 167
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1752 = ACACTGACACAGACAG-1

using 1167 reads

====================================================================================

graph has 348 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 4, 242, 344, 572]
surviving nonsolo ucounts = 2[242, 572]
ids = [4, 7]

====================================================================================

UMI info for barcode ACACTGACACAGACAG-1 contig 1 = GAGCTGCTCA...
umi CCTCGATCGG = 242 reads: +385 validated
umi TGATCAATCG = 262 reads: +6 -1XX +49 -1XX +8 -1XX +3 -1XX +15 -1XX +10 -1XX +51 -2X +6 -1XX +40 -1XX +13 -1XX +8 -1XX +12 -1XX +7 -1XX +24 -1XX +5 -1XX +20 -1XX +3 -1XX +2 -1XX +16 -1XX +6 -18 +1 -2XX +2 -2XX +7 -1XX +4 -2XX +8 -2XX +4 -1XX +7 invalidated
umi TGCATTATAT = 549 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=482]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-482 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 122 reads
cdr3 = CQQYGSSPVTF at 354, score = 9 + 8
umis assigned: [4, 6, 7]
of which 2 are surviving nonsolos
reads assigned: 1019
start codons at 30, 238, 241, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1754 = ACACTGACACATTAGC-1

using 13 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1756 = ACACTGACACCACGTG-1

using 439 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 4, 433]
surviving nonsolo ucounts = 1[433]
ids = [1]

====================================================================================

UMI info for barcode ACACTGACACCACGTG-1 contig 1 = AGTCTGGGCC...
umi GCAACATGCC = 428 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=535]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-385 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=30)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-535 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQVWYSNSDHVVF at 355, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 424
start codons at 40, 235, 242, 338, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1762 = ACACTGACAGACACTT-1

using 1641 reads

====================================================================================

graph has 2303 edges initially, 30 edges after simplification

total ucounts = 682
nonsolo ucounts = 354[2^152, 3^78, 4^35, 5^32, 6^17, 7^12, 8^11, 9^5, 10^3, 11^4, 12, 15, 16^2, 23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1763 = ACACTGACAGAGCCAA-1

using 219 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[216]
surviving nonsolo ucounts = 1[216]
ids = [1]

====================================================================================

UMI info for barcode ACACTGACAGAGCCAA-1 contig 1 = GCTCTGCTTC...
umi CTTCGGAAAG = 215 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=540]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-540 ==> 0-98 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1766 = ACACTGACAGCCACCA-1

using 17 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[7, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1767 = ACACTGACAGGACCCT-1

using 248 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 244]
surviving nonsolo ucounts = 1[244]
ids = [0]

====================================================================================

UMI info for barcode ACACTGACAGGACCCT-1 contig 1 = AGTGCTTTCT...
umi ACAACGCCAA = 243 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=518]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
409-447 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
447-518 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARGLLAARLFYW at 377, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 17, 38, 82, 168
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1769 = ACACTGACAGGTCCAC-1

using 46 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 7[2, 4^2, 5^2, 7, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1772 = ACACTGACAGTATCTG-1

using 117 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 5, 107]
surviving nonsolo ucounts = 1[107]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1775 = ACACTGACATACGCTA-1

using 52 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[4^2, 5, 9, 12, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1781 = ACACTGACATCTACGA-1

using 67 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[3, 5^2, 8, 45]
surviving nonsolo ucounts = 1[45]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1782 = ACACTGACATCTGGTA-1

using 189 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 184]
surviving nonsolo ucounts = 1[184]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1788 = ACACTGACATTCCTCG-1

using 288 reads

====================================================================================

graph has 150 edges initially, 4 edges after simplification

total ucounts = 17
nonsolo ucounts = 9[2, 3, 4^2, 5^2, 9, 17, 231]
surviving nonsolo ucounts = 1[231]
ids = [14]

====================================================================================

UMI info for barcode ACACTGACATTCCTCG-1 contig 1 = GGAGTCAGAC...
umi TGGATTTATG = 233 reads: +385 validated
umi TTGATTTATT = 1 reads: -195X +2 -1 +5 -1X +2 -1 +3 -1 +2 -1X +6 -3 +5 -1 +2 -1 +4 -2 +3 -2X +4 -138 invalidated

GOOD CONTIGS

TIG 1[bases=435]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=25)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
411-435 ==> 0-24 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CHQYNSYSTF at 353, score = 8 + 7
umis assigned: [14, 15]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 26, 32, 88, 101, 237, 240, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1790 = ACACTGAGTAAATGTG-1

using 112 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[110]
surviving nonsolo ucounts = 1[110]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1797 = ACACTGAGTATATGGA-1

using 266 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 3^2, 10, 245]
surviving nonsolo ucounts = 1[245]
ids = [4]

====================================================================================

UMI info for barcode ACACTGAGTATATGGA-1 contig 1 = ACTTTCTGAG...
umi TACTCAGTCA = 241 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=500]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=9)
411-459 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
459-500 ==> 0-41 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CARGAGITTRAYYFDYW at 377, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 14, 35, 79
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1798 = ACACTGAGTCAGGACA-1

using 377 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 135, 234]
surviving nonsolo ucounts = 2[135, 234]
ids = [4, 8]

====================================================================================

UMI info for barcode ACACTGAGTCAGGACA-1 contig 1 = GATCAGGACT...
umi CGGCACTTTC = 135 reads: +397 validated
umi TTACTCACCC = 231 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=508]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
388-427 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
427-508 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 49 reads
cdr3 = CMQALQTPRTF at 366, score = 9 + 8
umis assigned: [4, 8]
of which 2 are surviving nonsolos
reads assigned: 363
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1805 = ACACTGAGTCGAACAG-1

using 236 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 7, 222]
surviving nonsolo ucounts = 1[222]
ids = [4]

====================================================================================

UMI info for barcode ACACTGAGTCGAACAG-1 contig 1 = TGAGCGCAGA...
umi TCCACTATCG = 218 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=520]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=13)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-520 ==> 0-96 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CGAWDTSLSAWVF at 357, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1816 = ACACTGAGTGGTCCGT-1

using 193 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 190]
surviving nonsolo ucounts = 1[190]
ids = [0]

====================================================================================

UMI info for barcode ACACTGAGTGGTCCGT-1 contig 1 = AGCTTCAGCT...
umi CACTTCGCTT = 192 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=496]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-496 ==> 0-61 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 186
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1821 = ACACTGAGTTCGGCAC-1

using 207 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 201]
surviving nonsolo ucounts = 1[201]
ids = [1]

====================================================================================

UMI info for barcode ACACTGAGTTCGGCAC-1 contig 1 = AGTCTCAGTC...
umi CGCCCCAGCG = 198 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=452]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
408-452 ==> 0-44 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQTYSTPTSF at 347, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 20, 26, 82, 95, 231
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1826 = ACACTGATCACTTACT-1

using 271 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[267]
surviving nonsolo ucounts = 1[267]
ids = [0]

====================================================================================

UMI info for barcode ACACTGATCACTTACT-1 contig 1 = GGGAGGAACT...
umi ATTCAGTGTC = 263 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=559]
0-35 ==> 12-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
35-380 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
385-423 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQRSNWPPGSTF at 356, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 35, 240, 243, 465
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1827 = ACACTGATCAGAGACG-1

using 162 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[5^2, 10, 138]
surviving nonsolo ucounts = 1[138]
ids = [1]

====================================================================================

UMI info for barcode ACACTGATCAGAGACG-1 contig 1 = CTGGGCCTCA...
umi AGCTGGCAAA = 136 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=530]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-377 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
378-416 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
416-530 ==> 0-114 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQAWDSSTGVVF at 352, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 135
start codons at 37, 42, 98, 185, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1832 = ACACTGATCCAAACTG-1

using 541 reads

====================================================================================

graph has 130 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 3, 63, 122, 154, 192]
surviving nonsolo ucounts = 4[63, 122, 154, 192]
ids = [9, 2, 8, 10]

====================================================================================

UMI info for barcode ACACTGATCCAAACTG-1 contig 1 = GGGGGGGGTC...
umi CTCTAAAGAG = 120 reads: +355 -1 +29 non-validated
umi TCGAGTATCG = 188 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=512]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=3)
42-383 ==> 0-341 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=15)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
427-512 ==> 0-85 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 40 reads
cdr3 = CSSYAGASWVF at 366, score = 7 + 8
umis assigned: [2, 10]
of which 2 are surviving nonsolos
reads assigned: 307
start codons at 42, 193, 199, 250, 253, 349, 376
confident = true

REJECT CONTIGS

TIG 1[bases=479]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
0-50 ==> 11314-11364 on rc of segment before IGHV3-19 exon 1 [len=11364] (mis=1)
36-68 ==> 10108-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-479 ==> 12-39 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [8, 9]
of which 2 are surviving nonsolos
reads assigned: 212
start codons at 50, 248, 253, 270, 314, 347
confident = false
VJ delta = 6
not full
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1833 = ACACTGATCCAAATGC-1

using 114 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[114]
surviving nonsolo ucounts = 1[114]
ids = [0]

====================================================================================

UMI info for barcode ACACTGATCCAAATGC-1 contig 1 = GGGGTCTCAG...
umi TCTAAAGAGT = 112 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=446]
0-38 ==> 4-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
38-379 ==> 0-341 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=15)
385-423 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
423-446 ==> 0-23 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CSSYAGASWVF at 362, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 112
start codons at 38, 189, 195, 246, 249, 345, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1835 = ACACTGATCCCATTAT-1

using 278 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[276]
surviving nonsolo ucounts = 1[276]
ids = [1]

====================================================================================

UMI info for barcode ACACTGATCCCATTAT-1 contig 1 = GATCAGGACT...
umi TATTTTGTAT = 268 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=495]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-495 ==> 0-65 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1841 = ACACTGATCCTTGACC-1

using 313 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[310]
surviving nonsolo ucounts = 1[310]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1865 = ACACTGATCTTGTACT-1

using 43 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 34]
surviving nonsolo ucounts = 1[34]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1868 = ACAGCCGAGAGCTTCT-1

using 240 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 4, 233]
surviving nonsolo ucounts = 1[233]
ids = [3]

====================================================================================

UMI info for barcode ACAGCCGAGAGCTTCT-1 contig 1 = TGGGGGATCA...
umi TCAGTAGTAA = 226 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=521]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
397-435 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
435-521 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CMQALQTPTWTF at 371, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 35, 68, 104, 192, 354, 374, 477
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1871 = ACAGCCGAGCAGACTG-1

using 212 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[7, 204]
surviving nonsolo ucounts = 1[204]
ids = [2]

====================================================================================

UMI info for barcode ACAGCCGAGCAGACTG-1 contig 1 = GGCAGTCTCA...
umi TGCCTTTTCT = 198 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=419]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=1)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=0)
376-414 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQQSYSTPPFTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 23, 29, 85, 98, 234
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1872 = ACAGCCGAGCCACGCT-1

using 498 reads

====================================================================================

graph has 216 edges initially, 6 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[3, 5, 7, 96, 382]
surviving nonsolo ucounts = 2[96, 382]
ids = [0, 2]

====================================================================================

UMI info for barcode ACAGCCGAGCCACGCT-1 contig 1 = GAGCTACAAC...
umi AAAGTGCAGC = 94 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
403-430 ==> 12-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 93
start codons at 27, 30, 85, 99, 352, 382, 472
confident = false

REJECT CONTIGS

TIG 1[bases=480]
11-42 ==> 5730-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=2)
17-66 ==> 0-49 on |285|IGKV3-7|L-REGION+V-REGION| [len=348] (mis=0)
62-308 ==> 102-348 on |285|IGKV3-7|L-REGION+V-REGION| [len=348] (mis=2)
305-344 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
344-480 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 377
start codons at 17, 168, 386
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1878 = ACAGCCGAGCTGTCTA-1

using 60 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 9, 47]
surviving nonsolo ucounts = 1[47]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1882 = ACAGCCGAGGCCATAG-1

using 1026 reads

====================================================================================

graph has 405 edges initially, 24 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[4, 5^2, 7, 354, 649]
surviving nonsolo ucounts = 2[354, 649]
ids = [3, 0]

====================================================================================

UMI info for barcode ACAGCCGAGGCCATAG-1 contig 1 = GGAGTCAGTC...
umi CGTACACTGT = 375 reads: +110 -1XX +277 invalidated

UMI info for barcode ACAGCCGAGGCCATAG-1 contig 2 = GCAGGAGTCA...
umi CACTTGCCCC = 649 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=28)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CHQYESVPYTF at 353, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 350
start codons at 26, 32, 88, 101, 240, 336, 363, 456
confident = false

TIG 2[bases=553]
0-29 ==> 18-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
29-380 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 112 reads
cdr3 = CQQSYRRPITF at 356, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 635
start codons at 29, 35, 91, 104, 240, 339, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1884 = ACAGCCGAGGGATCTG-1

using 163 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 157]
surviving nonsolo ucounts = 1[157]
ids = [2]

====================================================================================

UMI info for barcode ACAGCCGAGGGATCTG-1 contig 1 = CCACATCCCT...
umi AATTCCGTGT = 153 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=552]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
42-395 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=16)
409-457 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
457-552 ==> 0-95 on |40|IGHG1|C-REGION| [len=884] (mis=2)
junction support: 1 umis using 18 reads
cdr3 = CARGVARHDPFDFW at 384, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 151
start codons at 42, 193, 240, 245, 262, 339, 406
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1893 = ACAGCCGAGTGTACTC-1

using 352 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3^2, 345]
surviving nonsolo ucounts = 1[345]
ids = [0]

====================================================================================

UMI info for barcode ACAGCCGAGTGTACTC-1 contig 1 = GGGGAGTCAG...
umi CAAGGATTCC = 345 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQSYTTLLTF at 355, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 341
start codons at 28, 34, 90, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1895 = ACAGCCGAGTGTTGAA-1

using 232 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[227]
surviving nonsolo ucounts = 1[227]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1903 = ACAGCCGCAAGACGTG-1

using 47 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[3^2, 4, 7^2, 8, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1904 = ACAGCCGCAAGCTGTT-1

using 363 reads

====================================================================================

graph has 178 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 4, 354]
surviving nonsolo ucounts = 1[354]
ids = [2]

====================================================================================

UMI info for barcode ACAGCCGCAAGCTGTT-1 contig 1 = GAATCAGACC...
umi GATGATTTCG = 323 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
0-25 ==> 2-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
413-503 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQYDSYPFTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 313
start codons at 25, 31, 87, 100, 236, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1908 = ACAGCCGCACAGGAGT-1

using 18 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1912 = ACAGCCGCACGCTTTC-1

using 183 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^4, 170]
surviving nonsolo ucounts = 1[170]
ids = [2]

====================================================================================

UMI info for barcode ACAGCCGCACGCTTTC-1 contig 1 = GAGCTACAAC...
umi AGATACACCA = 159 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=481]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-481 ==> 0-51 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 158
start codons at 27, 30, 85, 99, 352, 382, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1916 = ACAGCCGCAGCTCGAC-1

using 927 reads

====================================================================================

graph has 260 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 2[2, 916]
surviving nonsolo ucounts = 1[916]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1920 = ACAGCCGCAGTAAGCG-1

using 351 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 348]
surviving nonsolo ucounts = 1[348]
ids = [0]

====================================================================================

UMI info for barcode ACAGCCGCAGTAAGCG-1 contig 1 = GATCAGGACT...
umi GTAACGAGTA = 322 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=491]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-491 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1921 = ACAGCCGCAGTGACAG-1

using 463 reads

====================================================================================

graph has 137 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 193, 261]
surviving nonsolo ucounts = 2[193, 261]
ids = [5, 7]

====================================================================================

UMI info for barcode ACAGCCGCAGTGACAG-1 contig 1 = GGCATCACTC...
umi TCTGGGGGTT = 188 reads: +406 validated

UMI info for barcode ACAGCCGCAGTGACAG-1 contig 2 = GGCTGGGGTC...
umi TTTTTTCTCT = 259 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=522]
61-414 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=35)
421-467 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=8)
467-522 ==> 0-55 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CVRRFLGFDSW at 403, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 61, 259, 264, 358
confident = false

TIG 2[bases=518]
42-395 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
395-433 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
433-518 ==> 0-85 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CSSYTSSSTLRVF at 366, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 42, 199, 243, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1928 = ACAGCCGCATGATCCA-1

using 56 reads

====================================================================================

graph has 74 edges initially, 10 edges after simplification

total ucounts = 14
nonsolo ucounts = 7[2, 4^2, 6, 7, 8, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1933 = ACAGCCGCATGTCTCC-1

using 195 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[195]
surviving nonsolo ucounts = 1[195]
ids = [0]

====================================================================================

UMI info for barcode ACAGCCGCATGTCTCC-1 contig 1 = GCTCTGCTTC...
umi AACGCAGTGC = 191 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=614]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=8)
407-445 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
445-614 ==> 0-169 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQSYDISLSAHVVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 51, 205, 208, 259, 358, 385, 406
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1935 = ACAGCCGGTAAATGTG-1

using 278 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 4, 266]
surviving nonsolo ucounts = 1[266]
ids = [6]

====================================================================================

UMI info for barcode ACAGCCGGTAAATGTG-1 contig 1 = GAGTCAGACC...
umi TGCCGGTTAG = 259 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=451]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
419-451 ==> 0-32 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQHYNSFFLRYIF at 352, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 25, 31, 87, 100, 236, 332
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1937 = ACAGCCGGTACCGAGA-1

using 4095 reads

====================================================================================

graph has 3617 edges initially, 30 edges after simplification

total ucounts = 581
nonsolo ucounts = 246[2^113, 3^48, 4^30, 5^13, 6^7, 7^8, 8^2, 9^2, 10, 11, 14, 18, 20, 35, 42, 54, 66, 87, 101, 151, 162, 174, 184, 187, 210, 216, 233, 236, 257, 301, 303]
surviving nonsolo ucounts = 16[35, 42, 66, 101, 151, 162, 174, 184, 187, 210, 216, 233, 236, 257, 301, 303]
ids = [230, 510, 575, 476, 281, 394, 362, 458, 179, 329, ...]

====================================================================================

UMI info for barcode ACAGCCGGTACCGAGA-1 contig 1 = TGGGGAGTCC...
umi CATAACTGAC = 307 reads: +382 validated
umi TACTATCCTC = 209 reads: +382 validated
umi TCACTATCAG = 303 reads: +382 validated
umi TCGAATGGTC = 155 reads: +18 -4XX +2 -4XX +1 -2XX +1 -2XX +2 -1XX +1 -2XX +1 -2XX +2 -1XX +264 -2 +2 -1 +4 -1 +2 -1 +1 -1 +3 -1 +4 -1 +2 -1 +4 -1 +6 -1X +1 -1 +5 -26 invalidated
umi TCTACTATTA = 182 reads: +382 validated
umi TGTTTTAGCC = 29 reads: +29 -2XX +1 -2XX +2 -1XX +1 -2XX +1 -2XX +2 -1XX +214 -122 invalidated
umi TTTAAGGTTG = 262 reads: +382 validated
umi TTTTCATCAT = 67 reads: +382 validated

UMI info for barcode ACAGCCGGTACCGAGA-1 contig 2 = AGCCCTCAGA...
umi AAATTACCTT = 231 reads: +428 -2 non-validated
umi CCGCCCGTTA = 189 reads: +201 -4XX +1 -1XX +223 invalidated
umi CTATAAGGCA = 31 reads: +307 -1 +1 -1X +62 -33 +25 invalidated
umi GACCGAGGCG = 153 reads: +430 validated
umi GGCTTCCTAC = 205 reads: +430 validated
umi GTTGCCAATC = 170 reads: +430 validated
umi TAGCTCGTGC = 159 reads: +430 validated
umi TGACCCTCCT = 97 reads: +405 -1 +14 -10 non-validated

GOOD CONTIGS

TIG 1[bases=549]
31-279 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=35)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 6 umis using 182 reads
cdr3 = CLHYDNRRRTF at 352, score = 9 + 8
umis assigned: [142, 391, 420, 451, 458, 510, 562, 575]
of which 8 are surviving nonsolos
reads assigned: 1488
start codons at 31, 87, 100, 239, 362, 455
confident = true

TIG 2[bases=549]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=1)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=37)
463-509 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
509-549 ==> 0-40 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 5 umis using 52 reads
cdr3 = CARESYVGLYSSTSYPDYW at 421, score = 8 + 7
umis assigned: [4, 179, 230, 281, 329, 362, 394, 476]
of which 8 are surviving nonsolos
reads assigned: 1200
start codons at 79, 228, 235, 314, 356, 382, 437
confident = true
now this is a cell
paired!

GCTGTGTATTACTGTGCGAGAGAATCTTATGTCGGGCTCTATTCTTCAACCAGTTATCCCGACTACTGGGGTCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GTCTCCAGCCTGCAACCTGAAGATTTTGCCACCTATTATTGTCTACACTATGATAATCGCCGTCGCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1944 = ACAGCCGGTCAACTGT-1

using 285 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2^2, 274]
surviving nonsolo ucounts = 1[274]
ids = [8]

====================================================================================

UMI info for barcode ACAGCCGGTCAACTGT-1 contig 1 = GAGTCAGTCT...
umi TTTCGATATG = 262 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=477]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
413-477 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQSYTTLLTF at 352, score = 9 + 9
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1949 = ACAGCCGGTCCAGTTA-1

using 279 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2^3, 4, 261]
surviving nonsolo ucounts = 1[261]
ids = [6]

====================================================================================

UMI info for barcode ACAGCCGGTCCAGTTA-1 contig 1 = GGAGGAGTCA...
umi TAAAAATGGG = 265 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=1)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=18)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CLQDHNYPYTF at 356, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 29, 35, 91, 104, 186, 236, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1952 = ACAGCCGGTCGAACAG-1

using 234 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[5, 6^2, 215]
surviving nonsolo ucounts = 1[215]
ids = [0]

====================================================================================

UMI info for barcode ACAGCCGGTCGAACAG-1 contig 1 = GGTAGCTCAG...
umi ACCCTGAATT = 217 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=496]
0-36 ==> 50-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
36-389 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=4)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
427-496 ==> 0-69 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQSYDSSINWVF at 363, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 36, 99, 190, 241, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1953 = ACAGCCGGTCGACTAT-1

using 3709 reads

====================================================================================

graph has 3550 edges initially, 58 edges after simplification

total ucounts = 1167
nonsolo ucounts = 420[2^198, 3^105, 4^48, 5^22, 6^10, 7^9, 8^3, 9^8, 10, 11^2, 12^2, 14^2, 15^2, 18, 20, 25, 91, 172, 184, 430, 676]
surviving nonsolo ucounts = 5[91, 172, 184, 430, 676]
ids = [940, 789, 954, 459, 685]

====================================================================================

REJECT CONTIGS

TIG 1[bases=421]
8-175 ==> 189-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=6)
172-210 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
210-421 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
cdr3 = CQSYDTSLSGSVF at 143, score = 8 + 8
umis assigned: [685, 789]
of which 2 are surviving nonsolos
reads assigned: 691
start codons at 27, 126, 153
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1956 = ACAGCCGGTCTAGAGG-1

using 270 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[267]
surviving nonsolo ucounts = 1[267]
ids = [1]

====================================================================================

UMI info for barcode ACAGCCGGTCTAGAGG-1 contig 1 = GAGTCAGTCC...
umi CCCTTTGGGT = 247 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=487]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=23)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
413-487 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQYDDLPITF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 25, 31, 87, 100, 362, 365, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1957 = ACAGCCGGTGACGGTA-1

using 66 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 60]
surviving nonsolo ucounts = 1[60]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=408]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-31 ==> 5706-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
380-408 ==> 0-28 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 57
start codons at 30, 238, 364
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1961 = ACAGCCGGTGCTCTTC-1

using 19 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1968 = ACAGCCGGTTCCCTTG-1

using 346 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[11, 334]
surviving nonsolo ucounts = 1[334]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1974 = ACAGCCGTCAACGCTA-1

using 490 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[488]
surviving nonsolo ucounts = 1[488]
ids = [2]

====================================================================================

UMI info for barcode ACAGCCGTCAACGCTA-1 contig 1 = GCTGGGGTCT...
umi TTGTTTTAAC = 500 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=640]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
429-640 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 74 reads
cdr3 = CSSHAGSTRVLF at 365, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 485
start codons at 41, 198, 249, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1980 = ACAGCCGTCACTCCTG-1

using 219 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[3, 4, 10, 196]
surviving nonsolo ucounts = 1[196]
ids = [8]

====================================================================================

UMI info for barcode ACAGCCGTCACTCCTG-1 contig 1 = TGAGCGCAGA...
umi TTAGTCCACT = 192 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=537]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=10)
386-424 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
424-537 ==> 0-113 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CGTWDSSLSVYVF at 357, score = 7 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 36, 190, 241, 365, 388
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1986 = ACAGCCGTCCAAGTAC-1

using 11 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1987 = ACAGCCGTCCACTCCA-1

using 259 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2^2, 3, 8, 236]
surviving nonsolo ucounts = 1[236]
ids = [9]

====================================================================================

UMI info for barcode ACAGCCGTCCACTCCA-1 contig 1 = AGGAATCAGA...
umi GGATCGGTAC = 232 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=468]
0-27 ==> 0-27 on |245|IGKV1D-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |246|IGKV1D-16|L-REGION+V-REGION| [len=351] (mis=7)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
415-468 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQQYDSFPPTF at 354, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 27, 33, 89, 102, 238, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1989 = ACAGCCGTCCCTTGCA-1

using 303 reads

====================================================================================

graph has 132 edges initially, 10 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^3, 4, 287]
surviving nonsolo ucounts = 2[4, 287]
ids = [9, 3]

====================================================================================

UMI info for barcode ACAGCCGTCCCTTGCA-1 contig 1 = GGAGAAGAGC...
umi ATACTTGGGA = 276 reads: +385 validated
umi TTATCCTAGG = 2 reads: -323 +9 -1XX +3 -2XX +1 -1XX +1 -4XX +3 -3XX +24 -1XX +3 -6 invalidated

GOOD CONTIGS

TIG 1[bases=497]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
421-497 ==> 0-76 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYGSSPVTF at 360, score = 9 + 8
umis assigned: [3, 9]
of which 2 are surviving nonsolos
reads assigned: 275
start codons at 36, 244, 247, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1992 = ACAGCCGTCCGTAGGC-1

using 122 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[122]
surviving nonsolo ucounts = 1[122]
ids = [0]

====================================================================================

UMI info for barcode ACAGCCGTCCGTAGGC-1 contig 1 = TGGGGTCACA...
umi ATATGCCTCT = 122 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=464]
0-39 ==> 123-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
39-379 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
395-433 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
433-464 ==> 0-31 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CCSEAGGGVPGLLF at 363, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 120
start codons at 39, 193
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.1997 = ACAGCCGTCGAGAGCA-1

using 478 reads

====================================================================================

graph has 168 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[211, 264]
surviving nonsolo ucounts = 2[211, 264]
ids = [1, 3]

====================================================================================

UMI info for barcode ACAGCCGTCGAGAGCA-1 contig 1 = GGAGGAACTG...
umi GTACATTTAT = 204 reads: +379 validated

UMI info for barcode ACAGCCGTCGAGAGCA-1 contig 2 = GGGGATCAGT...
umi GTTAACCTTA = 249 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=5)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
413-494 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQQRSKWFTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 34, 239, 242, 455
confident = false

TIG 2[bases=496]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-496 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2001 = ACAGCCGTCGCTTGTC-1

using 174 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 10[2^3, 3^2, 4, 6, 8, 10, 129]
surviving nonsolo ucounts = 1[129]
ids = [3]

====================================================================================

UMI info for barcode ACAGCCGTCGCTTGTC-1 contig 1 = CAGGACAATC...
umi CAGATCTACG = 126 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=510]
16-369 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=10)
366-404 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
404-510 ==> 0-106 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CAVWDDSLNGVVF at 337, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 123
start codons at 16, 227, 320, 345, 350, 362
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2006 = ACAGCCGTCTCAACTT-1

using 175 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 9[2^6, 3, 5, 146]
surviving nonsolo ucounts = 4[2^2, 3, 146]
ids = [1, 3, 10, 11]

====================================================================================

UMI info for barcode ACAGCCGTCTCAACTT-1 contig 1 = GAGGAATCAG...
umi ACATAACTAT = 2 reads: +2 -245 +5 -1 +12 -1 +7 -1 +18 -1 +10 -85 non-validated
umi ACTTAACAAT = 2 reads: -110 +56 -124 +56 -42 non-validated
umi ACTTAACTGT = 1 reads: -74 +17 -1 +9 -1 +7 -1 +17 -2X +1 -258 invalidated
umi CCTTAACAAA = 3 reads: -29 +1 -1 +54 -37 +2 -1 +5 -1 +5 -2 +58 -192 non-validated
umi CCTTAACTAT = 141 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=467]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-467 ==> 0-51 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [1, 3, 4, 10, 11]
of which 4 are surviving nonsolos
reads assigned: 147
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2010 = ACAGCCGTCTCTGAGA-1

using 10 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2011 = ACAGCCGTCTCTGTCG-1

using 305 reads

====================================================================================

graph has 98 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 100, 197]
surviving nonsolo ucounts = 2[100, 197]
ids = [3, 1]

====================================================================================

UMI info for barcode ACAGCCGTCTCTGTCG-1 contig 1 = GAATCAGTCC...
umi AATGGCCGTT = 179 reads: +388 validated

UMI info for barcode ACAGCCGTCTCTGTCG-1 contig 2 = GGAGAAGAGC...
umi ATAAGTGCGC = 101 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=414]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 30 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 25, 31, 100, 236
confident = false

TIG 2[bases=483]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
383-421 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
421-483 ==> 0-62 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CQQYGSSPPTF at 360, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 98
start codons at 36, 244, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2018 = ACAGCTAAGAACAATC-1

using 25 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[8, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2023 = ACAGCTAAGACTGTAA-1

using 834 reads

====================================================================================

graph has 258 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 291, 537]
surviving nonsolo ucounts = 2[291, 537]
ids = [2, 5]

====================================================================================

UMI info for barcode ACAGCTAAGACTGTAA-1 contig 1 = TGGGGAGGAA...
umi CTCCACTTCT = 292 reads: +388 validated
umi TTGGTAGAAC = 532 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 127 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [2, 5]
of which 2 are surviving nonsolos
reads assigned: 812
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2029 = ACAGCTAAGATGTGTA-1

using 597 reads

====================================================================================

graph has 260 edges initially, 20 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[5, 7, 285, 297]
surviving nonsolo ucounts = 2[285, 297]
ids = [1, 6]

====================================================================================

UMI info for barcode ACAGCTAAGATGTGTA-1 contig 1 = AGGAGTCAGT...
umi TCGAGGTAGT = 292 reads: +89 -1XX +298 invalidated

UMI info for barcode ACAGCTAAGATGTGTA-1 contig 2 = AGGAGTCAGT...
umi AAATCGTTTG = 270 reads: +55 -1XX +332 invalidated

GOOD CONTIGS

TIG 1[bases=493]
0-27 ==> 20-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=20)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
415-493 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQTYTNLFTF at 354, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 27, 33, 89, 102, 238, 457
confident = false

TIG 2[bases=493]
0-27 ==> 20-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=10)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
415-493 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQSYRRPITF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 27, 33, 89, 102, 238, 337, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2036 = ACAGCTAAGCCGTCGT-1

using 251 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 7, 14, 223]
surviving nonsolo ucounts = 1[223]
ids = [1]

====================================================================================

UMI info for barcode ACAGCTAAGCCGTCGT-1 contig 1 = GATCAGGACT...
umi ACTCAAATAG = 215 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=430]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 30, 63, 99, 187, 349, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2037 = ACAGCTAAGCCTCGTG-1

using 223 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[220]
surviving nonsolo ucounts = 1[220]
ids = [1]

====================================================================================

UMI info for barcode ACAGCTAAGCCTCGTG-1 contig 1 = GACTACCACC...
umi CTTTGACACC = 213 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=504]
0-30 ==> 33-63 on |297|IGKV5-2|5'UTR| [len=63] (mis=0)
30-375 ==> 0-345 on |298|IGKV5-2|L-REGION+V-REGION| [len=345] (mis=5)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
412-504 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CLQHDNFPWTF at 351, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 30, 120, 178, 181, 186, 289, 334, 361, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2044 = ACAGCTAAGCTGAACG-1

using 1628 reads

====================================================================================

graph has 2404 edges initially, 22 edges after simplification

total ucounts = 704
nonsolo ucounts = 322[2^111, 3^78, 4^49, 5^31, 6^22, 7^9, 8^5, 9^6, 10^2, 11, 12^3, 13, 14^2, 21^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2048 = ACAGCTAAGGCCCTTG-1

using 295 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 292]
surviving nonsolo ucounts = 1[292]
ids = [0]

====================================================================================

UMI info for barcode ACAGCTAAGGCCCTTG-1 contig 1 = AGCTTCAGCT...
umi CATTTTCGAG = 290 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=572]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-572 ==> 0-137 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2060 = ACAGCTAAGTCTCGGC-1

using 358 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 350]
surviving nonsolo ucounts = 1[350]
ids = [1]

====================================================================================

UMI info for barcode ACAGCTAAGTCTCGGC-1 contig 1 = GTCAGTCTCA...
umi ATCCTTTGTC = 333 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=469]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
408-469 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQSYSTPSF at 350, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 331
start codons at 23, 29, 85, 98, 234, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2061 = ACAGCTAAGTGAATTG-1

using 77 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[7, 64]
surviving nonsolo ucounts = 1[64]
ids = [7]

====================================================================================

UMI info for barcode ACAGCTAAGTGAATTG-1 contig 1 = AGAGCTGCTC...
umi TTTGTTCTTC = 61 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=472]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
419-472 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 8 reads
cdr3 = CQQYGSSPMYTF at 355, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 59
start codons at 31, 80, 239, 338, 379, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2062 = ACAGCTAAGTGTGGCA-1

using 186 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 181]
surviving nonsolo ucounts = 1[181]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=475]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=2)
16-106 ==> 5828-5918 on rc of segment after IGHV5-78 exon 1 [len=6000] (mis=11)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=20)
431-475 ==> 0-44 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
cdr3 = CARPYNSYWLGFDYW at 401, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 59, 233
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2072 = ACAGCTACAAGTCTAC-1

using 182 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[182]
surviving nonsolo ucounts = 1[182]
ids = [0]

====================================================================================

UMI info for barcode ACAGCTACAAGTCTAC-1 contig 1 = AGCTGTGGGC...
umi TGTACTCGAG = 183 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=563]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=3)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
422-563 ==> 0-141 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CNSRDRSDTQWVF at 355, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 175
start codons at 40, 159, 188, 239, 265, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2083 = ACAGCTACACCGAATT-1

using 16525 reads

====================================================================================

graph has 10561 edges initially, 142 edges after simplification

total ucounts = 2072
nonsolo ucounts = 951[2^368, 3^207, 4^132, 5^76, 6^40, 7^30, 8^12, 9^7, 10^4, 11^3, 12^2, 13^5, 14, 17^3, 18, 19, 22, 26, 34, 37^2, 38, 44, 45, 52, 65, 76, 79, 98, 104, 109, 115, 123, 125, 130, 131, 145, 150, 157, 169, 182, 184, 191, 203, 206, 207, 209, 213, 218, 219, 228, 230, 240, 241, 259, 260, 267, 269, 271, 274^2, 275, 282, 283, 284, 285, 313, 314, 335, 367, 368, 459, 465, 632, 648]
surviving nonsolo ucounts = 44[17, 44, 65, 76, 79, 98, 145, 150, 157, 169, 182, 184, 191, 206, 207, 209, 213, 218, 219, 228, 230, 240, 241, 259, 260, 267, 269, 271, 274^2, 275, 282, 283, 284, 285, 313, 314, 335, 367, 368, 459, 465, 632, 648]
ids = [881, 1697, 1753, 1301, 474, 655, 1231, 367, 1434, 487, ...]

====================================================================================

UMI info for barcode ACAGCTACACCGAATT-1 contig 1 = GAGCTACAAC...
umi AAAAAATGTC = 231 reads: +41 -1XX +358 invalidated
umi ACTACATTGT = 238 reads: +400 validated
umi AGATTTATAG = 271 reads: +400 validated
umi AGCTCTGATC = 209 reads: +400 validated
umi ATACGCCGGC = 240 reads: +400 validated
umi ATACTGCCCA = 216 reads: +400 validated
umi ATAGCCGGTT = 144 reads: +400 validated
umi ATCAGAGCTT = 261 reads: +400 validated
umi CACTTTGCAC = 273 reads: +400 validated
umi CAGAAAGGCC = 389 reads: -363X +1 -2XX +2 -1XX +2 -1XX +3 -3XX +9 -1XX +3 -1XX +8 invalidated
umi CCAATTTGCG = 98 reads: +1 -1 +398 non-validated
umi CCCTTCAACC = 209 reads: +400 validated
umi CCGCCATTTA = 190 reads: +400 validated
umi CTCCCGTCTC = 276 reads: +400 validated
umi GATGCTACCA = 310 reads: +400 validated
umi GCGGACCGGC = 261 reads: +400 validated
umi GGATCTTATG = 185 reads: +400 validated
umi GTAACGGACC = 339 reads: +400 validated
umi GTCGCATGTT = 279 reads: +400 validated
umi GTTTGAGCCT = 267 reads: +400 validated
umi TAGCCACGTA = 314 reads: +400 validated
umi TATGCCTTAC = 214 reads: +400 validated
umi TCACATGTGG = 459 reads: -314X +86 invalidated
umi TCACTTGTTA = 223 reads: +400 validated
umi TCATGTATCG = 280 reads: +400 validated
umi TCATTTAGGG = 285 reads: +400 validated
umi TGCACTTCGC = 259 reads: +400 validated
umi TGTGTGCCGC = 213 reads: +394 -3 +3 non-validated
umi TTAGGAATTC = 273 reads: +400 validated
umi TTTGCATTAG = 371 reads: +334 -1XX +65 invalidated

UMI info for barcode ACAGCTACACCGAATT-1 contig 2 = ATCACCCAGC...
umi ATTATTCCGT = 274 reads: -21X +409 invalidated
umi ATTCTTTTAG = 80 reads: +401 -29 non-validated
umi ATTTTCCGGA = 8 reads: -429 +1 non-validated
umi CTATCAGGCG = 11 reads: -397 +1 -5X +1 -2X +1 -12X +1 -2XX +1 -2XX +1 -3XX +1 invalidated
umi CTGGCGGGCA = 786 reads: -397X +1 -5XX +1 -2XX +1 -1XX +1 -10XX +1 -2XX +1 -2XX +1 -3XX +1 invalidated
umi GGATCTTTAG = 144 reads: +430 validated
umi GTAACCTTCT = 6 reads: -411X +1 -2XX +1 -3XX +1 -5XX +1 -1XX +4 invalidated
umi GTACCGTGCC = 78 reads: +430 validated
umi TAAGATTTCA = 155 reads: +430 validated
umi TAGTCAGCGG = 188 reads: +430 validated
umi TCTACCGTGT = 45 reads: +275 -2 +4 -1 +66 -17 +65 non-validated
umi TGACTCATTC = 66 reads: +373 -39 +3 -1 +10 -1 +2 -1 non-validated
umi TGTTGACCCA = 450 reads: -397 +2 -1X +2 -3XX +2 -3XX +2 -1XX +2 -1XX +2 -2XX +2 -2XX +2 -1XX +3 invalidated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=13)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 26 umis using 655 reads
cdr3 = CQQYFNTPRTF at 369, score = 9 + 8
umis assigned: [0, 235, 292, 312, 361, 366, 367, 386, 579, 583] and 20 others
of which 30 are surviving nonsolos
reads assigned: 7653
start codons at 30, 99, 352, 472
confident = true

TIG 2[bases=670]
0-58 ==> 6-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
58-344 ==> 0-286 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=24)
440-488 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
488-670 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 5 umis using 98 reads
cdr3 = CSRDSSRDCSERSCHFDYW at 400, score = 7 + 7
umis assigned: [459, 474, 487, 881, 951, 1231, 1288, 1301, 1434, 1516] and 3 others
of which 13 are surviving nonsolos
reads assigned: 1990
start codons at 58, 256, 261, 355
confident = true
now this is a cell
paired!

GCCATTTATTATTGTTCGAGAGACTCATCACGGGATTGTAGTGAGCGAAGTTGTCACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCGCAG <==> ATCAGTAACCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTTTAATACTCCTCGTACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2088 = ACAGCTACACGAAATA-1

using 304 reads

====================================================================================

graph has 170 edges initially, 4 edges after simplification

total ucounts = 17
nonsolo ucounts = 11[2^2, 4, 5^2, 6, 7^2, 11, 13, 236]
surviving nonsolo ucounts = 1[236]
ids = [11]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2093 = ACAGCTACAGACACTT-1

using 191 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[191]
surviving nonsolo ucounts = 1[191]
ids = [0]

====================================================================================

UMI info for barcode ACAGCTACAGACACTT-1 contig 1 = GGCTCTGGGA...
umi TTCAATCCCG = 189 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=573]
0-80 ==> 0-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=1)
80-387 ==> 0-307 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=22)
468-531 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=7)
531-573 ==> 0-42 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CTRDIPHRIWFGDVLVYYYYMDVW at 428, score = 10 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 80, 133, 236, 321, 360, 389, 454, 488
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2097 = ACAGCTACAGCCTTGG-1

using 492 reads

====================================================================================

graph has 232 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[179, 313]
surviving nonsolo ucounts = 2[179, 313]
ids = [1, 0]

====================================================================================

UMI info for barcode ACAGCTACAGCCTTGG-1 contig 1 = AGCTCTGAGA...
umi CTAGAAAGCG = 310 reads: +424 validated
umi TTCATGGAGC = 179 reads: +291 -1XX +132 invalidated

GOOD CONTIGS

TIG 1[bases=593]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-593 ==> 0-90 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 2 umis using 61 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 477
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2106 = ACAGCTACATAGGATA-1

using 1384 reads

====================================================================================

graph has 1767 edges initially, 24 edges after simplification

total ucounts = 668
nonsolo ucounts = 281[2^118, 3^63, 4^36, 5^26, 6^16, 7^7, 8^7, 9^3, 11^2, 14, 17^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2132 = ACAGCTAGTCAGGACA-1

using 171 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[169]
surviving nonsolo ucounts = 1[169]
ids = [0]

====================================================================================

UMI info for barcode ACAGCTAGTCAGGACA-1 contig 1 = GCTGGGGTCA...
umi CAAGATATCA = 165 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=460]
0-41 ==> 121-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
41-381 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=2)
394-432 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
432-460 ==> 0-28 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CCSYAGSSTSYVF at 365, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 161
start codons at 41, 180, 242, 249, 375, 396
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2138 = ACAGCTAGTCCGACGT-1

using 341 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[338]
surviving nonsolo ucounts = 1[338]
ids = [2]

====================================================================================

UMI info for barcode ACAGCTAGTCCGACGT-1 contig 1 = GAGGAACTGC...
umi CTCCACGGCT = 340 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQYNNWPPWTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 336
start codons at 33, 102, 238, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2145 = ACAGCTAGTCTTCAAG-1

using 69 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3^2, 59]
surviving nonsolo ucounts = 1[59]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2166 = ACAGCTATCAACGGCC-1

using 275 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 270]
surviving nonsolo ucounts = 1[270]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=514]
0-38 ==> 5-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
10-85 ==> 11269-11344 on segment before IGLV3-6 exon 1 [len=11502] (mis=3)
38-352 ==> 0-314 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=8)
357-379 ==> 16-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
379-514 ==> 0-135 on |305|IGLC1|C-REGION| [len=317] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 38, 99, 168, 186
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2169 = ACAGCTATCAATCTCT-1

using 31 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[31]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2170 = ACAGCTATCACAACGT-1

using 729 reads

====================================================================================

graph has 1048 edges initially, 2 edges after simplification

total ucounts = 351
nonsolo ucounts = 124[2^58, 3^28, 4^12, 5^5, 6^6, 7^2, 8^3, 9^3, 10, 11^3, 12, 13, 60]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2176 = ACAGCTATCAGGTAAA-1

using 1944 reads

====================================================================================

graph has 3133 edges initially, 10 edges after simplification

total ucounts = 840
nonsolo ucounts = 410[2^147, 3^118, 4^54, 5^37, 6^17, 7^11, 8^7, 9^4, 10^8, 11^2, 12^2, 16, 17, 35]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2178 = ACAGCTATCAGTTTGG-1

using 161 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[6, 154]
surviving nonsolo ucounts = 1[154]
ids = [2]

====================================================================================

UMI info for barcode ACAGCTATCAGTTTGG-1 contig 1 = AGCAGAGCTC...
umi TGTCGGTATT = 152 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=566]
25-387 ==> 0-362 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=8)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
422-566 ==> 0-144 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CETWDSNTRVF at 361, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 151
start codons at 25, 189, 344
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2181 = ACAGCTATCATTGCCC-1

using 666 reads

====================================================================================

graph has 282 edges initially, 14 edges after simplification

total ucounts = 17
nonsolo ucounts = 9[2^3, 3^2, 4, 15, 261, 366]
surviving nonsolo ucounts = 3[15, 261, 366]
ids = [0, 8, 11]

====================================================================================

UMI info for barcode ACAGCTATCATTGCCC-1 contig 1 = GGAGGAACTG...
umi CTTAAGTGGC = 351 reads: +382 validated

UMI info for barcode ACAGCTATCATTGCCC-1 contig 2 = AGTCTCAGTC...
umi CAGTTGGCAT = 248 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=488]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
416-488 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQRSNWPLTF at 355, score = 9 + 9
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 342
start codons at 34, 242, 458
confident = false

TIG 2[bases=480]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
408-480 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQSYSTPYTF at 347, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2185 = ACAGCTATCCAGGGCT-1

using 244 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 238]
surviving nonsolo ucounts = 1[238]
ids = [2]

====================================================================================

UMI info for barcode ACAGCTATCCAGGGCT-1 contig 1 = AGCTTCAGCT...
umi TAACCTCTGC = 238 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=517]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=14)
393-431 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
431-517 ==> 0-86 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CAAWDDSQSGVF at 367, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2191 = ACAGCTATCCTTGGTC-1

using 16 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2207 = ACAGCTATCTTCTGGC-1

using 193 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 186]
surviving nonsolo ucounts = 1[186]
ids = [6]

====================================================================================

UMI info for barcode ACAGCTATCTTCTGGC-1 contig 1 = GGGGGCTGGG...
umi TTTCTAATCG = 189 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=479]
45-396 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
395-433 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
433-479 ==> 0-46 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CSSYTSSSTYVF at 369, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 45, 202, 246, 253, 256, 397
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2212 = ACATACGAGACCCACC-1

using 160 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[5, 154]
surviving nonsolo ucounts = 1[154]
ids = [1]

====================================================================================

UMI info for barcode ACATACGAGACCCACC-1 contig 1 = AGAGCTCTGG...
umi CTCTTGGTTC = 146 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=510]
0-22 ==> 38-60 on |373|IGLV4-69|5'UTR| [len=60] (mis=0)
22-381 ==> 0-359 on |374|IGLV4-69|L-REGION+V-REGION| [len=359] (mis=2)
378-416 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
416-510 ==> 0-94 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQTWGTGIVVF at 355, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 145
start codons at 22, 183, 223, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2214 = ACATACGAGATGCCTT-1

using 293 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[288]
surviving nonsolo ucounts = 1[288]
ids = [3]

====================================================================================

UMI info for barcode ACATACGAGATGCCTT-1 contig 1 = GCTCTGCTTC...
umi TCGGACTTGC = 284 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=581]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-581 ==> 0-136 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2219 = ACATACGAGCGTTGCC-1

using 321 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 316]
surviving nonsolo ucounts = 1[316]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2224 = ACATACGAGGCTACGA-1

using 67 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 11[2, 3^2, 4^3, 6, 7, 8, 9, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2230 = ACATACGAGTCAAGGC-1

using 21 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2233 = ACATACGAGTGGACGT-1

using 647 reads

====================================================================================

graph has 268 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[13, 269, 359]
surviving nonsolo ucounts = 2[269, 359]
ids = [6, 4]

====================================================================================

UMI info for barcode ACATACGAGTGGACGT-1 contig 1 = AGAAGCAGAG...
umi CCTTAGCTTT = 351 reads: +382 validated

UMI info for barcode ACATACGAGTGGACGT-1 contig 2 = GGGAATCAGT...
umi GGGTAACGAT = 260 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=573]
0-28 ==> 12-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
28-365 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
372-410 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
410-573 ==> 0-163 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CNSRDSSGNHRVF at 343, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 346
start codons at 28, 147, 176, 227, 326
confident = false

TIG 2[bases=457]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-457 ==> 0-42 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 27, 33, 102, 238
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2237 = ACATACGCAATAGCAA-1

using 274 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[272]
surviving nonsolo ucounts = 1[272]
ids = [0]

====================================================================================

UMI info for barcode ACATACGCAATAGCAA-1 contig 1 = GGGGTCTCAG...
umi CCGTCATTTG = 270 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=511]
0-38 ==> 4-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
38-390 ==> 0-352 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=0)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
426-511 ==> 0-85 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CCSYAGSYTWVF at 362, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 38, 177, 195, 239, 246, 249, 345, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2238 = ACATACGCAATCCAAC-1

using 303 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 11, 286]
surviving nonsolo ucounts = 1[286]
ids = [6]

====================================================================================

UMI info for barcode ACATACGCAATCCAAC-1 contig 1 = GGACTGATCA...
umi TGTTATTATC = 275 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=511]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
394-432 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
432-511 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CMQALQIRETF at 371, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 35, 68, 104, 192, 354, 374, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2240 = ACATACGCAATGGAAT-1

using 838 reads

====================================================================================

graph has 300 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 10, 331, 488]
surviving nonsolo ucounts = 2[331, 488]
ids = [6, 2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=555]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
0-33 ==> 5967-6000 on segment before IGKV3OR2-268 exon 1 [len=6000] (mis=0)
0-33 ==> 5967-6000 on rc of segment after IGKV3-15 exon 1 [len=6000] (mis=0)
6-47 ==> 5709-5750 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 33, 102, 238, 461
confident = false
did not find CDR3

TIG 2[bases=344]
0-39 ==> 47-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
0-39 ==> 5961-6000 on segment before IGLV6-57 exon 1 [len=6000] (mis=0)
31-72 ==> 5820-5861 on segment before IGLV2-34 exon 1 [len=6000] (mis=4)
39-311 ==> 0-272 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=9)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 483
start codons at 39, 102, 193
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2253 = ACATACGCAGATCTGT-1

using 262 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 258]
surviving nonsolo ucounts = 1[258]
ids = [0]

====================================================================================

UMI info for barcode ACATACGCAGATCTGT-1 contig 1 = GGGGTCACAA...
umi ACCTTGATTA = 258 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=502]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-331 ==> 0-293 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=22)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=7)
429-502 ==> 0-73 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CSSYAGRTTFDVF at 362, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 38, 174, 177, 192, 195, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2255 = ACATACGCAGCTGTAT-1

using 30 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 5, 20]
surviving nonsolo ucounts = 1[20]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2272 = ACATACGGTAATCACC-1

using 623 reads

====================================================================================

graph has 266 edges initially, 12 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2^2, 3^2, 291, 320]
surviving nonsolo ucounts = 2[291, 320]
ids = [5, 1]

====================================================================================

UMI info for barcode ACATACGGTAATCACC-1 contig 1 = AGAGCTCTGG...
umi TACTCGGCTG = 296 reads: +388 validated

UMI info for barcode ACATACGGTAATCACC-1 contig 2 = GATCAGGACT...
umi ACTTGGGCTT = 317 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=568]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=9)
394-432 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CHQYGSSPLFTF at 368, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 44, 252, 378, 474
confident = false

TIG 2[bases=560]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
392-424 ==> 6-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CMQALQTPFF at 366, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 30, 63, 99, 187, 349, 369, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2275 = ACATACGGTACCATCA-1

using 198 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 11, 181]
surviving nonsolo ucounts = 1[181]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2286 = ACATACGGTCTTGTCC-1

using 1707 reads

====================================================================================

graph has 899 edges initially, 20 edges after simplification

total ucounts = 159
nonsolo ucounts = 68[2^31, 3^11, 4^8, 5^3, 6^2, 7^4, 9, 13^3, 14, 24, 275, 403, 670]
surviving nonsolo ucounts = 3[275, 403, 670]
ids = [19, 94, 102]

====================================================================================

UMI info for barcode ACATACGGTCTTGTCC-1 contig 1 = GATCAGGACT...
umi AGGTAAAGAC = 268 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=522]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
427-522 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CMQALQTPRTF at 366, score = 9 + 8
umis assigned: [19]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2288 = ACATACGGTGCTCTTC-1

using 717 reads

====================================================================================

graph has 302 edges initially, 12 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 310, 400]
surviving nonsolo ucounts = 2[310, 400]
ids = [5, 1]

====================================================================================

UMI info for barcode ACATACGGTGCTCTTC-1 contig 1 = GAGGAACTGC...
umi CACCGATAAG = 398 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 76 reads
cdr3 = CQQRSNWQGYTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 394
start codons at 33, 238, 241, 460
confident = false

REJECT CONTIGS

TIG 1[bases=532]
0-362 ==> 1-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
359-396 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
396-532 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYYSLLSF at 338, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 321, 438
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2302 = ACATACGTCAATAAGG-1

using 331 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^2, 4, 316]
surviving nonsolo ucounts = 1[316]
ids = [10]

====================================================================================

UMI info for barcode ACATACGTCAATAAGG-1 contig 1 = TGGGGAGAGC...
umi TTAGGAGTAA = 301 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=509]
0-49 ==> 0-49 on |289|IGKV3D-15|5'UTR| [len=49] (mis=3)
49-396 ==> 0-347 on |290|IGKV3D-15|L-REGION+V-REGION| [len=347] (mis=3)
396-434 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
434-509 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYNNWPPATF at 370, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 49, 118, 254, 476
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2307 = ACATACGTCAGTTGAC-1

using 1661 reads

====================================================================================

graph has 2626 edges initially, 10 edges after simplification

total ucounts = 661
nonsolo ucounts = 354[2^154, 3^56, 4^62, 5^25, 6^18, 7^14, 8^8, 9^4, 10^2, 11^2, 12^2, 13, 14, 16^3, 18, 40]
surviving nonsolo ucounts = 1[40]
ids = [436]

====================================================================================

REJECT CONTIGS

TIG 1[bases=338]
0-75 ==> 5-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
0-75 ==> 7071-7146 on rc of segment before IGHVII-30-1 exon 1 [len=7146] (mis=0)
0-75 ==> 7065-7140 on rc of segment before IGHVII-33-1 exon 1 [len=7140] (mis=0)
44-111 ==> 6507-6574 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=2)
75-333 ==> 0-258 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=4)
umis assigned: [436]
of which 1 are surviving nonsolos
reads assigned: 26
start codons at 75, 226, 231, 284, 289, 292, 310
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2308 = ACATACGTCATAACCG-1

using 120 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[120]
surviving nonsolo ucounts = 1[120]
ids = [0]

====================================================================================

UMI info for barcode ACATACGTCATAACCG-1 contig 1 = AGGAACTGCT...
umi CCTTCAGGTC = 114 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=512]
0-32 ==> 65-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
32-377 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-512 ==> 0-98 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CLQYYNWPRTF at 353, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 111
start codons at 32, 87, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2309 = ACATACGTCATACGGT-1

using 1028 reads

====================================================================================

graph has 942 edges initially, 6 edges after simplification

total ucounts = 273
nonsolo ucounts = 114[2^40, 3^22, 4^19, 5^9, 6^5, 7^6, 8^6, 9, 10^2, 11, 19, 44, 379]
surviving nonsolo ucounts = 1[379]
ids = [14]

====================================================================================

UMI info for barcode ACATACGTCATACGGT-1 contig 1 = TACAACAGGC...
umi ACACATCAAA = 368 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=480]
0-26 ==> 149-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
26-389 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
388-426 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
426-480 ==> 0-54 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYYSTLWTF at 365, score = 9 + 8
umis assigned: [14]
of which 1 are surviving nonsolos
reads assigned: 356
start codons at 26, 95, 348, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2315 = ACATACGTCCGCGGTA-1

using 2710 reads

====================================================================================

graph has 1890 edges initially, 18 edges after simplification

total ucounts = 425
nonsolo ucounts = 173[2^67, 3^37, 4^34, 5^11, 6^3, 7^6, 8^2, 9, 10, 15^2, 28, 116, 142, 170, 237, 259, 304, 317, 324]
surviving nonsolo ucounts = 5[237, 259, 304, 317, 324]
ids = [150, 200, 254, 275, 66]

====================================================================================

UMI info for barcode ACATACGTCCGCGGTA-1 contig 1 = TCCCAGCTGT...
umi CCCTACATCG = 238 reads: +418 validated

UMI info for barcode ACATACGTCCGCGGTA-1 contig 2 = GAGTCAGTCC...
umi CTGACACGCC = 256 reads: +400 validated
umi GGATACGCGA = 287 reads: -363X +1 -2X +2 -1XX +6 -2XX +6 -5XX +4 -1XX +2 -1XX +4 invalidated
umi GTATTTCTGA = 317 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=538]
0-49 ==> 187-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=0)
49-402 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=23)
419-467 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
467-538 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARVMVIKGRASDFW at 391, score = 9 + 7
umis assigned: [150]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 49, 205, 243, 266, 352, 403
confident = true

TIG 2[bases=561]
0-25 ==> 33-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
25-376 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=8)
387-425 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=6)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 80 reads
cdr3 = CQHLDSNPPTYPPTF at 352, score = 9 + 8
umis assigned: [200, 254, 275]
of which 3 are surviving nonsolos
reads assigned: 849
start codons at 25, 31, 87, 236, 467
confident = true
now this is a cell
paired!

GCCGAGGACACGGCAGTATATTTCTGTGCAAGAGTTATGGTAATTAAGGGCCGCGCATCTGACTTCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> CAGCCTGAAGATTTTGCGACTTATTTCTGTCAACACCTTGATAGTAACCCTCCAACCTACCCTCCAACCTTCGGCCCAGGGACACGACTGGACATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2342 = ACATCAGAGAGCTTCT-1

using 19 reads

====================================================================================

graph has 36 edges initially, 12 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^3, 3, 6]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2344 = ACATCAGAGATATGCA-1

using 48 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2, 3, 6^3, 10, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2346 = ACATCAGAGATGTCGG-1

using 4982 reads

====================================================================================

graph has 2963 edges initially, 62 edges after simplification

total ucounts = 447
nonsolo ucounts = 201[2^65, 3^35, 4^20, 5^29, 6^4, 7^6, 8^11, 9^4, 10^3, 11^3, 12^2, 13^2, 69, 83, 131, 162, 163, 168, 171, 193, 212, 218, 245, 259, 305, 320, 331, 400, 543]
surviving nonsolo ucounts = 15[83, 131, 163, 168, 171, 193, 212, 218, 245, 259, 305, 320, 331, 400, 543]
ids = [90, 331, 319, 83, 445, 383, 298, 334, 17, 181, ...]

====================================================================================

UMI info for barcode ACATCAGAGATGTCGG-1 contig 1 = AGCACTAGAA...
umi ATAGCTGGGC = 162 reads: +373 -5X +64 invalidated
umi ATCAACCCTC = 77 reads: +128 -1XX +82 -2XX +107 -1XX +28 -1XX +6 -3XX +1 -1XX +1 -8XX +1 -1XX +1 -1XX +1 -67XX invalidated
umi GTCTCTGTTT = 221 reads: +59 -1XX +382 invalidated
umi TATCATGCCG = 129 reads: +403 -39 non-validated
umi TATCGCCCTA = 228 reads: +128 -1XX +82 -2XX +107 -1XX +28 -1XX +6 -3XX +1 -1XX +1 -8XX +1 -1XX +1 -1XX +1 -67XX invalidated
umi TTTTTGACAG = 171 reads: +431 -11 non-validated

UMI info for barcode ACATCAGAGATGTCGG-1 contig 2 = GGGAGAGCCC...
umi AAGGTATAAG = 246 reads: +382 validated
umi ACAAGACGGG = 334 reads: +382 validated
umi CATTTGATCG = 396 reads: +382 validated
umi CGGATCATCA = 256 reads: +382 validated
umi GACTTATTAT = 315 reads: +382 validated
umi GTATCCCTGT = 320 reads: +382 validated
umi TACGGAGTAT = 4 reads: -360 +5 -3X +1 -1X +4 -1X +2 -1X +4 invalidated
umi TGAACTTCGG = 194 reads: +382 validated
umi TTTCGAGGTT = 442 reads: -341X +1 -4X +11 -3XX +8 -1XX +5 -1XX +7 invalidated

GOOD CONTIGS

TIG 1[bases=573]
0-60 ==> 20-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
60-411 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=0)
417-438 ==> 0-21 on |32|IGHD6-13|D-REGION| [len=21] (mis=0)
439-502 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=5)
502-573 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARDQGYSSSWYPSYYYYGMDVW at 402, score = 9 + 7
umis assigned: [83, 90, 298, 331, 334, 445]
of which 6 are surviving nonsolos
reads assigned: 937
start codons at 60, 211, 216, 269, 274, 277, 295, 363, 459
confident = true

TIG 2[bases=565]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
391-429 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 7 umis using 340 reads
cdr3 = CQQRSNWLFTF at 368, score = 9 + 8
umis assigned: [17, 34, 137, 181, 225, 294, 319, 383, 440]
of which 9 are surviving nonsolos
reads assigned: 2454
start codons at 47, 252, 255, 471
confident = true
now this is a cell
paired!

TGTGCGAGAGATCAAGGGTATAGCAGCAGCTGGTACCCCAGTTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCTATTCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2354 = ACATCAGAGCTAAACA-1

using 355 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[4, 5, 6^2, 333]
surviving nonsolo ucounts = 1[333]
ids = [0]

====================================================================================

UMI info for barcode ACATCAGAGCTAAACA-1 contig 1 = GCTGTGGGTC...
umi AAAGCTCTGG = 321 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=577]
0-38 ==> 5-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
38-375 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
376-414 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
414-577 ==> 0-163 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQSADSSGILF at 353, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 38, 99, 168, 186
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2366 = ACATCAGAGTAGCGGT-1

using 46 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[46]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 4.2374 = ACATCAGAGTGTCTCA-1

using 458 reads

====================================================================================

graph has 178 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[3, 4, 6, 8, 434]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!
sorting bam, mem = 0.10
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk004-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk004-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

97.622 seconds used processing barcodes, peak mem = 0.27
